Abstract
Background
Plasmodium falciparum has developed resistance to almost all the antimalarial drugs currently in use. This resistance has been and remains one of the greatest threats to the control and elimination of malaria. The use of molecular markers of resistance to monitor the emergence and spread of antimalarial drug-resistant parasite strains has proved highly effective. The aim of this study was to analyse the polymorphism of the pfcrt, pfdhfr-ts and pfK13 propeller genes for resistance in P. falciparum to chloroquine (CQ), pyrimethamine and artemisinin-based combination therapies (ACTs) in three sites in southern Côte d'Ivoire.
Methodology
Blood samples were collected in Anonkoua-kouté, Port-Bouët, and Ayamé from 94 patients with microscopically confirmed uncomplicated P. falciparum malaria. These patients, aged over 2 years, gave their informed consent prior to blood sampling. P. falciparum genomic DNA extracted from these samples was amplified by nested PCR using primers specific to the pfcrt, pfdhfr-ts and Pfk13 propeller genes. The amplification products were sequenced using the Sanger method. After sequencing, the prevalence of pfcrt (M74I, N75E, K76T), pfdhfr (N51I, C59R, S108N) and pfk13 propeller (Y493H, R539T, I543T, C580Y, M476I and R561H) mutations confirmed to be involved in P. falciparum resistance to CQ, pyrimethamine and ACTs, respectively was determined. Data were analysed using R statistical software, version 3.2.2.
Results
For all three study sites, 93 (93/94, i.e. 98.94%), 86 (86/94, i.e. 94.49%) and 74 (74/94, i.e. 78.72%) DNA fragments from patient isolates were successfully amplified for the Pfk13 propeller, pfdhfr-ts and pfcrt genes, respectively. Of the successfully amplified fragments, 93 (93/93, i.e. 100%), 81 (81/86, i.e. 94.18%) and 64 (64/74, i.e. 86.48%) were successfully sequenced for the pfk13 propeller, pfdhfr-ts and pfcrt genes, respectively. Sequence analysis indicated that S108N mutations in the pfdhfr gene and K76T mutations in the pfcrt gene were observed in 74.07% (60/81) and 15.62% (10/64) respectively. Analysis of the k13 propeller gene also showed a predominance of the YRICMR allelic form representing the sensitive haplotype (72/93, i.e. 78.49%).
Conclusions
More than a decade after the abandonment of the use of CQ and the adoption of sulfadoxinepyrimethamine (SP) as intermittent preventive treatment (IPT) for pregnant women, the prevalence of alleles associated with CQ chemoresistance, represented by the K76T mutation in the pfcrt gene, fell, while that of alleles associated with pyrimethamine chemoresistance, represented by the S108N mutation in the pfdhfr-ts gene, increased in Anonkoua-Kouté, Port-Bouët and Ayamé. No mutations in mutant alleles of the K13 propeller gene conferring resistance to artemisinin derivatives were observed at any of the study sites. The study thus showed that the ACTs used for first-line treatment of malaria in Côte d'Ivoire are still effective.
Introduction
Malaria is one of the deadliest infectious diseases in tropical and subtropical regions in terms of morbidity and mortality. The World Health Organization (WHO) has formulated the Malaria Control Strategy with the vision of a malaria-free world by 2030 [1].
According to the WHO, around 249 million cases of malaria were recorded in 2022, of which 610,000 caused deaths, of which around 580,000 (95%) occurred in Africa [2]. The vast majority of deaths (78%) occurred in children under five, with 452,000 deaths in 2022, or 74% of all malaria deaths [2]. Despite efforts to combat malaria, the disease remains a serious public health problem. The emergence of P. falciparum resistance to almost all available antimalarial drugs is making the situation more complicated and difficult. South-East Asia (SEA) is considered the epicentre for the evolution and spread of resistance against all major classes of antimalarials [3]. Resistance to CQ and SP in P. falciparum emerged in the late 1950s and 1960s on the Thai-Cambodian border and spread across Asia and then Africa, resulting in millions of malaria deaths [4,5]. In response to this situation, the WHO has recommended the use of ACTs as first-line treatment for uncomplicated P. falciparum malaria in all malaria-endemic countries [6]. Since 2005, Côte d'Ivoire has adopted new disease control strategies, which involve the use of ACTs for all confirmed cases of malaria in both adults and children. This strategy included the free dispensing of ACTs for confirmed cases of malaria in children under 5 and pregnant women.
However, the official introduction of ACTs has led to fears of widespread use of cheap CQ and SP, which could increase P. falciparum resistance to CQ and SP and reduce sensitivity to ACTs. To ensure early warning and better management of malaria in Côte d’Ivoire, it is necessary to set up a system for monitoring P. falciparum resistance to CQ, pyrimethamine and artemisinin derivatives. The efficacy of antimalarial drugs can be determined by four different methods: in vivo therapeutic efficacy studies, in vitro tests, molecular marker studies and the measurement of drug concentrations. The in vivo therapeutic efficacy study is still considered the gold standard in this respect. Molecular marker studies are also important for determining any early signs of antimalarial drug resistance. Several studies have conclusively shown a correlation between the development of antimalarial drug resistance and the presence of polymorphisms in the genes of the P. falciparum parasite that determine the effects of the drugs [7,8]. For example, mutations in the pfcrt gene encompassing codons 72-76 have been associated with CQ resistance in P. falciparum, while the K76T mutation is characteristic of CQ resistance [7,9]. Furthermore, the N86Y mutation in the pfmdr gene of P. falciparum modulates a higher level of resistance to CQ when present with the K76T mutant in the pfcrt gene [10]. In addition, point mutations in the pfdhfr and pfdhps genes confer resistance to pyrimethamine and sulfadoxine respectively [10-12] with an in vitro decrease in P. falciparum susceptibility linked to the number of mutations in each gene. Polymorphisms at codons 436, 437, 540, 581 and 613 of pfdhps and at codons 16, 51, 59, 108 and 164 of the pfdhfr gene have been identified as markers of resistance to sulfadoxine and pyrimethamine [7]. Artemisinin resistance is characterized by slow elimination of the parasite [13], which reflects the reduced susceptibility of the asexual stages of the parasites. [10,14]. This resistance of P. falciparum to artemisinin derivatives reported in various countries [14,15] has been correlated with point mutations in the pfK13 propeller gene [14]. Periodic monitoring of polymorphisms in molecular markers associated with antimalarial drug resistance will be useful to assess drug pressure, map and monitor the resistance status of these drugs; and will be useful to search for alternative treatments. This study was conducted in three localities in southern Côte d'Ivoire to determine the prevalence of key mutations associated with P. falciparum resistance to CQ, pyrimethamine and artemisinin derivatives in subjects with uncomplicated malaria.
Materials and Methods
Study site
Samples were collected from February to August 2015 at the Anonkoua Kouté health center and the Port-Bouët and Ayamé general hospitals. All these sites are located in the southern region of Côte d'Ivoire, where the climate is Atrean, with annual rainfall in excess of 1,700 mm and temperatures ranging from 27 to 33°C. Malaria is seasonal, predominating in the rainy season from June to September, with peaks in prevalence and incidence in October-November. P. falciparum is the dominant species, accounting for over 90% of the parasite formula. The main malaria vectors in this study area (the forested south of Côte d'Ivoire) are members of the An. gambiae s.l. and An. funestus s.l. complexes [16]. The Anonkoua-kouté health center and the Ayamé general hospital were selected because of the high annual incidence of malaria cases. In addition, these health facilities have been considered for several years as the main sites for multicenter clinical efficacy testing by the Malaria Unit of the Pasteur Institute of Côte d'Ivoire. The Port Bouët General Hospital was chosen for this study not only because of its consistently high annual incidence of malaria, but also and above all because of its marshy environment used for market gardening.
