SNX30 inhibits lung adenocarcinoma cell proliferation and induces cell ferroptosis through regulating SETDB1

Abstract

Background

Lung adenocarcinoma is the most common form of lung cancer and one of the most life-threatening malignant tumors. Ferroptosis is an iron-dependent regulatory cell death pathway that is crucial for tumor growth. SNX30 is a key regulatory factor in cardiac development; however, its regulatory mechanism and role in inducing ferroptosis in lung adenocarcinoma remain unclear.

Objective

This study aimed to elucidate the functions and specific mechanisms of action of SNX30 in lung adenocarcinomas.

Methods

SNX30 levels in lung adenocarcinoma cell lines (A549 and HCC827) were determined using reverse transcription quantitative real-time PCR (RT-qPCR) or western blotting. Cell proliferation and apoptosis were assessed by CCK8 and flow cytometry, respectively. The intracellular levels of total iron and Fe²⁺ were detected using Iron Assay Kits. Reactive oxygen species (ROS) levels were evaluated using a DCFH-DA probe and flow cytometry. Cysteine (Cys), glutathione (GSH), and glutathione peroxidase 4 (GPX4) levels were measured using detection assay kits. Other related markers, including Ptgs2, Chac1, SETDB1 cleaved-Caspase3, and Caspase3 were analyzed by RT-qPCR or western blotting.

Results

SNX30 is downregulated in lung adenocarcinoma cell lines. SNX30-plasmid depressed lung adenocarcinoma cell proliferation, accelerated apoptosis, enhanced cleaved-Caspase3 expression and cleaved-Caspase3/Caspase3 ratio. Ferrostatin-1 significantly reversed the effects of the SNX30-plasmid on cell ferroptosis in lung adenocarcinoma, as confirmed by the reduced ROS levels, inhibited intracellular total iron and Fe²⁺ levels, decreased Ptgs2 and Chac1 expression, and increased Cys, GSH, and GPX4 release. We observed that the level of SETDB1 was lower in the SNX30-plasmid group than in the control-plasmid group, whereas the opposite results in ferrostatin-1 treated cells. SNX30 negatively regulates SETDB1 expression in lung adenocarcinoma cells. The upregulation of SETDB1 reversed the effects of the SNX30-plasmid on ferroptosis in lung adenocarcinoma cells.

Conclusion

SNX30 inhibits lung adenocarcinoma cell proliferation and induces ferroptosis by regulating SETDB1 expression.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13019-024-03298-2.

Background

Lung cancer is a malignant tumor originating from the mucous membrane or glands of the bronchial tract [1, 2]. In recent years, the incidence and mortality of lung cancer have increased significantly, and the incidence and mortality of lung cancer in men rank first among all malignant tumors [3]. Lung adenocarcinoma is the most common type of lung cancer; however, bloodborne metastases sometimes occur in the early stages [4]. Immunotherapy has recently been used to treat lung adenocarcinoma, and the potential predictive biomarker for the prognosis and immunotherapy efficacy of lung adenocarcinoma has received more and more attention [5–7]. For example, Xie et al. demonstrated that GPR37 promotes cancer growth by binding to CDK6, and is a new therapeutic target for lung adenocarcinoma [8]. Moreover, Wang et al. revealed that LINC02126 is a potential diagnostic, prognostic, and immunotherapeutic target in lung adenocarcinoma [9]. However, molecular mechanism of lung adenocarcinoma remains unclear. Therefore, it is necessary to understand the pathogenesis, molecular changes, and new therapies for lung adenocarcinoma, as well as explore effective treatment strategies for the lung adenocarcinoma.

