Assessment of various etiological factors for oral squamous cell carcinoma in non-habit patients- a cross sectional case control study

Abstract

Background

Oral squamous cell carcinoma (OSCC) is one of the most prevalent oral cancers in the world. The major etiological factors are considered to be tobacco and alcohol. However, the etiological factors for non-habit associated oral squamous cell carcinoma (NHOSCC) remains an enigma. So we focused in assessing various etiological factors like genetic factor, microbial factor, dental factor and the biochemical factor of non-habit associated oral squamous cell carcinoma. The aim was to assess Harvey Rat Sarcoma Virus gene (HRAS) mutation, total bacterial count, Herpes Simplex Virus-1 (HSV-1), regressive changes of teeth, total antioxidant capacity and its association with NHOSCC.

Materials and methods

A total of 564 (n = 564) patients with OSCC were included in the study. Out of 564 patients, 282 patients had NHOSCC and 282 patients had habit associated oral squamous cell carcinoma (HOSCC). The isolated DNA from the tissue was subjected to Sanger’s sequencing analysis for mutation analysis of the HRAS gene. The isolated serum was subjected to HSV-1 ELISA analysis and TAC ELISA analysis. The dental cast used to analyze the presence of sharp teeth/ any other form of regressive changes of teeth.

Results

Firstly, we found 3 novel pathogenic mutations c.16C > A/p.L6M (missense mutation), c.359 T > C/p.L120P (point mutation), c.382C > T/p.R128W (missense mutation) of HRAS gene in NHOSCC samples by genetic analysis. No significant difference was noted in the total bacterial count between the non-habit associated and habit associated oral squamous cell carcinoma (HOSCC). The binary logistic regression showed patients with HSV1 infection have 2.667 odds (2.667 OR, CI, 1.589- 4.484) of getting NHOSCC and it was found to be statistically significant (p < 0.001).The dental analysis revealed that patients with regressive changes have 4.432 odds (4.432 OR, CI, 2.807- 6.998) of getting NHOSCC and it was found to be statistically significant (p < 0.001). The biochemical analysis revealed patients with lower total antioxidant capacity have 0.671 odds (0.671 OR, CI, 0.621–0.725) of getting NHOSCC and was found to be statistically significant (p < 0.001). Our results suggest that the frequency of HRAS mutation in NHOSCC is high. HSV1, oxidative stress and regressive changes of teeth are associated with NHOSCC.

Conclusion

Our results suggest that the frequency of HRAS mutation in NHOSCC is high. HSV1, oxidative stress and regressive changes of teeth are associated with NHOSCC.

Background

Cancer is the second leading cause of mortality in the world and acts as a crucial barrier to increase the life expectancy. In the year 2020, the Global Cancer Observatory (GLOBOCAN) reported around 19.3 million new cases and 10 million deaths globally. It is expected that by the year 2040, there will be an increase in the number of cancer cases by 47% which is an estimated value of 28.4 million new cancer cases [1]. Oral cancer is the sixth most common cancer in the world accounting to 377,713 new cases and 177,757 deaths globally [2]​. According to the National Cancer Registry Programme 2022, the burden of oral cancer is found to be high in India making it the second most common cancer in India accounting for 1,45,844 new oral cancer cases in males and 52,594 in females [3]. The age-standardized incidence rate of oral cancer in India is 12.6 per 1,00,000 people and is found to be rising rapidly [4]. Oral Squamous Cell Carcinoma (OSCC) accounts for approximately 90% of all oral cancers [5].​

Clinically OSCC is characterized as an ulcerated lesion with necrotic central area surrounded by elevated rolled borders, exophytic growth, indurated non-ulcerative patch (endophytic) or a combination of all these features. Patient generally complains of difficulty in mouth opening, eating and talking [6]​. The lesion most commonly appears in the buccal mucosa, lateral border/ ventral surface of tongue, dorsum of tongue, vermilion border of upper and lower lip, alveolar ridges, hard palate, soft palate, floor of the mouth, gingivobuccal sulcus [7]​.