Study population and sample collection
All patients at the Anonkoua-kouté health center and the Port-Bouët and Ayamé general hospitals with clinical symptoms suggestive of malaria during our study period were eligible for blood sampling after obtaining informed consent. Following informed consent, blood samples were collected from patients aged over 2 years with an axillary or rectal temperature above 37.5°C and uncomplicated P. falciparum malaria confirmed microscopically by thick drop and a blood smear.
Blood sampling
From each patient with microscopically confirmed malaria, approximately 2-5 mL of venous blood was drawn and collected in an EDTA tube. Approximately 50 μL of whole blood was spotted onto Whatman 3 mm filter paper using a micropipette with filter cones. The paper containing the blood spots was dried for approximately 60 to 120 minutes at room temperature in a dust-free environment. Unused blood from the EDTA tube was stored in cryotubes at -20°C for possible future use.
Extraction of Plasmodium falciparum genomic DNA
Plasmodium DNA was extracted with methanol from blood confetti [17]. Thin cuts of blood confetti were immersed in 1 mL of wash buffer (950 μL of 1X PBS plus 50 μL of 10% saponin) and then incubated overnight at 4°C. The wash buffer was removed and washed before adding 150 μL of methanol. After incubation for 20 minutes, the methanol was gently removed and the samples were dried at room temperature for 2 hours before adding 300 μL of sterile water. The samples were then heated to 99°C in a thermo-mixer for 30 minutes to elute the DNA. After removing the confetti debris, the DNA extracts were aliquoted into a 1.5 mL Eppendorf tube and stored at -20°C.
Amplification of the pfcrt, pfdhfr and pfk13 propeller genes
The pfcrt, pfdhfr and pfk13 propeller resistance genes were amplified by nested PCR using a pair of primers specific for each gene and a commercial DNA polymerase kit called 5X FIREPol® Blend Master Mix with mM MgCl2.
The composition of this kit constituted a pre-mix for the reaction mixture. For the primary PCR, the primer pairs used for the pfk13 propeller, pfdhfr and pfcrt genes were respectively K13_PCR_F(5'CGGAGTGACCAAATCTGGGA)/ K13_PCR_R(5'GGGAATCTGGTGGT AACAGC), dhfr_M1(5'TTTATGATGGAACAAGTCTGC) / dhfr_M7(CTAGTATATACATCGC TAACA) and 72_97EF(5' GAC CTT AAC AGA TGG CTC AC) / 72_97ER(5' TTT TAT ATT GGT AGG TGG AAT AG). Primary PCR of these genes was performed in a 25 μl reaction volume containing: 0.625 μL of each primer, 3 μL of plasmodial DNA, 5 μL of Taq polymerase and 15.75 μL of milliQ water. The mixture was then placed in a PTC-100TM thermal cycler (Eppendorf Mastercycler, PTC-100 Peltier Thermal Cycler), programmed as follows: Initial denaturation at 95°C for 15 minutes followed by 30 cycles of denaturation at 95°C for 30 seconds, hybridisation at 58°C for 2 minutes and extension at 72°C for 2 minutes. Finally, a terminal extension at 72°C for 10 minutes.
The second PCR was performed on the amplification products of the primary PCR in a 50 μl reaction volume containing: 1.25 μL of each primer, 5 μL of amplification product (amplifiate) from the first PCR, 5 μL of Taq polymerase and 37.5 μl of milliQ water.
The primer pairs used for the secondary PCR were K13_N1_F(5'GCCAAGCTGCCATTCATTTG)/ K13_N1_R(5'GCCTTGTTGAAAGAAGCAG) for the pfk13 propeller gene, dhfr_M9(5' CTG-GAAAAAATACATCACATTCATATG) / dhfr_M3 (5' TGATGGAACAAGTCTGCGACGTT) for the pfdhfr gene and SecIF (5' GGTAAATGTGCTCAT-G T G T T T A A A C T T A T T ) / S e c I R (5’TTACTTTTGAATTTCCCTTTAT TTCCA).
Secondary PCR was performed using the same thermal cycler used for primary PCR with the following programme: Initial denaturation at 95°C for 15 minutes followed by 30 cycles of denaturation at 95°C for 30 seconds, hybridisation at 60°C for one minute and extension at 72°C for one minute. Finally, a terminal extension at 72°C for 10 minutes.
Detection and analysis of PCR products
The amplification products of the pfcrt, pfdhfr and pfK13 propeller genes were migrated onto a 1.5% (W/V) agarose gel containing Ethidium Bromide (BET). After migration, the gel was recovered and observed under a UV lamp using the UV transluminator (Gel DocTM EZ Imager). The presence or absence of bands was used to judge PCR efficiency.
Sequencing amplification
In this work, the amplified DNA fragments (pfcrt, pfdhfr and pfK13 propeller genes from P. falciparum) were sequenced using the Sanger method by Eurofins MWG opéron (Cochin sequencing platform). Samples were supplied to the platform in a microplate (Greiner Bio-one-652270B) accompanied by a deposit slip which was sent to the platform's email address. A reaction medium was prepared for the nested PCR sense primer (sequencing primer) from the amplification products.
In each well of the microplate, a volume of 13 μL of amplification product was added to 2 μL of 10 μM sequencing primer. The wells containing the sequencing reaction medium were sealed with cap strips (4titude-044737) before covering the entire surface of the microplate with adhesive film (AmpliSeal, Greiner Bio-one-676040). This microplate containing our samples was supplied to the platform for sequencing. After the sequencing reaction, the DNA sequences received were recovered in fasta form. In the case of this work, these were the sequences corresponding to the pfcrt, pfdhfr and pfK13 propeller genes of the isolates collected. The sequences were analysed for mutations using BioEdit software. Codons of interest (74, 75, 76) in the PFCRT polypeptide or nucleotides in positions 222, 225, 228 of the pfcrt gene sequence were identified and analysed after parallel alignment of two or more DNA sequences, including the reference sequence of the pfcrt gene, maximising the number of identical nucleotides or residues, while minimising the number of mismatches and gaps. Codons 51, 59 and 108 of the PfDHFR polypeptide and nucleotides at positions 153, 177 and 324 of the pfdhfr gene were also analysed. Codons 493, 539, 543, 580, 476 and 561 of the PFK13 PROPELLER polypeptide and nucleotides at positions 1479, 1617, 1629, 1740, 1428 and 1683 of the K13 propeller gene were also analysed.
Statistical analysis of data
Data were collected using a standard questionnaire that had been tested and validated. They were then entered and analysed on R statistical software; version 3.2.2 [18]. The χ2 test of comparison of three means was used to compare the prevalences of molecular markers of resistance to CQ (pfcrt K76T), pyrimethamine (pfdhfr S108N). The χ2 test was used to determine whether the molecular marker prevalences can be considered to be all equal (null hypothesis H0) or whether at least two prevalences are different (alternative hypothesis Ha). A statistical difference and/or association was considered significant if p of the χ2 test < 0.05.