Ferroptosis is a newly discovered type of programmed cell death that is distinct from apoptosis, necrosis, and autophagy. Ferroptosis depends on the depletion of glutathione, a decrease in glutathione peroxidase (GPX4) activity, and the inability of lipid oxides to be metabolized through the glutathione reductase reaction catalyzed by GPX4 [10, 11]. Ferroptosis is associated with various pathological diseases, including lung adenocarcinoma. Zhang et al. revealed the essential roles of exosomes and circRNA_101093 in ferroptosis desensitization in lung adenocarcinoma [12]. Zhang et al. also found that ARNTL2 is an indicator of poor prognosis, promotes epithelial-to-mesenchymal transition, and inhibits ferroptosis in lung adenocarcinoma [13]. SNX30 has been reported to be a regulator of ferroptosis in cancer cells; however, its functions of SNX30 in lung adenocarcinoma have not been studied.

SET Domain Bifurcation 1 (SETDB1), also known as ESET/KMT1E, is located on human chromosome 1q2116 and is an oncogenic driver of tumorigenesis. Growing evidence has shown that SETDB1 is strongly associated with the development of tumors, including bladder and colorectal cancers [14, 15]. Previous studies have suggested that SETDB1 functions in lung cancer. For instance, Cui et al. indicated that LINC00476 suppresses the progression of non-small cell lung cancer by inducing the ubiquitination of SETDB1 [16]. Liu et al. reported that SOD1 promotes cell proliferation and metastasis in non-small cell lung cancer via the miR-409-3p/SOD1/SETDB1 pathway [17]. However, the exact mechanism of action of SETDB1 in the progression of lung adenocarcinoma has not yet been elucidated.

Thus, our study aimed to illustrate the latent roles of SNX30 in ferroptosis in lung adenocarcinoma and to clarify the relationship between SNX30 and SETDB1. Our findings provide the first evidence that SNX30 inhibits lung adenocarcinoma cell proliferation and induces cell ferroptosis by regulating SETDB1 expression, thus providing a basis for lung adenocarcinoma therapy.

Materials and methods

Cell culture

A549, HCC827, and BEAS-2B cells were purchased from American Type Culture Collection (ATCC, USA). All cells were seeded in DMEM (Gibco, USA) containing 10% FBS (Gibco) and 1% penicillin/streptomycin (Gibco; USA), and cultured at 37˚C in a 5% CO₂ incubator.

RT-qPCR assay

RNA was extracted from cells and tissues using the TRIzol reagent (EP013, ELK Biotechnology) following the manufacturer’s protocol. Then, the RNA was reverse-transcribed to cDNA using EntiLink ™ 1st Strand cDNA Synthesis Super Mix (Eq. 031, ELK Biotechnology) following the reference synopsis. qRT-PCR analysis was conducted using the EnTurbo™ SYBR Green PCR SuperMix (Eq. 001, ELK Biotechnology) with ABI 7500 Real-Time PCR System (Life technologies). The levels of SNX30, Ptgs2, Chac1, and SETDB1 were determined using the primer sequences listed in Table 1. The relative gene expressions were calculated using 2^−ΔΔCt method.

Table 1.

Primer sequences for PCR

Gene	Sequences(5`-3`)
GAPDH	sense	CATCATCCCTGCCTCTACTGG
	antisense	GTGGGTGTCGCTGTTGAAGTC
Ptgs2	sense	AGATTATGTGCAACACTTGAGTGG
	antisense	ATTCCTACCACCAGCAACCCT
Chac1	sense	GTGGTGACGCTCCTTGAAGAT
	antisense	GCCTCTCGCACATTCAGGTAC
SNX30	sense	AGCTTCGGTGACAAGGATCTC
	antisense	CACACATGCTTCTTGGGATCAT
SETDB1	sense	AGGAACTTCGGCATTTCATCG
	antisense	TGTCCCGGTATTGTAGTCCCA