OSCC is a multifactorial disease and is caused by various factors like tobacco, betel quid, areca nut, alcohol, diet, family history of head and neck squamous cell carcinoma, immune deficiency, radiation [8]​. Alcohol and cigarette smoking are considered to have synergistic effect in causing OSCC [9]. Heavy alcohol consumption with increased cigarette smoking is known to increase the risk of OSCC because of the carcinogen acetaldehyde which is the end product during the conversion of ethanol in the presence of alcohol dehydrogenase 3 (ADH3) ​23 [10]. Though alcohol and tobacco are considered to be the most common etiological factors of habit associated oral squamous cell carcinoma (HOSCC), there is a growing incidence of non-habit associated oral squamous cell carcinoma (NHOSCC). Studies reveal that 4–6% of OSCC are not associated with any oral habits [11]. A study analyzed the case records of patients, which revealed interesting observations. 82% of young oral cancer patients ≤ 30 years of age in the study population had no habits and 28% of oral cancer patients ≥ 30 years of age in the study population had no habits [12]. A study also addressed that the incidence and prevalence of non-habit associated oral cancer is seen more commonly in females than in males whereas male predilection is seen is generally seen in habit associated oral cancer [13]. Another important evidence explaining the reason for female predilection in non-habit oral cancer is linked to altered levels of luteinizing hormone, prolactin, follicle stimulating hormone, testosterone and also in the metabolism of estrogen especially estradiol [14, 15]. Various studies have tried to determine the possible etiologies of NHOSCC but the results were highly controversial [16–20]​. The lack of etiologies prompted to postulate immune deficiency and dietary intake as contributing factors [21]. Genetic mutations, oral microflora, Herpes Simples Virus-1 (HSV-1), regressive changes of teeth/ sharp teeth, Total Antioxidant Capacity (TAC) are considered to be potential carcinogenic factors. Gene mutations are alterations in the genetic material (genome) of a living cell. Such alterations in the genetic material can alter the structure and intensify the function of the proteins that induces uncontrollable division and proliferation of the cells eventually leading to carcinogenesis [22]. RAS proteins are found to be frequently mutated in cancers. The RAS proteins are encoded by the genes namely Harvey Rat Sarcoma Viral oncogene homolog (HRAS), Kristen rat sarcoma virus (KRAS) and Neuroblastoma ras viral oncogene (NRAS) respectively. They are GTPases that act as molecular switches in regulating the molecular pathways of cell proliferation and survival [23]. HRAS mutations are found to be more prevalent in oral cavity and salivary gland tumors [24]. Another important factor is oral microflora. Oral cavity is an important ecological site for colonization of the microorganisms [25]​. The oral microorganisms play vital role in maintaining the normal physiological environment by a symbiotic relationship [26]. But microbial dysbiosis alters this normal physiological process leading to the pathogenesis of various diseases like oral cancer, periodontal disease, dental caries, bacterial /fungal /viral infections predominantly affecting the quality of life of the patients [27]​. Among the oral microorganisms, HSV-1 is considered to be highly pathogenic but its association with OSCC remains enigmatic. Various studies have proved the strong association of oral microflora with OSCC [28]. The regressive changes of teeth/ sharp teeth left unnoticed leads to chronic mucosal irritation. This irritation is considered as a risk factor for oral cancer [29, 30]​. It has been reported that 44% of OSCC on tongue showed signs of mechanical trauma [31]. It is also found that the risk of OSCC increases win patients with habits of biting the oral mucosa on a regular basis. Mechanisms involving the interruption of normal architecture of the extracellular matrix leading to the expression of oncogenes, hyper-proliferation, inflammatory microenvironment and enabled exposure to carcinogens have been an aggravating factors for chronic trauma in carcinogenesis [32]. Total antioxidant status is the measure of overall antioxidant level of the body [33]. It is an indicator of oxidative stress and the susceptibility to oxidative damage. The sustained prevalence of oxidative stress leads to the accumulation of genetic damage leading to the initiation of carcinogenesis [34]. Whereas, the association of HRAS mutation, oral microflora, HSV-1, regressive changes of teeth/ sharp teeth, total antioxidant status with NHOSCC remains unexplored. So, we assessed various etiological factors like genetic factor, microbial factor, dental factor and the biochemical factor and its association in the etiology and pathogenesis of NHOSCC. The aim our study was to assess HRAS mutation, total bacterial count, HSV-1, regressive changes of tooth, total antioxidant capacity and their association with NHOSCC.