Results
Patient profile and selected isolates
A total of 94 people infected with P. falciparum were included in the study, 58 (61.7%) of them women and 36 (38.3%) men. The patients ranged in age from 2 to 62 years, with an average age in Anonkoua-kouté, Port-bouët and Ayamé of 16.60, 16.69 and 15.84 years, respectively. A total of 94 blood samples were collected from the three study sites (Table 1).
Table 1.
Samples used for molecular analysis of chemoresistance to chloroquine, pyrimethamine and artemisinin derivatives.
| Sites | Period of collections in 2015 | Brackets age (years) | Average age (years) | Conffetis collected |
|---|---|---|---|---|
| Anonkoua- kouté | February - March | 2 - 53 | 16,60 | 30 |
| Port - Bouët | April - May - July | 2 - 62 | 16,69 | 32 |
| Ayamé | June - July - August | 2 - 55 | 15,84 | 32 |
| Total | 94 |
Amplification and sequencing results
Across the three study sites, 94 DNA fragments from patient isolates were amplified, including 93 (93/94, 98.84%) fragments of the pfk13 propeller gene, 86 (86/94, 94.49%) of the pfdhfr gene and 74 (74/94, 78.72%) of the pfcrt gene successfully amplified (Table 2).
Table 2.
PCR sensitivity for the genes studied.
| Amplified DNA fragments (N* = 94) | |||
|---|---|---|---|
| K13 propeller | pfdhfr | pfcrt | |
| Amplification success n** (%) | 93 (98,84) | 86 (94,49) | 74 (78,72) |
* N represents the number of isolates amplified.
**n represents the number of isolates successfully amplified per gene.
Molecular analysis of the amplified fragments showed that the number of DNA fragments successfully sequenced varied according to the presence of codons of interest on the DNA fragment of the amplified gene. Of the 86 DNA fragments of the pfdhfr gene sequenced, 65 (75.60%), 66 (76.75%) and 81 (94.20%) were successfully sequenced for nucleotides at positions 153, 177 and 324, respectively, corresponding to the amino acids at which the Asn-51-Ile, Cys-59-Arg and Ser-108-Asn mutations were observed (Table 3). Sequencing of the DNA region leading to the Ser-108-Asn mutation was more successful (155/165; 93.93%).
Table 3.
Summary of sequencing of DNA extracted from isolates according to mutations.
| Sequenced frag- ments (N*= 94) | Changes | Success n**(%) | Ches n** (%) |
|---|---|---|---|
| Blood (n=86) | |||
| Asn-51-Ile | 65 (75,60%) | 21 (24,4%) | |
| Pfdhfr (N*=86) | Cys-59-Arg | 66 (76,75%) | 20 (23,25%) |
| Ser-108-Asn | 81 (94,20%) | 5 (5,80%) | |
| Blood (n=74) | |||
| Met-74-Ile | 59 (79,73%) | 15 (20,27%) | |
| Pfcrt (N*=74) | Asn-75-Glu | 64 (84,50%) | 10 (13,50%) |
| Lys-76-Thr | 64 (84,50%) | 10 (13,50%) | |
| Blood (n=93) | |||
| Tyr-493-Ile | 79 (84,94%) | 14 (15,06%) | |
| pfk13 propeller (N*=93) | Arg-539-Thr | 85 (91,40%) | 8 (8,60%) |
| Ile-543-Thr | 89 (95,70%) | 4 (4,30%) | |
| Cys-580-Tyr | 93 (100%) | 0 (0,0%) | |
| Met-476-Ile | 77 (82,80%) | 16 (17,20%) | |
| Arg-561-His | 88 (94,60%) | 5 (5,40%) |
*N represents the total number of isolates successfully sequenced at the three sites.
**n represents the number of isolates for which codons of interest of the sequence were located.
Similarly, out of 74 DNA fragments of the pfcrt gene, 59 (79.73%), 64 (84.50%) and 64 (84.50%) DNA fragments were successfully sequenced for nucleotides at positions 222, 225 and 228 respectively, corresponding to the amino acids at which the Met-74-Ile, Asn-75-Glu and Lys-76-Thr mutations were observed.
For the pfk13 propeller gene, of the 93 DNA fragments successfully sequenced, 79 (84.94%), 85 (91.40%), 89 (95.70%), 93 (100%), 77 (82.80%) and 88 (94.60%) were successfully sequenced for nucleotides at positions 1479, 1617, 1629, 1740, 1428 and 1683 respectively, corresponding to the amino acids at which the Tyr-493-Ile, Arg-539-Thr, Ile-543-Thr, Cys- 580-Tyr, Met-476-Ile and Arg-561-His mutations were observed (Table 3).
Sequencing of the DNA region leading to the Cys-580-Tyr mutation was more successful (186/186; 100%).
Polymorphism of pfdhfr and pfcrt genes in the study sites
Prevalence of individual alleles of pfdhfr and pfcrt genes
For all three study sites, our results indicate that the prevalences of isolates carrying the Ile-51 (61.29%), Arg-59 (54.76%) and Asn-108 (74.19%) mutations are higher than those of wild-type Asn-51 (15.32%), Cys-59 (15.07%) and Ser-108 (17.41%) isolates of the pfdhfr gene (Table 4).
Table 4.
Prevalences of individual alleles of pfdhfr and pfcrt genes in the study sites.
| Genes | Codons | Alleles | n* | Frequencies | |
|---|---|---|---|---|---|
| n=65 | (%) | ||||
| pfdhfr | dhfr_51 | Wild (N) | Asn-51 | 10 | 15,38 |
| Ile-51 | 40 | 61,53 | |||
| Mutants | Other | 15 | 23,07 | ||
| n=66 | (%) | ||||
| dhfr_59 | Wild (C) | Cys-59 | 10 | 15,15 | |
| Arg-59 | 36 | 54,54 | |||
| Mutants | Other | 20 | 30,30 | ||
| n=81 | (%) | ||||
| dhfr_108 | Wild (S) | Ser-108 | 14 | 17,28 | |
| Asn-108 | 60 | 74,07 | |||
| Mutants | Other | 7 | 8,64 | ||
| n=59 | (%) | ||||
| pfcrt | pfcrt_74 | Wild (M) | Met-74 | 47 | 73,43 |
| Mutants | Ile-74 | 5 | 7,81 | ||
| Other | 1 | 1,56 | |||
| n=64 | (%) | ||||
| pfcrt_75 | Wild (N) | Asn-75 | 48 | 75 | |
| Glu-75 | 5 | 7,81 | |||
| Mutants | Other | 6 | 9,37 | ||
| n=64 | (%) | ||||
| pfcrt_76 | Wild (K) | Lys-76 | 40 | 62,50 | |
| Thr-76 | 10 | 15,62 | |||
| Mutants | Other | 1 | 1,56 |
n* represents the number of isolates for which pfdhfr-ts and pfcrt genes codons of interest (51, 59, 108 and 74, 75, 76 respectively) or nucleotides at respective positions 153, 177, 324 and 222, 225, 228 of sequence were identified. The list of other mutants can be found in Supplementary Tables (Appendix 1 for pfcrt and Appendix 3 for pfdhfr-ts).
Similarly, for the pfcrt gene, the prevalences of wild isolates Met-74 (73.43%), Asn-75 (75%) and Lys-76 (62.5%) are higher than those of isolates carrying the Ile-74 (7.81%), Glu-75 (7.81%) and Thr-76 (15.62%) mutations (Table 4).