Western blot assay

A549 and HCC827 cells were seeded in 96-well plates. The cells were then lysed using RIPA buffer (AS1004, ASPEN) for 30 min on ice. Proteins were resolved using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto PVDF membranes (IPVH00010, Millipore). The membranes were blocked with 5% skimmed milk for 2 h and then cultivated with primary antibodies against SNX30 (50 kDa; 1:1000, ab121600, Abcam), cleaved-Caspase3 (17 kDa; 1:500, AF7022, Affbiotech), Caspase3 (35 kDa; 1:1000, ab32351, Abcam), SETDB1(180 kDa; 1:500, ab107225, Abcam), or GAPDH (37 kDa; 1:10000, ab181602, Abcam) at 4 °C overnight. After washing thrice with TBST, the membranes were incubated with secondary antibodies (AS1107, ASPEN) for 2 h. Protein signals were visualized using ECL detection reagents (AS1059, ASPEN) and quantified using ImageJ software version 1.8.0.

Cell transfection

The A549 and HCC827 cells were transfected with control-plasmid (Control CRISPR Activation Plasmid; Santa Cruz; sc-437275), SNX30-plasmid (Santa Cruz; sc-415980-ACT) and SETDB1-plasmid (sc-401325-ACT) using Lipofectamine^® 3000 reagent (Thermo) for 24 h following the instructions. RT-qPCR and western blotting were conducted to evaluate the cell transfection efficiency.

For ferrostatin-1 treatment, A549 and HCC827 cells were treated with 1 µM ferrostatin-1 (Fer-1) at 37˚C for 24 h.

CCK-8 assay

The A549 and HCC827 cells were inoculated into 96 well plates and cultured at 37˚C for 24 h. Each well was added with 10 µL CCK-8 solution and the cells were incubated at 37˚C for 1.5 h. A microplate reader (Diatek) was used to measure optical density (OD) at 450 nm following the direction to determine cell viability.

Flow-cytometry analysis

Flow cytometry was used to analyze apoptosis. The A549 and HCC827 cells were collected by centrifugation at 4℃ for 5 min. The cells were then washed with PBS. Apoptosis was detected using the Annexin-V/propidium iodide (PI) Apoptosis Detection Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Finally, apoptotic cells were quantified using Flow cytometer (BD Biosciences, USA) and analyzed using the Kaluza analysis software (v.2.1.1.20653; Beckman Coulter, Inc.).

ROS assay

DCFH-DA was used to quantify ROS levels, according to the manufacturer’s protocol (E-BC-K138-F, Elabscience). A549 and HCC827 cells were plated in 6-well plates and incubated for 24 h. After washing with PBS for three times, cells were labeled with 5 µM DCFH-DA under standard conditions for 30 min. Finally, fluorescence was examined using a FACSAria II flow cytometer (BD Technologies).

Iron assay

The Iron Assay Kit (Elabscience) was used to detect the total iron (E-BC-K880-M, Elabscience) or Fe²⁺ levels (E-BC-K881-M, Elabscience) in A549 and HCC827 cells. According to the manufacturer’s protocol, the iron assay buffer and iron reducer were sequentially added to the cells. The samples were thoroughly mixed in the dark, added to an iron-reducing agent and iron probe, and cultured for 30 min. Intracellular ferrous levels were quantified using a kit, and the absorbance at 593 nm was calculated as the intracellular Fe²⁺ level.

Cys, GSH, and GPX4 level measurements

A549 and HCC827 cells were gently washed with pre-cooled PBS, separated using trypsin, and centrifuged at 1000 ×g for 5 min. The cells were resuspended in fresh lysis buffer. The levels of Cys, GSH, and GPX4 were detected using the Human Cysteine ELISA Kit (ELK9092, ELK Biotechnology), glutathione assay kit (A006-2-1, Nanjing Jiancheng Bioengineering Institute), and Human GPX4 ELISA Kit (ELK4775, ELK Biotechnology), respectively, following the manufacturer’s instructions.