Methods

Study design

Ethical clearance

The study was conducted in Saveetha dental college and Hospitals, Chennai, Tamil Nadu and Malabar Cancer Centre, Thalassery, Kerala in accordance with the Declaration of Helsinki. The institutional ethical committee approval was obtained from Saveetha Dental College and hospitals, Chennai, Tamil Nadu (IHEC Ref. No: IHEC/SDC/OPATH-1601/21/189) and Malabar Cancer Centre, Thalassery, Kerala (No: 1617/IRB-IEC/13/MCC/16–5-2023/3, CDSCO Reg. No: ECR/780/Inst./KL/2015/RR-21). All the procedures involving the human participants were in accordance with the ethical standards of the institution. Informed consent in regional language (Tamil or Malayalam) or English was received from all the patients included in the study and a patient information sheet in regional language (Tamil or Malayalam) or English explaining about the aim and benefits of the study was also given to the patients. After receiving the informed consent from the patients, the samples were collected.

Patient selection

A total of 564 OSCC participants were included in the study and divided into two groups namely the cases and controls. The case group included 282 NHOSCC patients and the control group included 282 HOSCC patients. The included patients met the following criteria: the disease was primary, there was no previous history of other cancers, the history of habits was elicited before deciding to stratify a participant as case or control by taking case history, histopathologically confirmed OSCC cases with Bryne’s grading and TNM staging (AJCC Staging 8th edition) [35]. The exclusion criteria of the study included patients with secondary OSCC, patients with severe systemic illness, patients with nil mouth opening. A separate patient profoma was developed for the entry of case history that included family history, personal history (habits and duration) (smoking tobacco/chewing tobacco/ drinking alcohol), site, size and extent of the lesion, type of malocclusion.

Sample collection

Sample collection was carried out from December 2020-July 2023. The specimens that were collected from the patients included tissue, blood, saliva, dental impression of maxilla and mandible. The tissue samples of the included patients were collected during the biopsy from the Department of Oral and maxillofacial surgery of Saveetha dental college and hospitals, Chennai, Tamil Nadu and Malabar Cancer Centre, Thalassery, Kerala. The collected tissue samples were stored at -80 °C. Unstimulated saliva was collected in sterile saliva containers from the patients. Participants were instructed not to drink or eat before 2 h of sample collection. The patients were asked to rinse their mouth thoroughly before the saliva is being collected. The collected saliva was stored at -20°C before subsequent use. Venous blood from the included patients were collected in non-EDTA tube and was centrifuged at 3500 rpm for 5 min and the serum was isolated from the blood. The isolated serum was stored at—80°C.

Tissue, serum and plasma samples were stored at -80 °C, saliva samples were stored at -20 °C.

Genetic analysis

HRAS was the gene of interest of analysis. The tissue samples were subjected to Deoxyribo nucleic acid (DNA) extraction by using INVITROGEN^TM GENOMIC DNA MINI KIT (Thermofisher, Waltham, MA, USA) according to the manufacturer’s instructions. The concentration and the purity of the extracted DNA were assessed by using Nanodrop One (Thermofisher, USA), and visualized in agarose gel electrophoresis (AGE) . After DNA extraction, primer designing was done (Primer 3 Web, version 4.1.0). The human HRAS nucleotide sequence (Sequence ID: NC_000011.10) was retrieved from the National Centre for Biotechnology Information (NCBI). Based on the previous literature and criteria for choosing a primer to identify the desired site of exon and exon-intron boundaries of the HRAS gene, the six primers were selected to amplify the mutational hotspot exons of the HRAS gene [36–41] (Table 1).

Table 1.