Molecular analysis of genotypes corresponding to pfdhfr and pfcrt genes
Molecular analysis of the genotypes corresponding to the pfdhfr gene showed that isolates carrying the IRN (triple mutant haplotype), NRN (double mutant haplotype) and ICN (double mutant haplotype) genotypes were observed with respective prevalences of 31.40% (27/86), 9.30% (8/86) and 8.14% (7/86) compared with 13.93% for the NCS susceptible haplotype (Table 5). The analysis also revealed a predominance of the sensitive MNK haplotype of the pfcrt gene with a prevalence of 62.5% (40/64) compared with 6.25% (4/64) and 9.37% (6/64) for the IET and LKQ mutant haplotypes respectively. Single mutant (SNM) and double mutant (NYQ) haplotypes were observed at prevalences of 9.37% (6/64) and 6.25% (4/64), respectively (Table 5).
Table 5.
Prevalences of haplotypes of pfcrt, pfdhfr genes.
| Allelic forms | ||||||
|---|---|---|---|---|---|---|
| Gene | Haplotypes | M74I | N75E | K76T | n | Prevalences |
| pfcrt (N* = 64) | Wild | M | N | K | 40 | 62,5 |
| Simple mutants | 8 | 12,5 | ||||
| M | N | T | 6 | 9,37 | ||
| Other | 2 | 3,12 | ||||
| Double mu- | N | Y | Q | 4 | 6,25 | |
| Triple mutants | 12 | 18,75 | ||||
| I | E | T | 4 | 6,25 | ||
| L | K | Q | 6 | 9,37 | ||
| Other | 2 | 3,12 | ||||
| Gene | Haplotypes | N51I | C59R | S108N | n | Prevalences |
| pfdhfr (N* = 86) | Wild | N | C | S | 12 | 13,96 |
| Simple mutants | 9 | 10,47 | ||||
| N | C | N | 2 | 2,33 | ||
| Other | 7 | 8,13 | ||||
| Double mu- | 26 | 30,23 | ||||
| N | R | N | 8 | 9,30 | ||
| I | C | N | 7 | 8,13 | ||
| Other | 11 | 12,79 | ||||
| Triple mutants | 39 | 45,34 | ||||
| I | R | N | 27 | 31,40 | ||
| Other | 12 | 13,95 | ||||
N* represents the total number of isolates successfully sequenced at the three sites. A capital letter in the allelic forms column represents the single-letter code for the amino acids. The amino acids resulting from the mutation of pfcrt and pfdhfr are underlined and in bold. The frequencies determined correspond to the number of observations out of the number of hits per gene. The list of other mutants can be found in Supplementary Tables (Appendix 2 for pfcrt and Appendix 4 for pfdhfr-ts).
Polymorphism of the pfk13 propeller gene in the study sites
Prevalence of individual alleles of the pfk13 propeller gene
For all three study sites, our results indicate that the prevalences of isolates carrying the Ile-493 (1.26%), Thr-539 (3.52%) and Ile-476 (1,29%) are very low compared to the wild-type isolates Tyr-493 (92.40%), Arg-539 (94.11%), Ile-543 (94.38%), Cys-580 (91.39%), Met-476 (89.61%) and Arg-561 (88.63%) of the pfk13 propeller gene (Table 6).
Table 6.
Prevalence of individual alleles of the pfk13 propeller gene.
| Study sites (N*=93) | |||
|---|---|---|---|
| Codons | Strains and mutations observed | Number of employees (%) | |
| K13_493 (n** = 79) | Wild | Tyr-493 | 73 (92,40) |
| Mutants | His-493 | 1 (1,26) | |
| Pro-493 | 1 (1,26) | ||
| Phe-493 | 3 (3,79) | ||
| Cys-493 | 1 (1,26) | ||
| K13_539 (n** = 85) | Wild | Arg-539 | 80 (94,11) |
| Mutants | Thr-539 | 3 (3,52) | |
| Gly-539 | 1 (1,17) | ||
| Pro-539 | 1 (1,17) | ||
| K13_543 (n** = 89) | Wild | Ile-543 | 84 (94,38) |
| Mutants | Thr-543 | 0,00 | |
| Met-543 | 2 (2,24) | ||
| Phe-543 | 2 (2,24) | ||
| Ser-543 | 1 (1,12) | ||
| K13_580 (n** = 93) | Wild | Cys-580 | 85 (91,39) |
| Mutants | Tyr-580 | 0,00 | |
| Ser-580 | 3 (3,22) | ||
| Pro-580 | 3 (3,22) | ||
| Gly-580 | 1 (1,07) | ||
| Arg-580 | 1 (1,07) | ||
| K13_476 (n** = 77) | Wild | Met-476 | 69 (89,61) |
| Mutants | Ile-476 | 1 (1,29) | |
| Gly-476 | 2 (2,59) | ||
| Lys-476 | 1 (1,07) | ||
| Arg-476 | 2 (2,59) | ||
| Thr-476 | 1 (1,29) | ||
| Ser-476 | 1 (1,29) | ||
| R561H | Wild | Arg-561 | 78 (88,63) |
| Mutants | His-561 | 0,00 | |
| Cys-561 | 7 (7,95) | ||
| Trp-561 | 1 (1,13) | ||
| Ser-561 | 1 (1,13) | ||
| Leu-561 | 1 (1,13) | ||
*N represents the total number of isolates successfully sequenced at the three sites.
**n represents the number of isolates for which codons of interest (493, 539, 543, 580, 478 and 561) or nucleotides at positions 1479, 1617, 1629, 1740, 1428 and 1683 of the sequence were identified.
The Thr-543, Tyr-580 and His-561 mutations were not observed. However, isolates carrying the Cys-561 mutation (7.95%) were observed. Very low prevalences (less than 5%) of other mutations were also detected.
Molecular analysis of genotypes corresponding to the pfk13 propeller gene
Molecular analysis of the genotypes corresponding to the pfk13 propeller showed that the YRICMR allelic form (susceptible haplotype) predominated in the isolates with a prevalence of 77.42% compared with 7.53%, 9.68%, 3.22% and 2.15%, respectively for the single mutant, double mutant, triple mutant and quadruple mutant haplotypes observed (Table 7).
Table 7.
Prevalences of genotypes corresponding to pfk13 propeller in the three sites.
| Blood (N= 93) | ||||||||
|---|---|---|---|---|---|---|---|---|
| Haplotype | Y493H | R539T | I543T | C580Y | M476I | R561H | n | Proportion |
| Wild | Y | R | I | C | M | R | 72 | 77,42 |
| Simple Mutants | 7 | 7,53 | ||||||
| Y | R | I | C | K | R | 1 | ||
| Y | R | I | C | R | R | 1 | ||
| Y | R | I | C | T | R | 1 | ||
| Y | R | I | C | M | C | 1 | ||
| C | R | I | C | M | R | 1 | ||
| Y | R | I | G | M | R | 1 | ||
| Y | R | I | S | M | R | 1 | ||
| Double Mutants | 9 | 9,68 | ||||||
| Y | R | I | C | G | C | 1 | ||
| Y | G | I | S | M | R | 1 | ||
| P | R | I | C | M | C | 1 | ||
| Y | R | M | C | M | C | 1 | ||
| Y | R | F | P | M | R | 1 | ||
| F | T | I | C | M | R | 1 | ||
| F | R | I | C | R | R | 1 | ||
| Y | R | I | C | S | C | 1 | ||
| Y | R | I | R | M | L | 1 | ||
| Triple Mutants | 3 | 3,22 | ||||||
| H | R | I | C | I | C | 1 | ||
| Y | R | M | P | M | W | 1 | ||
| Y | P | F | F | M | R | 1 | ||
| Quadruple Mutants | 2 | 2,15 | ||||||
| Y | T | S | P | M | S | 1 | ||
| F | T | I | C | G | C | 1 |
A capital letter in the genotypes column represents the single-letter code for the amino acids. The amino acids resulting from the mutation are underlined and in bold. The prevalences determined correspond to the number of observations out of the number of hits per gene.