Statistical analysis

Statistical analyses were conducted using GraphPad Prism software (version 6.0). All findings are displayed by mean ± standard deviation (SD) from three independent experiments. Differences between two groups were estimated using the unpaired Student’s t-test, and the differences among multiple groups were analyzed by the one-way ANOVA test followed by Tukey’s test. *P < 0.05, and **P < 0.01 indicated as significant difference.

Results

SNX30 was down-regulated in lung adenocarcinoma cells lines

First, we detected the levels of SNX30 in lung adenocarcinoma cell lines. The results suggested that SNX30 was downregulated in lung adenocarcinoma cell lines (A549 and HCC827) compared to BEAS-2B cells (Fig. 1A-C), indicating that SNX30 acts as a vital regulator in lung adenocarcinoma.

Fig. 1.

Expression of SNX30 in lung adenocarcinoma cells lines (A and B) Detection of SNX30 expression in lung adenocarcinoma cell lines (A549 and HCC827) and BEAS-2B cells using RT-qPCR and western blotting. (C) SNX30/GAPDH ratio. **P < 0.01. The experiments were independently repeated three times. Data are presented as mean ± SD from three independent experiments

SNX30-plasmid depressed lung adenocarcinoma cells proliferation and accelerated cells apoptosis

We investigated the biological functions of lung adenocarcinoma cells regulated by the SNX30-plasmid. Control plasmid or SNX30-plasmid was transfected into A549 and HCC827 cells, and transfection efficiency was evaluated by RT-qPCR and western blot assays. As shown in Fig. 2A-C, SNX30 was up-regulated in SNX30-plasmid transfected A549 and HCC827 cells. Furthermore, CCK-8 analysis revealed that the SNX30-plasmid remarkably inhibited A549 and HCC827 cell proliferation (Fig. 2D). In addition, SNX30 upregulation enhanced cleaved-Caspase3 expression and the cleaved-Caspase3/Caspase3 ratio (Fig. 2E and F) in lung adenocarcinoma cells compared to the control plasmid group. Flow cytometry analysis revealed that the SNX30-plasmid remarkably enhanced apoptosis in A549 and HCC827 cells (Fig. 2G) compared to the control plasmid group. These data demonstrated that the upregulation of SNX30 had an inhibitory effect on the proliferation of lung adenocarcinoma cells.

Fig. 2.

Effects of SNX30-plasmid on lung adenocarcinoma cells proliferation and apoptosis. A549 and HCC827 cells were transfected with control-plasmid and SNX30-plasmid. (A, B) SNX30 expression was detected by RT-qPCR and western blot assays. (C) SNX30/GAPDH ratio. (D) Cell viability was measured using the CCK-8 assay. (E) Detection of cleaved-Caspase3 and Caspase3 expression by western blotting. (F) cleaved-Caspase3/Caspase3 ratio. (G) Flow cytometric analysis of apoptosis and quantification of apoptotic cells. **P < 0.01. The experiments were independently repeated three times. Data are presented as mean ± SD from three independent experiments

SNX30-plasmid induced ferroptosis in lung adenocarcinoma cells

Ferroptosis is a form of iron-dependent cell death that differs from necrosis and apoptosis, and is characterized mainly by lipid peroxidation. Previous report has found that ferrostatin-1 is a specific aromatic amine binding lipid ROS and protects cells against lipid peroxidation [18]. Thus, we investigated the function of SNX30 in ferroptosis in lung adenocarcinoma cells. Our data revealed that the SNX30-plasmid significantly increased ROS levels (Fig. 3A), intracellular levels of total iron (Fig. 3B), and Fe²⁺ levels (Fig. 3C) in A549 and HCC827 cells compared with the control plasmid group. Further mechanistic experiments suggested that the SNX30-plasmid suppressed the release of Cys, GSH, and GPX4, in contrast to the control plasmid (Fig. 3D-F). We also measured the expression of ferroptosis-related genes, including Ptgs2 and Chac1. As shown in Fig. 3G and H, Ptgs2 and Chac1 were up-regulated in SNX30-plasmid treated lung adenocarcinoma cells. However, treatment with ferrostatin-1 significantly reversed all the effects of the SNX30-plasmid on cell ferroptosis in lung adenocarcinoma cells.