Forward and reverse primers designed for the exons of HRAS gene

S. No	Exon	Primer	Base pair Length
1	1	Forward – 5’- GACGGAATATAAGCTGGTGG -3’ Reverse – 5’- TGGATGGTCAGCGCACTCTT -3’	63
2	2,3	Forward – 5’-CAGGAGACCCTGTAGGAGGA-3’ Reverse – 5’- TGGTGTTGTTGATGGCAAAC-3’	576
3	4	Forward- 5’-CTGTCCTCTCTGCGCATGTC-3’ Reverse- 5’-GAGGGTCAGTGAGTGCTGCTC-3’	317
4	5	Forward- 5’-ACTTCGAGATGGCCAGAGTC-3’ Reverse- 5’-ACCTCCATGTCCTGAGCTTG-3’	425
5	6	Forward-5’-CGGGCCAGGCAAGGCTTGAT-3’ Reverse-5’ -GGCACAAGGGAGGCTGCTGA-3’	320

DNA amplification and sequencing

The polymerase chain reaction (PCR) was done using the MiniAmp Plus thermal cycler (Applied biosystem by Thermofisher, USA) for the desired amplification of the target hotspot using five sets of forward and reverse primers. PCR reaction were prepared for 50µl volumes using 50 ng of genomic DNA as template, 0.5 μM of each primers (forward and reverse), 25µl of Emerald green 2 × PCR master mix (Takara, Tokyo, Japan) and DDH₂O. The PCR condition follows with initial denaturation at 94°C for 5 minutes, then 35 cycles of denaturation at 94°C for 35s, annealing at 55 to 58ºC for 35s, extension at 72°C for 35s, and a final extension at 72°C for 5 minutes. Amplified PCR product was subjected to gel electrophoresis on a 2% agarose gel was checked for quality and 25 µL of PCR product was used for Sanger’s sequencing.

The Sanger’s sequencing results were analyzed using the software DNA STAR (Madison, Wisconsin USA). The novelty and pathogenicity of the mutations were assessed by using the bioinformatics softwares SIFT, PolyPhen 2, GnomAD.

Microbial analysis

Total bacterial quantification

DNA isolation

The saliva collected from OSCC patients was inoculated in Brain Heart Infusion broth incubated for 24 hours at 37°C. Then the treated sample was subjected to DNA isolation. The treated saliva sample was mixed with 200 µl of Phosphate buffer Saline (1X PBS) and vortexed for 30 seconds. Then the suspension was spun at 8000 rpm for 2 minutes. As a result, the pellet and the supernatant are formed. The supernatant is discarded and the pellet was resuspended in 180 µl of digestion buffer and 20 µl of lysozyme. After gentle vortexing for 10 seconds and brief centrifugation, the suspension was incubated at 37°C for 15 minutes. 200 µl of binding buffer and 20 µl of proteinase K were added and the suspension was subjected to pulse vortexing. After a brief spin, the suspension was incubated at 56°C for 15 minutes. 200 µl of 100% ethanol was added and was mixed thoroughly. The entire suspension was then transferred to a spin column. The tubes were centrifuged at 8000 rpm for 1 minute. After discarding the flow through, the column was placed back to the same collection tube. Then, 500 µl of Wash buffer I (Ethanol added), was added to the spin column and was subjected to centrifugation at 10000 rpm for 1 minute and the flow through was discarded. After discarding the flow through, the column was placed back to the same collection tube. 500 µl of Wash buffer II (Ethanol added) was added to the spin column and was subjected to centrifugation at 10000 rpm for 1 minute. The tubes were subjected to brief spin to remove any residual ethanol. The collection tube along with the flow through was discarded and the column was placed in a fresh 1.5 ml microcentrifuge tube. Around 100 µl of pre-warmed elution buffer was added to the center of the spin column membrane and the tubes were incubated at 37°C for 2 minutes and subjected to centrifugation at 13000 rpm for 1 minute. After centrifugation, the spin column was discarded and the isolated DNA was stored at - 20°C. The quantitative analysis of the isolated DNA was analysed using Nanodrop One (Thermo Fischer scientific, USA).

Primer designing

For total bacterial quantification, universal primer (universal primers are complementary to nucleotide sequences that are very common in a particular set of DNA molecules and cloning vectors which enable them to bind with a wide variety of DNA templates) was selected. The primer sequence given in Table 2 was synthesized from Eurofins, Bangalore, India.

Table 2.