Discussion
The use of molecular biomarkers is essential for identifying and understanding the genetic mutations responsible for P. falciparum resistance to antimalarial drugs. This study was carried out to analyse the polymorphism of the pfcrt, pfdhfr-ts and pfK13 propeller genes conferring resistance in P. falciparum to CQ, pirymethamine and ACTs respectively in three sites in southern Côte d'Ivoire. DNA fragments from isolates from patients at the three study sites were amplified and sequenced. Polymorphism analysis of the genes studied (pfk13 propeller, pfdhfr-ts and pfcrt) was carried out. With regard to the pfdhfr-ts gene, the results indicate that the Ser-108-Asn (Asn-108) mutation was observed in 74.07% of the three study sites. The high prevalence of this mutation could be explained by the presence of potentially pyrimethamine-resistant P. falciparum isolates.
This prevalence is higher than those obtained by Ako et al. [19] in 2014 at Anonkoua-Kouté in Abidjan (49%) and Ayamé (54%) in blood isolates from individuals with malaria symptoms. Lower proportions had already been observed in 2010 in the south of Côte d'Ivoire by Djaman et al. [20] in Yopougon (Abidjan) and Ouattara et al. [21] in Adzopé. Our results corroborate those of Ako et al. [19,22] who indicated that the prevalence of the Ser-108-Asn mutation had increased significantly in Anonkoua-kouté between 2002 and 2008 with an average of 43%. All these results clearly indicate that the prevalence of the Asn-108 mutation has increased significantly in this part of the country. This finding is also important because the SP combination is still in circulation because it is recommended for intermittent preventive treatment in pregnant women in Côte d'Ivoire [23]. The results obtained could therefore be explained by increased use of SP on parallel markets as a result of the effective withdrawal of CQ. This drug pressure could be at the origin of the circulation of pyrimethamine-resistant strains in the three study sites, with an increase in the prevalence of Ile-51 (61.29%), arg-59 (54.76%) and Asn-108 (74.19%) mutations in the pfdhfr-ts gene in the three study sites. Indeed, these mutations are fixed in the parasite and confer resistance to pyrimethamine, implying that the efficacy of the SP combination as Intermittent Preventive Treatment would be limited in this region [24]. In addition to drug pressure, pyrimethamine resistance in these three localities could be explained by the use of poor-quality antimalarials. Indeed, the use of poor quality antimalarials can have multiple consequences, including an increased risk of developing drug resistance, as sub-therapeutic doses of drugs will be ineffective in destroying all parasites [25,26].
Elsewhere in sub-Saharan Africa, high rates have been found. Monitoring of P. falciparum chemoresistance has yielded the following results: in Burkina Faso, the reported rate of the Asn-108 mutation was 63.8% [27], 66.9% in Cameroon [7] and 64% in Benin [28]. As well as the Asn-108 mutation, additional mutations (Asn-51-Ile and Cys-59-Arg) were identified. All the mutations at codons 51 and 59 were associated with codon 108. Parasites carrying these additional Asn-51-Ile and Cys-59-Arg mutations associated with the Ser-108-Asn mutation have 2000 times greater resistance to pyrimethamine than those carrying the Ser-108-Asn mutation alone [29,30].
With regard to the pfcrt gene, previous studies have shown a marked correlation between the Thr-76 mutation in the pfcrt gene and therapeutic failures on the one hand, and between the Thr-76 mutation in the pfcrt gene and in vitro chemoresistance of P. falciparum isolates to CQ on the other [31-33].
Our results indicate that across all three study sites, the Thr-76 mutant allele (15.63%) was associated with the Ile-74 (7.81%) and Glu-75 (7.81%) mutant alleles in isolates at very low proportions compared with the wild-type alleles Lys-76 (62.50%), Met-74 (73.43%) and Asn-75 (75%).
In addition, the wild Lys-76 allele was observed in Anonkoua-Kouté, Port-Bouët and Ayamé at 60.71%, 62.50% and 65% respectively. These results are similar to those of Kouman et al. [34], who observed a predominance of the wild 76-Lys allele at five sites in Côte d'Ivoire, with a prevalence ranging from 60.9 to 86.4%.These high prevalences of the wild Lys-76 allele could be explained by the drop in drug pressure associated with the effective withdrawal of CQ in Côte d'Ivoire. When drug pressure is low, drug resistance is accompanied by a reduction in the genetic performance of resistant parasites compared with susceptible parasites [35,36]. Thus, when drug pressure is reduced, the proportion of susceptible parasites increases and that of resistant parasites decreases [37]. Thus, the withdrawal of CQ and the introduction of ACTs seem to favour a re-emergence of CQ-susceptible isolates in Côte d'Ivoire. Elsewhere in malaria-endemic areas, similar frequencies were observed for the wild allele of the pfcrt gene after CQ was abandoned for the treatment of malaria. In Burkina Faso, Nigeria and Equatorial Guinea, the reported prevalence of the wild Lys-76 allele was 63.8%, 63.9% and 74% respectively [27,38,24].
Thus, the withdrawal of CQ and the introduction of ACTs seem to favour a re-emergence of CQ-susceptible isolates. It would be desirable to carry out another study covering several localities with a larger number of samples to confirm this decrease in CQ-resistant parasites in Côte d'Ivoire. Thus, if the proportion of CQ-resistant parasites decreases at national level to an undetectable level of pfcrt mutants, the reintroduction of CQ in combination with other antimalarial drugs for treatment and prophylaxis could be envisaged, as has been done in Malawi [37].
Polymorphism analysis of the k13 propeller gene indicates very low proportions of mutations associated with P. falciparum resistance to artemisinin derivatives. Indeed, for the three study sites, the analysis showed that the YRICMR allelic form (sensitive haplotype) was predominant, with a prevalence of 78.49%. In addition, this analysis indicated prevalences of 1.26%, 3.52% and 1.29% respectively for the His-493, Thr-539 and Ile-476 mutant alleles, compared with 92.40% (His-493), 94.11% (Thr-539), 94.38% (Thr-543), 91.39% (Tyr-580), 89.61% (Ile-476) and 88.63% (His-561) for the wild-type alleles. No mutations in the Ile-543, Cys-580 or His-561 alleles were observed at any of the three sites studied. Overall, our results indicate a very low prevalence of mutations associated with resistance to artemisinin derivatives. These low proportions of known mutations in the pfK13 propeller gene support the efficacy of ACTs in Côte d'Ivoire.
In Côte d'Ivoire, ACTs have been recommended as first-and second-line treatments for uncomplicated malaria since 2005, and the efficacy of these combinations remains high, as reported by Touré et al. [39,40]. The use of ACTs increased in the country after the adoption of their free distribution to children under the age of five. Consequently, drug pressure due to uncontrolled use (prescription or self-medication) of ACTs could have selected resistant parasites over time. It is also important to monitor the possible emergence of a population of ACT-resistant parasites. However, these results need to be confirmed by sequencing the complementary DNA strand and also by in vitro tests such as the RSA (Ring-stage Survival Assay).