Fig. 3.

Effects of SNX30-plasmid and ferrostatin-1 on lung adenocarcinoma cells ferroptosis. A549 and HCC827 cells were transfected with control-plasmid and SNX30-plasmid, followed by treated with 1 µM ferrostatin-1. (A) ROS levels were measured. Total iron (B) and ferrous iron (C) levels in lung adenocarcinoma cells were analyzed. GSH (D), Cys (E), and GPX4 (F) levels in lung adenocarcinoma cell lines. (G and H) qRT-PCR analysis of Ptgs2 and Chac1 expression. **P < 0.01. The experiments were independently repeated three times. Data are presented as mean ± SD from three independent experiments

Ferrostatin-1 reversed the effects of SNX30-plasmid on SETDB1 expression

Increasing evidence demonstrates that abnormal regulation of SETDB1 is tightly linked to various human cancers [19]. we evaluated the expression of SETDB1 in SNX30-plasmid transfected A549 and HCC827 cells. We observed that the level of SETDB1 was lower in the SNX30-plasmid group than in the control-plasmid group, while the opposite results in ferrostatin-1 treated cells (Fig. 4A-C). Our findings indicated that SETDB1 expression is associated with LUAD development of lung adenocarcinoma.

Fig. 4.

Effects of SNX30-plasmid and ferrostatin-1 on SETDB1 expression. A549 and HCC827 cells were transfected with control-plasmid and SNX30-plasmid, followed by treated with 1 µM ferrostatin-1. (A) Relative expression levels of SETDB1 in lung adenocarcinoma cells were determined by RT-qPCR. (B) Protein expression levels of SETDB1 in lung adenocarcinoma cells were determined by western blotting. (C) SETDB1/GAPDH ratio. **P < 0.01. The experiments were independently repeated three times. Data are presented as mean ± SD from three independent experiments

SNX30 negatively regulated SETDB1 expression in lung adenocarcinoma cells

To further illustrate the regulatory roles of SNX30 and SETDB1 in lung adenocarcinoma cells, control-plasmid and SNX30-plasmid were transfected with A549 and HCC827 cells. As shown in Fig. 5A-C, the SETDB1-plasmid memorably enhanced SETDB1 levels, as opposed to the control plasmid group. In addition, the level of SETDB1 was lower in SNX30-plasmid transfected lung adenocarcinoma cells than in the control plasmid group, and this reduction was reversed after SETDB1-plasmid treatment (Fig. 5-D-F). Our observations verified that SNX30 negatively regulates SETDB1 expression in lung adenocarcinoma cells.

Fig. 5.

Effects of SETDB1-plasmid and SNX30-plasmid on SETDB1 expression. Lung adenocarcinoma cells were divided into four groups: control, SNX30-plasmid, SNX30-plasmid + control, and SNX30-plasmid + SETDB1-plasmid group. (A) RT-qPCR analysis of SETDB1 in A549 and HCC827 cells transfected with the control-plasmid or SETDB1-plasmid. (B) Western blot analysis of SETDB1 in A549 and HCC827 cells transfected with control-plasmid or SETDB1-plasmid. (C) SETDB1/GAPDH ratio in A549 and HCC827 cells transfected with the control plasmid or SETDB1-plasmid. (D) mRNA levels of SETDB1 were evaluated in all four groups. (E) Western blotting analysis of SETDB1 expression. (F) SETDB1/GAPDH ratio in A549 and HCC827 cells from the four groups. **P < 0.01. The experiments were independently repeated three times. Data are presented as mean ± SD from three independent experiments

Up-regulation of SETDB1 reversed the effects of SNX30-plasmid on cell ferroptosis in lung adenocarcinoma cells