Ubi forward and Ubi reverse primer that were used for total bacterial quantification

Primer
Ubi Forward- GATTAGATACCCTGGTAGTCCAC
Ubi Reverse- TACCTTGTTACGACTT

Quantitative real time PCR

Quantitative real time PCR was performed in 20 µl reaction. The reaction mixture was composed of 2X SYBR Premix, (TaKaRa, Shiga, Japan), the designed primer, the isolated bacterial DNA and the standard. The procedure was performed in the Biorad CFX96 thermal cycling system (Bio-Rad, Hercules, CA, USA). The reaction procedure was set at initial denaturation at 95°C for 3 minutes, cycling 95°C for 10 seconds, annealing 60°C for 30 seconds for 39 cycles followed by melt curve. Standard dilution of bacterial DNA was prepared and run along with the test samples. By using the associated Ct values, which were used to extrapolate and represent the copy numbers for the test samples as copies/mL, the standard curve was plotted for the serially diluted samples. At the conclusion of the extension step on each cycle, fluorescence signals were measured. Utilising CFX Maestro Software (BioRad, USA), the obtained data were examined.

HSV-1 ELISA analysis

Human Herpes Simplex Virus1, HSV1 antibody,IgG BT- LAB kit was for HSV-1 detection in serum. The ELISA analysis was performed according to the manufacturer’s instructions. After determining the optical density (OD values) of the wells in the ELISA plate, the readings of the duplicate samples were noted and the average value was taken. The valence of Herpes Simplex virus 1 (HSV1), the values of the sample well were compared with the values of the control well. Cutoff value was calculated by average of negative control value+0.15. If the OD value > cutoff value, it was considered HSV1 positive and if the OD value< cut off value, it was considered HSV1 negative.

Dental analysis

The oral cavity of the OSCC patients was examined and checked for regressive changes in the teeth. Alginate impression material was used to take the alginate impression of the OSCC patients. Immediately type 3 dental stone was used to fabricate the cast of the impression and Type 1 impression plaster was used to fabricate the base of the cast. Methods for identifying the sharp tooth or broken tooth or attrition or any other regressive changes of teeth in the location adjacent to the lesion included thorough clinical examination of the inter-occlusal distance and analyzing the models for dimensional changes of the teeth and the morphological changes by comparing with normal anatomical dimensions and morphologies.

Biochemical analysis

Total anti-oxidant capacity colorimetric assay kit (Abbkine, China) was used for the estimation of total antioxidant levels. The procedure was followed according to the manufacturer’s instructions. After determining the optical density (OD values) of the wells in the ELISA plate, the readings of the duplicate samples were noted and the average value was taken. The total anti-oxidant capacity (TAC) of the cases and controls was calculated by the formula,

$$\mathrm{TAC}\left(\mu ,\mathrm{mol},/,\mathrm{mL}\right)=\mathrm{y}\mathrm{x}{\mathrm{V}}_{\mathrm{Reaction}\mathrm{total}}+{\mathrm{V}}_{\mathrm{Sample}}\mathrm{x}\mathrm{n}=19\mathrm{xyxn},$$

Where VReaction total: total reaction volume, 0.19 mL, V Sample: sample volume added, 0.01 mL. Standard curve calculation formula of TAC: y = 4.4664x + 0.0685 where x is the absorbance change value (ΔA). The ΔA value was substituted into the equation to obtain the y value (µmol/mL).

Statistical analysis

The Normality tests Kolmogorov–Smirnov and Shapiro-Wilks tests results reveal that the variable (Age) follows Normal distribution, other variables HSV1, TAC and microbial counts do not follow Normal distribution. Therefore, to analyse the data both parametric and non-parametric methods are applied. To compare mean age between Cases and Controls independent samples t-test is applied. To compare HSV1, TAC values and microbial counts between Cases and Controls independent samples Mann Whitney U test is applied. To compare proportions between case and control groups Chi-Square test is applied, if any expected cell frequency is less than five then Fisher’s exact test is used. Binary logistic regression (both Univariate and Multivariate) analysis was done to identify risk factors for Cases. The factors which has a p-values less than 0.2 was considered for univariate and Backward stepwise (Wald) procedure was used to select the factors in multivariate LR model. The collected data were entered in the Microsoft Excel 2016 and to analyze the data SPSS (IBM SPSS Statistics for Windows, Version 26.0, Armonk, NY: IBM Corp. Released 2019) was used. Significance level was fixed as 5% (α = 0.05).