Conclusion
The main objective of this study was to analyse the polymorphism of the P. falciparum pfcrt, pfdhfr and pfK13 propeller genes in patients with uncomplicated malaria. To do this, the prevalence of mutations in the pfcrt, pfdhfr and pfK13 propeller genes involved in resistance to CQ, SP and ACT respectively, was determined. The study showed that more than a decade after the discontinuation of CQ use in Côte d’Ivoire and the adoption of SP as intermittent preventive treatment (IPT) for pregnant women, the prevalence of alleles associated with CQ chemoresistance, represented by the K76T mutation in the pfcrt gene, fell, while that of alleles associated with pyrimethamine chemoresistance, represented by the S108N mutation in the pfdhfr-ts gene, increased in Anonkoua-Kouté, Port-Bouët and Ayamé. No mutations in mutant alleles of the K13 propeller gene conferring resistance to artemisinin derivatives were observed at any of the study sites. The study thus showed that the ACTs used for first-line treatment of malaria in Côte d'Ivoire are still effective.
Acknowledgements
The authors are grateful to the Director of the Institut Pasteur de Côte d'Ivoire for allowing them to use the equipment of the Institut Pasteur de Côte d'Ivoire's molecular biology platform to perform the PCR tests. The authors would also like to thank the staff at the study sites (Anonkoua-kouté, Port-Bouët and Ayamé) for their efforts and cooperation in recruiting patients and collecting samples.
Appendix 1.
Frequency of other mutant alleles of the pfcrt gene in blood
| Blood (N=74) | ||||
|---|---|---|---|---|
| Codons | Strains and mutations observed | Numbers | Proportions (%) | |
| Blood (n=59) | ||||
| Crt_74 | Wild type | Met-74 | 47 | 79.66 |
| Mutants | Ile-74 | 5 | 8.47 | |
| Lys-74 | 1 | 1.69 | ||
| Leu-74 | 5 | 8.47 | ||
| Pro-74 | 0 | 0 | ||
| Trp-74 | 1 (1,69) | 1.69 | ||
| Blood (n=64) | ||||
| Crt_75 | Wild type | Asn-75 | 48 | 75.00 |
| Mutants | Glu-75 | 5 | 7.81 | |
| Lys-75 | 6 | 9.38 | ||
| Gln-75 | 0 | 0 | ||
| Tyr-75 | 5 | 7.81 | ||
| Blood (n=64) | ||||
| Crt_76 | Wild type (K) | Lys-76 | 40 | 62.50 |
| Mutants | Thr-76 | 10 | 15.63 | |
| Gly-76 | 1 | 1.56 | ||
| Ile-76 | 1 | 1.56 | ||
| Glu-76 | 12 | 18.75 | ||
Appendix 2.
Frequency of other mutant genotypes corresponding to the pfcrt gene
| Genotypes | Blood (N=64) | ||||
|---|---|---|---|---|---|
| Haplotypes dhfr | M74I | N75E | K76T | n | Proportions |
| Wild type (WT) | N | N | K | 40 | 62,5 |
| Single mutant haplotypes (SM) | 8 | 12,5 | |||
| N | N | T | 6 | 9,37 | |
| M | N | Q | 2 | 3,16 | |
| M | N | G | 0 | 0 | |
| Double mutant haplotypes (DM) | N | Y | Q | 4 | 6,25 |
| Triple mutant haplotypes (TM) | 12 | 18,75 | |||
| L | K | Q | 6 | 9,37 | |
| I | E | T | 4 | 6,25 | |
| K | E | G | 1 | 1,56 | |
| I | Y | I | 1 | 1,56 | |
| P | Q | E | 0 | 0 | |
Appendix 3.
Frequency of other mutant alleles of the pfdhfr-ts gene in blood
| Blood (N=86) | ||||
|---|---|---|---|---|
| Codons | Strains and mutations observed | Numbers | Proportions (%) | |
| Blood (n=65) | ||||
| dhfr_51 | Wild type (N) | Asn-51 | 10 | 15,38 |
| Mutants | Ile-51 | 40 | 61,50 | |
| Phe-51 | 7 | 10,76 | ||
| Lys-51 | 1 | 1,53 | ||
| Leu-51 | 3 | 4,61 | ||
| Pro-51 | 3 | 4,61 | ||
| Ser-51 | 1 | 1,53 | ||
| Met-51 | 0 | 0 | ||
| Thr-51 | 0 | 0 | ||
| Val-51 | 0 (0) | 0 | ||
| Blood (n=66) | ||||
| dhfr_59 | Wild type (C) | Cys-59 | 10 | 15,15 |
| Mutants | Arg-59 | 36 | 54,54 | |
| Ala-59 | 1 | 1,51 | ||
| Gly-59 | 11 | 16,66 | ||
| Leu-59 | 1 | 1,51 | ||
| Ser-59 | 5 | 7,57 | ||
| Trp-59 | 2 | 3,03 | ||
| Pro-59 | 0 | 0 | ||
| Asn-59 | 0 | 0 | ||
| Val-59 | 0 | 0 | ||
| Phe-59 | 0 | 0 | ||
| Tyr-59 | 0 | 0 | ||
| Blood (n=81) | ||||
| dhfr_108 | Wild type (S) | Ser-108 | 14 | 17,28 |
| Mutants | Asn-108 | 60 | 74,07 | |
| Ala-108 | 2 | 2,46 | ||
| Phe-108 | 1 | 1,23 | ||
| His-108 | 2 | 2,46 | ||
| Thr-108 | 1 | 1,23 | ||
| Val-108 | 1 | 1,23 | ||
| Asp-108 | 0 | 0 | ||
| Lys-108 | 0 | 0 | ||
| Gly-108 | 0 | 0 | ||
| Pro-108 | 0 | 0 | ||
| Ile-108 | 0 | 0 | ||
| Arg-108 | 0 | 0 | ||
Appendix 4.