We also evaluated the effects of the SETDB1-plasmid on ferroptosis in lung adenocarcinoma cells. Our data demonstrated that the SETDB1-plasmid reversed the effects of the SNX30-plasmid on ferroptosis in lung adenocarcinoma cells, as evidenced by the reduced ROS levels (Fig. 6A), intracellular levels of total iron (Fig. 6B), and Fe²⁺ levels (Fig. 6C). We also observed that SETDB1-plasmid treatment promoted Cys, GSH, and GPX4 secretion (Fig. 6D-F), as well as reduced Ptgs2 and Chac1 expression (Fig. 6G and H), as opposed to the SNX30-plasmid + control-plasmid group. These findings indicate that SNX30 inhibits lung adenocarcinoma cell proliferation and induces ferroptosis by regulating SETDB1expression.

Fig. 6.

Effects of SNX30-plasmid and SETDB1-plasmid on lung adenocarcinoma cells ferroptosis. Lung adenocarcinoma cells were divided into four groups: control, SNX30-plasmid, SNX30-plasmid + control, and SNX30-plasmid + SETDB1-plasmid group. (A) ROS levels were measured. Total iron (B) and Fe2 + accumulation (C) in lung adenocarcinoma cells were analyzed. Determination of GSH (D), Cys (E), and GPX4 (F) levels in lung adenocarcinoma cells. (G and H) Ptgs2 and Chac1 mRNA levels were determined by RT-qPCR. **P < 0.01. The experiments were independently repeated three times. Data are presented as mean ± SD from three independent experiments

Discussion

Lung cancer is one of the most common malignant tumors worldwide, with high morbidity and mortality [20]. Lung adenocarcinoma is the primary type of lung cancer, accounting for approximately 50% of all lung cancer cases [21]. In recent decades, research has focused on treatments for lung cancer, including surgical resection [22], radiotherapy, and immunotherapy [23]. Although early and timely detection and treatment can prevent lung cancer progression, clinical outcomes are not ideal [24]. Therefore, the discovery of effective treatment strategies and new biomarkers has important clinical value for the treatment of lung adenocarcinoma. In recent years, biological information analysis has been commonly used to predict cancer related markers [25]. And a previous study has shown that high SNX30 expression is associated with better prognosis in patients with lung adenocarcinoma [26]. However, the specific mechanism of SNX30 action in lung adenocarcinoma remains unclear.

First, the expression levels of SNX30 in lung adenocarcinoma cell lines were detected using RT-qPCR and western blotting. We observed that SNX30 expression was low in lung adenocarcinoma cell lines. Our results were consistent with those of previous studies [26], suggesting that SNX30 is involved in LUAD progression of lung adenocarcinoma. To further investigate the regulatory role of SNX30 in lung adenocarcinoma, control-plasmids and SNX30-plasmids were transfected with A549 and HCC827 cells, respectively. We found that the upregulation of SNX30 inhibited the proliferation of A549 and HCC827 cells and promoted cell apoptosis, confirming its tumor-inhibitory effect in lung adenocarcinoma. Caspase-3, a member of the Caspase family, has been reported to be a key factor in regulating apoptosis. Qu et al. have suggested that lenalidomide induces apoptosis and inhibits angiogenesis via caspase-3 and VEGF in hepatocellular carcinoma cells [27]. Yang et al. also demonstrated that shikonin promotes Adriamycin-induced apoptosis by upregulating caspase-3 and caspase-8 in osteosarcoma [28]. Ferroptosis, a novel non-apoptotic programmed cell death pathway characterized by lethal ROS accumulation, is considered a beneficial therapeutic target for lung cancer. Zhang et al. suggested that RBMS1 regulates lung cancer ferroptosis through translational control of SLC7A11 [29]. Xu et al. showed that METTL3 promotes lung adenocarcinoma tumor growth and inhibits ferroptosis by stabilizing SLC7A11 [6]A modification [30]. However, the role of SNX30 in ferroptosis in lung adenocarcinoma remains unclear. It is well known that intracellular iron levels are regulated by iron-regulated transporters, and Fe²⁺ levels are particularly important for stimulating ferroptosis [31]. We investigated the effect of SNX30 on ferroptosis in A549 and HCC827 cells. Compared to the control plasmid group, the SNX30-plasmid increased ROS levels, intracellular levels of total iron, and Fe²⁺ levels in A549 and HCC827 cells. In addition, Ptgs2 and Chac1 expression was up-regulated in A549 and HCC827 cells in SNX30-plasmids treated cells. GPX4, an important antioxidant enzyme, is a central mediator of ferroptosis and is involved in lipid ROS production [10]. Previous reports have demonstrated that intracellular cysteine starvation leads to the depletion of GSH levels, resulting in the inactivation of GPX4 [32]. Therefore, we identified the regulators of ferroptosis-related factors, including Cys, GSH, and GPX4. Our results suggest that the SNX30-plasmid inhibited the release of Cys, GSH, and GPX4 compared to the control plasmid group.