Results

Demographic characteristics

A total of n=564 participants (438 males and 126 females) were recruited in the study. The case group included n=282 (50%) NHOSCC patients (NH) and the control group included n=282 HOSCC patients (H). For the baseline demographic characteristics of the participants, factors like age, sex, diagnosis, T-stage, site of the lesion, side of the lesion between the cases and controls were statistically analyzed using Chi-square test. The NH group consisted of 282 patients with 33 (11.7%) were aged <=40 years, 31 (11%) were aged 41-45 years, 45 (16%) were aged 46-50 years, 54 (19.1%) were aged 51-55 years, 44 (15.6%) were aged 56-60 years, 32 (11.3%) were aged 61-65, 43 (15.2%) were aged >65 years. The mean age of NHOSCC patients was 54.358. 82 (29.1%) MDSCC, 128 (45.4%) WDSCC, 14 (5%) PDSCC, 24 (8.5%) SISCC, 34 (12.1%) SCC. 106 (37.6%) Lateral border of tongue, 82 (29.1%) buccal mucosa, 59 (20.9%) mandible, 9 (3.2%) GBS, 5 (1.8) floor of the mouth, 3 (1.1%) lip, 18 (6.4%) maxilla. The H group consisted of 282 patients with 38 (13.5%) were aged <=40 years, 32 (11.3%) were aged 41-45 years, 47 (16.7%) were aged 46-50 years, 54 (19.1%) were aged 51-55 years, 48 (17.0%) were aged 56-60 years, 31 (11.0%) were aged 61-65, 32 (11.3%) were aged >65 years. The mean age of HOSCC patients was 53.128. 68 (24.1%) MDSCC, 129 (45.7%) WDSCC, 17 (6%) PDSCC, 17 (6%) SISCC, 45 (16%) SCC. 58 (20.6%) Lateral border of tongue, 115 (40.8%) buccal mucosa, 61 (21.6%) mandible, 12 (4.3%) GBS, 4 (1.4) floor of the mouth, 4 (1.4%) lip, 28 (9.9%) maxilla. Patients in the NH group were more likely to be males (p< 0.001) and the common site of lesion was lateral border of tongue (p=0.001) and there were no apparent significant difference in other factors (Table 3).

Table 3.

Baseline characteristics of patients with OSCC

Factors				Group				p-value
		H (Control)		NH (Case)		Total
		N	%	N	%	N	%
Age Group (in years)	< = 40	38	13.5	33	11.7	71	12.6	0.899
	41 – 45	32	11.3	31	11.0	63	11.2
	46 – 50	47	16.7	45	16.0	92	16.3
	51 – 55	54	19.1	54	19.1	108	19.1
	56 – 50	48	17.0	44	15.6	92	16.3
	61 – 65	31	11.0	32	11.3	63	11.2
	> 65	32	11.3	43	15.2	75	13.3
	Total	282	100.0	282	100.0	564	100.0
Sex	Male	260	92.2	178	63.1	438	77.7	< 0.001
	Female	22	7.8	104	36.9	126	22.3
	Total	282	100.0	282	100.0	564	100.0
Diagnosis	MDSCC	68	24.1	82	29.1	150	26.6	0.532
	WDSCC	129	45.7	128	45.4	257	45.6
	SCC	45	16.0	34	12.1	79	14.0
	PDSCC	17	6.0	14	5.0	31	5.5
	SISCC	23	8.2	24	8.5	47	8.3
	Total	282	100.0	282	100.0	564	100.0
T-Stage	T-1	13	4.6	16	5.7	29	5.1	0.956
	T-2	77	27.3	76	27.0	153	27.1
	T-3	44	15.6	43	15.2	87	15.4
	T-4	114	40.4	109	38.7	223	39.5
	NA	34	12.1	38	13.5	72	12.8
	Total	282	100.0	282	100.0	564	100.0
Site	Lateral border of tongue	58	20.6	106	37.6	164	29.1	0.001
	Buccal mucosa	115	40.8	82	29.1	197	34.9
	Mandible	61	21.6	59	20.9	120	21.3
	GBS	12	4.3	9	3.2	21	3.7
	Floor of the mouth	4	1.4	5	1.8	9	1.6
	Lip	4	1.4	3	1.1	7	1.2
	Maxilla	28	9.9	18	6.4	46	8.2
	Total	282	100.0	282	100.0	564	100.0
Side	Left	143	51.8	144	51.4	287	51.6	0.981
	Right	123	44.6	125	44.6	248	44.6
	Other	10	3.6	11	3.9	21	3.8
	Total	282	100.0	282	100.0	564	100.0