Frequency of other mutant genotypes corresponding to the pfdhfr-ts gene in blood
| Blood | ||||||
|---|---|---|---|---|---|---|
| Haplotype | N51I | C59R | S108N | n | Proportions (%) | |
| WT | N | C | S | 12 | 13,96 | |
| SM | 9 | 10,47 | ||||
| N | C | T | 1 | 1,16 | ||
| I | C | S | 2 | 2,33 | ||
| N | C | F | 1 | 1,16 | ||
| N | C | N | 2 | 2,33 | ||
| F | C | S | 0 | 0,00 | ||
| N | C | V | 1 | 1,16 | ||
| L | C | S | 1 | 1,16 | ||
| P | C | S | 1 | 1,16 | ||
| N | C | D | 0 | 0,00 | ||
| N | C | R | 0 | 0,00 | ||
| N | C | P | 0 | 0,00 | ||
| N | W | S | 0 | 0,00 | ||
| DM | 26 | 30,23 | ||||
| N | G | A | 1 | 1,16 | ||
| N | S | N | 2 | 2,33 | ||
| L | G | S | 2 | 2,33 | ||
| F | C | N | 2 | 2,33 | ||
| N | R | N | 8 | 9,30 | ||
| I | C | N | 7 | 8,14 | ||
| N | G | N | 2 | 2,33 | ||
| N | A | A | 1 | 1,16 | ||
| P | F | S | 0 | 0,00 | ||
| M | R | S | 0 | 0,00 | ||
| P | G | S | 0 | 0,00 | ||
| F | C | G | 0 | 0,00 | ||
| P | A | S | 0 | 0,00 | ||
| F | C | S | 0 | 0,00 | ||
| I | W | S | 0 | 0,00 | ||
| I | R | S | 0 | 0,00 | ||
| I | F | S | 0 | 0,00 | ||
| N | P | N | 0 | 0,00 | ||
| I | C | D | 0 | 0,00 | ||
| T | N | S | 0 | 0,00 | ||
| N | W | N | 0 | 0,00 | ||
| N | Y | N | 0 | 0,00 | ||
| P | W | S | 1 | 1,16 | ||
| TM | 39 | |||||
| S | G | N | 1 | 1 | ||
| F | L | N | 1 | 1 | ||
| I | G | H | 1 | 1 | ||
| F | S | N | 2 | 2 | ||
| I | R | N | 27 | 27 | ||
| I | R | H | 1 | 1 | ||
| K | G | N | 1 | 1 | ||
| I | W | N | 1 | 1 | ||
| I | S | N | 1 | 1 | ||
| F | G | N | 2 | 2 | ||
| P | G | N | 1 | 1 | ||
| P | R | R | 0 | 0 | ||
| F | R | N | 0 | 0 | ||
| I | L | N | 0 | 0 | ||
| F | P | I | 0 | 0 | ||
| F | P | N | 0 | 0 | ||
| F | W | N | 0 | 0 | ||
| V | R | N | 0 | 0 | ||
| I | V | K | 0 | 0 | ||
| V | R | K | 0 | 0 | ||
| T | L | R | 0 | 0 | ||
| T | F | K | 0 | 0 | ||
Abbreviations
- pfcrt:
Plasmodium falciparum Chloroquine Resistance Transporter
- pfdhfr-ts:
Plasmodium falciparum Dihydrofolate Reductase Thymidylate Synthetase
- pfk13 propeller:
Plasmodium falciparum Kelch13 Propeller
- PCR:
Polymerase Chain Reaction
- DNA:
Deoxyribonucleic Acid
- EDTA:
Ethylene Diamine Tetra-Acetic Acid
Ethical Considerations
The study was conducted in accordance with the Declaration of Helsinki and approval was received from the National Ethics and Research Committee (CNER) in Life Sciences and Health of Côte d'Ivoire. After appropriate information and explanations, the adult participants and the parents or legal guardians of all children wishing to participate in the study gave their written consent prior to sampling.
Competing Interests
The authors declare no competing interests.
References
- 1.WHO Malaria Policy Advisory Committee and Secretariat: Malaria Policy Advisory Committee to the WHO: Conclusions and recommendations of seventh biannual meeting (March 2015). Malar J. 2015;14:295. doi: 10.1186/s12936-015-0787-z. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.WHO: World malaria report 2023. Geneva: World Health Organization 2023. Licence: CC BY-NC-SA 3.0 IGO; https://tinyurl.com/2phyysn8 . [Google Scholar]
- 3.Hassett MR, Roepe PD. Origin and spread of evolving artemisinin-resistant Plasmodium falciparum malarial parasites in Southeast Asia. Am J Trop Med Hyg. 2019;101:1204–11. doi: 10.4269/ajtmh.19-0379. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Harinasuta T, Suntharasamai P, Viravan C. Chloroquine-resistant falciparum malaria in Thailand. Lancet. 1965;2:657–60. doi: 10.1016/s0140-6736(65)90395-8. Doi: [DOI] [PubMed] [Google Scholar]
- 5.Harinasuta T, Viravan C, Reid HA. Sulphormethoxine in chloroquine-resistant falciparum malaria in Thailand. Lancet. 1967;27(1(7500)):1117–9. doi: 10.1016/s0140-6736(67)91703-5. Doi: [DOI] [PubMed] [Google Scholar]
- 6.WHO: Guidelines for the Treatment of Malaria. 3rd ed. Geneva: World Health Organization; 2015. https://tinyurl.com/5etnfx77 (accessed on 2 January 2025) [PubMed] [Google Scholar]
- 7.Niba PTN, Nji AM, Evehe MS, et al. Drug resistance markers within an evolving efficacy of antimalarial drugs in Cameroon: a systematic review and meta-analysis (1998-2020). Malar J. 2021;20:32. doi: 10.1186/s12936-020-03543-8. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Plowe CV. The evolution of drug-resistant malaria. Trans R Soc Trop Med Hyg. 2009;103:S11–S14. doi: 10.1016/j.trstmh.2008.11.002. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Eboumbou Moukoko EC, Bogreau H, Briolant S, Pradines B, Rogier C. Molecular markers of Plasmodium falciparum resistance to antimalarial drugs. Med Trop. 2009;69:606–612. PMID 20099681. [PubMed] [Google Scholar]
- 10.Picot S, Olliaro P, De Monbrison F, Bienvenu A-L, Price RN, Ringwald P. A systematic review and meta-analysis of evidence for correlation between molecular markers of parasite resistance and treatment outcome in falciparum malaria. Malar J. 2009;8:89. doi: 10.1186/1475-2875-8-89. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gesase S, Gosling RD, Hashim R, Ord R, Naidoo I, Madebe R, et al. High resistance of Plasmodium falciparum to sulphadoxine/pyrimethamine in northern Tanzania and the emergence of dhps resistance mutation at Codon 581. PLoS ONE. 2009;4:e4569. doi: 10.1371/journal.pone.0004569. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Desai M, Gutman J, Taylor SM, Wiegand RE, et al. Impact of sulfadoxine-pyrimethamine resistance on efectiveness of intermittent preventive therapy for malaria in pregnancy at clearing infections and preventing low birth weight. Clin Infect Dis. 2016;62:323–33. doi: 10.1093/cid/civ881. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.WHO Global Malaria Programme: Artemisinin resistance and artemisinin-based combination therapy efficacy: status report. Geneva: World Health Organization; 2019. https://tinyurl.com/ycxy8sj4 (accessed on 2 January 2025) [Google Scholar]
- 14.Ariey F, Witkowski B, Amaratunga C, Beghain J, et al. A moleculair marker of artemisin-resistant Plasmodium falciparum malaria. Nature. 2014;505:50–55. doi: 10.1038/nature12876. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ménard D, Khim N, Beghain J, Adegnika AA, et al. A Worldwide map of Plasmodium falciparum K13-propeller polymorphisms. N Engl J Med. 2016;374:2453–2464. doi: 10.1056/NEJMoa1513137. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Adja AM, N'goran EK, Koudou BG, Dia I, et al. Contribution of Anopheles funestus, An. gambiae and An. nili (Diptera: Culicidae) to the perennial malaria transmission in the southern and western forest areas of Côte d'Ivoire. Ann Trop Med Parasitol. 2011;105:13–24. doi: 10.1179/136485910X12851868780388. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Miguel RH, Coura JR, Samudio F, Suárez-mutis MC, et al. Evaluation of three different DNA extraction methods from blood samples collected in dried filter paper in Plasmodium subpatent infections from the Amazon region in Brazil. Rev Inst Med Trop Sao Paulo. 2013;55:205–208. doi: 10.1590/S0036-46652013000300012. Doi: [DOI] [PubMed] [Google Scholar]