Shi et al. revealed that the ferroptosis inhibitor ferrostatin-1 remarkably reduced the release of cytosolic and lipid ROS in HT-22 cells and reversed the glutamate-stimulated inhibition of GSH and GPX [33]. In this study, we evaluated the influence of ferrostatin-1 on ferroptosis in patients adenocarcinoma. Our findings are consistent with those of previous studies, suggesting that ferrostatin-1 reverses the effects of SNX30-plasmid on ferroptosis in lung adenocarcinoma cells. SETDB1 is located within the 1q21 amplicon and influences tumor development by regulating a series of signaling pathways [14]. However, the regulatory mechanisms of SETDB1 in lung adenocarcinoma remain unclear. Our data indicated that the SNX30-plasmid decreased the expression of SETDB1 in A549 and HCC827 cells, and this inhibition was reversed by ferrostatin-1. Our observations further verified that SNX30 negatively regulates SETDB1 expression in lung adenocarcinoma cells. Meanwhile, the SETDB1-plasmid reversed the effects of the SNX30-plasmid on ferroptosis in lung adenocarcinoma cells, as evidenced by reduced ROS levels, decreased intracellular levels of total iron and Fe²⁺, enhanced Ptgs2 and Chac1 expression, and promoted Cys, GSH, and GPX4 secretion compared to the control plasmid group.

There were also some limitations of this study. Firstly, this is only a preliminary in vitro study on the role of SNX30 in lung adenocarcinoma, and further research on SNX30 in in vivo models of lung adenocarcinoma is needed. Besides, the specific molecular regulation mechanism (such as participating pathways or molecules) of SNX30 in lung cancer still needs to be explored. In addition, the correlation between SNX30 and clinical pathological parameters in patients with lung adenocarcinoma need to be further explored. We will perform these issues in the future.

In summary, our study showed that SNX30 inhibited the proliferation of lung adenocarcinoma cells and induced ferroptosis by regulating SETDB1 expression. Our research provides new insights for the development of lung adenocarcinoma, and provides a theoretical basis for further investigating the prognostic and therapeutic potentials of SNX30. In addition, this study provides potential targets (SNX30) for clinical drug treatment of lung adenocarcinoma.

Conclusions

This study indicated that SNX30 inhibited the proliferation of lung adenocarcinoma cells and induced ferroptosis by regulating SETDB1 expression, providing potential targets for the treatment of lung adenocarcinoma.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

Xinjie Fan contributed to data collection, statistical analysis, data interpretation and manuscript preparation. Qichu Zhu, Chengzhuo Du, Jinlai Chen, and Yingming Su contributed to data collection and data interpretation. All authors have read and approved the final manuscript.

Funding

No funding was received.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

Not Applicable.

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.