- 18.Team R Core. A language and environment for statistical computing. R Foundation for Statistical Computing; Vienna, Austria: ISBN 3-900051-07-0. https://www.R-project.org/ (accessed on 2 January 2025) [Google Scholar]
- 19.Ako ABA. Évolution des résistances à la sulfadoxine-pyriméthamine et à la chloroquine, et analyse de la complexité des infections à Plasmodium falciparum, Welch (1897) dans quatre localités en Côte d’Ivoire. PhD these. Université Félix Houphouët Boigny, UFR Biosciences; 2014. p. 163. https://tinyurl.com/4jmjp4xs (accessed 2 January 2025) [Google Scholar]
- 20.Djaman J, Ahibo H, Yapi HF., Bla KB, et al. Molecular Monitoring of Plasmodium falciparaum Malaria isolates in Côte d'Ivoire: Genetic Markers (dhfr-ts, dhps, pfcrt, pfmdr-1) for antimalarial-drugs resistance. Eur J Sci Res. 2010;40:1450–216. https://tinyurl.com/yjrjjz8n [Google Scholar]
- 21.Ouattara L, Bla KB, Assi SB, Yavo W, et al. PFCRT and DHFR-TS Sequences for Monitoring Drug Resistance in Adzopé Area of Côte d'Ivoire After the Withdrawal of Chloroquine and Pyrimethamine. Trop j pharm res. 2010;9:565–572. doi: 10.4314/tjpr.v9i6.63556. Doi: [DOI] [Google Scholar]
- 22.Ako BA., Offianan AT, Johansson M, Penali LK, et al. Molecular analysis of markers associated with chloroquine and sulfadoxine/pyrimethamine resistance in Plasmodium falciparum malaria parasites from southeastern Côte-d'Ivoire by the time of Artemisinin-based Combination Therapy adoption in 2005. Infect Drug Resist. 2012;5:113–120. doi: 10.2147/IDR.S31409. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.PNLP. Guide national de prise en charge du paludisme. Côte d'Ivoire, Ministère de la Santé. de l’Hygiène Publique et de la Couverture Maladie Universelle; 2022. p. 31. https://tinyurl.com/mv6uwu27 (accessed 2 January 2025) [Google Scholar]
- 24.Berzosa P, Esteban-Cantos A, García L, González V, et al. Profile of molecular mutations in pfdhfr, pfdhps, pfmdr1, and pfcrt genes of Plasmodium falciparum related to resistance to different anti-malarial drugs in the Bata District (Equatorial Guinea) Malar J. 2017;16:28. doi: 10.1186/s12936-016-1672-0. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Newton PN, Green MD, Fernandez FM. Impact of poor-quality medicines in the 'developing' world. Trends in Pharmacological Sci. 2010;31:99–101. doi: 10.1016/j.tips.2009.11.005. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yeung S, Lawford HLS, Tabernero P, et al. Quality of Antimalarials at the Epicenter of Antimalarial Drug Resistance: Results from an Overt and Mystery Client Survey in Cambodia. Am J Trop Med Hyg. 2015;92(6 Suppl):39–50. doi: 10.4269/ajtmh.14-0391. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Somé AF, Sorgho H, Zongo I, Bazié T, et al. Polymorphisms in K13, pfcrt, pfmdr1, pfdhfr, and pfdhps in parasites isolated from symptomatic malaria patients in Burkina Faso. Parasite. 2016;23:60. doi: 10.1051/parasite/2016069. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.L'Episcopia M, Doderer-Lang C, Perrotti E, Priuli GB, et al. Polymorphism analysis of drug resistance markers in Plasmodium falciparum isolates from Benin. Acta Trop. 2023;245:106975. doi: 10.1016/j.actatropica.2023.106975. Doi: [DOI] [PubMed] [Google Scholar]
- 29.Biswas S, Escalante A, Chaiyaroj S, Angkasekwinai P, et al. Prevalence of point mutations in the dihydrofolate reductase and dihydropteroate synthetase genes of Plasmodium falciparum isolates from India and Thailand: a molecular epidemiologic study. Trop Med Int Health. 2000;5:737–743. doi: 10.1046/j.1365-3156.2000.00632.x. Doi : [DOI] [PubMed] [Google Scholar]
- 30.Gregson A, Plowe CV. Mechanisms of resistance of malaria parasites to antifolates. Pharmacol Rev. 2005;57:117–145. doi: 10.1124/pr.57.1.4. Doi: [DOI] [PubMed] [Google Scholar]
- 31.Pulcini S, Staines HM, Lee AH, et al. Mutations in the Plasmodium falciparum chloroquine resistance transporter, PfCRT, enlarge the parasite's food vacuole and alter drug sensitivities. Sci Rep. 2015;5:14552. doi: 10.1038/srep14552. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Foguim FT, Bogreau H, Gendrot M, et al. Prevalence of mutations in the Plasmodium falciparum chloroquine resistance transporter, PfCRT, and association with ex vivo susceptibility to common anti-malarial drugs against African Plasmodium falciparum isolates. Malar J. 2020;19:201. doi: 10.1186/s12936-020-03281-x. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Parida P, Sarma K, Borkakoty B, Mohapatra PK. Structure and Functional Differentiation of PfCRT Mutation in Chloroquine Resistance (CQR) in Plasmodium falciparum Malaria. Current Topics in Malaria. 2016 doi: 10.5772/64659. Doi: [DOI] [Google Scholar]
- 34.Kouman KBA, Ako AAB, Trebissou JND, Assi S, et al. Analysis of Plasmodium falciparum Resistance to Chloroquine in Côte d'Ivoire After 20 Years: High Prevalence of Wild Strains. Int J Curr Microbiol App Sci. 2023;12:125–134. doi: 10.20546/ijcmas.2023.1202.012. Doi : [DOI] [Google Scholar]
- 35.Gardella F, Assi S, Simon F, Bogreau H, et al. Antimalarial drug use in general populations of tropical Africa. Malar. J. 2008;7:124. doi: 10.1186/1475-2875-7-124. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ord R, Alexander N, Dunyo S, Hallett R, et al. Seasonal carriage of pfcrt and pfmdr1 alleles in Gambian Plasmodium falciparum imply reduced fitness of chloroquine-resistant parasites. J Infect Dis. 2007;196:1613–1619. doi: 10.1086/522154. Doi: [DOI] [PubMed] [Google Scholar]
- 37.Kublin JG, Cortese JF, Njunju EM, Mukadam RA, et al. Reemergence of chloroquine- sensitive Plasmodium falciparum malaria after cessation of chloroquine use in Malawi. J Infect Dis. 2003;187:1870–1875. doi: 10.1086/375419. Doi: [DOI] [PubMed] [Google Scholar]
- 38.Zhao D, Zhang H, Ji P, Li S, et al. Surveillance of Antimalarial Drug-Resistance Genes in Imported Plasmodium falciparum Isolates From Nigeria in Henan, China, 2012-2019. Front Cell Infect Microbiol. 2021;11:644576. doi: 10.3389/fcimb.2021.644576. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Toure OA, Landry TN, Assi SB, Kone AA, et al. Malaria parasite clearance from patients following artemisinin-based combination therapy in Côte d'Ivoire. Infect Drug Resist. 2018;11:2031–2038. doi: 10.2147/IDR.S167518. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Bédia-Tanoh AV, Kassi KF, Touré OA, Assi SB, et al. Meta-Analysis of Data from Four Clinical Trials in the Ivory Coast Assessing the Efficacy of Two Artemisinin-Based Combination Therapies (Artesunate-Amodiaquine and Artemether-Lumefantrine) between 2009 and 2016. Trop Med Infect Dis. 2023;9:10. doi: 10.3390/tropicalmed9010010. Doi: [DOI] [PMC free article] [PubMed] [Google Scholar]