Genetic analysis

A novel missense mutation (c.16C>A/ p.L6M) was observed in 2 (0.7%) (1 male, 1 female) of NHOSCC patients. It refers to exon 1 where cytosine was substituted by adenine and results in point mutation (Fig. 1A). This mutation was found in none of the HOSCC patients.

Fig. 1.

Shows sequence electrophorogram fragment of the HRAS gene as determined by the Sanger’s sequence analysis (DNA STAR Software, (Madison, Wisconsin USA). A c.16C > A/ p.L6M in exon 1 of NHOSCC. B c.359 T > C/ p.L120P in exon 2 of NHOSCC. C c.382C > T/p.R128W in exon 2 of NHOSCC. D c.408C > G/p.S136R in exon 2 of NHOSCC. E c.417C > T/ p.I139I in exon 2 of NHOSCC. F c.507G > T/ p.R169R in exon 4 of NHOSCC. G c.96C > A/ p.Y32X in exon 2 of OSCC. H c.67C > T/p.L23L in exon 2 of OSCC. I c.166 C > A/ p.L56M in exon 2 of OSCC

In exon 2, four novel mutations were observed. One of the four mutations harboured (c.359 T>C/ p.L120P) was observed in 3 (1.06%) (1 male, 2 females) of NHOSCC patients. It refers to exon 2 where thymidine was substituted by cytosine and resulted in point mutation (Fig. 1B), (c.382C>T/p.R128W) was observed in 7 (2.48%) (5 males, 2 females) of NHOSCC patients. It refers to exon 2 where cytosine is substituted by thymidine and resulted in missense mutation (Fig. 1C). (c.408C>G/p.S136R) was observed in 9 (3.19%) (4 males, 5 females) of NHOSCC patients. It refers to exon 2 where cytosine is substituted by guanine (Fig. 1D). (c.417C>T/ p.I139I) was observed in 6 (2.12%) (3 males, 3 females) of NHOSCC patients. It refers to exon 2 where the cytosine is substituted by thymidine resulting in silent mutation (Fig. 1E).

In exon 4, one novel mutation was observed. (c.507G>T/ p.R169R) was observed in 9 (3.19%) (3 males, 6 females) of NHOSCC patients. It refers to exon 4 where the guanine is substituted by thymidine resulting in silent mutation (Fig. 1F).

In HOSCC patients, three novel mutations were observed in HOSCC patients. One of the three mutations harbored (c.96C>A/ p.Y32X) was observed in 6 (2.12%) (3 males, 3 females) of HOSCC patients. It refers to exon 2 where cytosine is substituted by adenine which resulted in stop codon (Fig. 1G). (c.67C>T/p.L23L) was observed in 8 (2.83%) (6 males, 2 females) of HOSCC patients (Fig. 1H). It refers to exon 2 where cytosine is substituted by thymidine which resulted in silent mutation. (c.166 C>A/ p.L56M) was observed in 3 (1.06%) (2 males, 1 female) of HOSCC patients.it refers to exon 2 where the cytosine is substituted by adenine resulting in point mutation (Fig. 1I). To our knowledge, there is no information available on these mutations in the literature.

Furthermore previously reported mutations like (c.317C>T/ p.S106L) was seen in 4 (1.41%) (1 male, 3 females) of NHOSCC patients. It refers to exon 2 where cytosine is substituted by thymidine which resulted in point mutation. (c.399C>T/ p.L133L) was seen in 4 (1.41%) (2 males, 2 females) of NHOSCC patients. It refers to exon 2 where cytosine is substituted by thymidine which resulted in silent mutation. (c.81 T>C/ p. H27H) was seen in 10 (3.54%) (7 males, 3 females) of NHOSCC patients. It refers to exon 2 where thymidine is substituted by cytosine which resulted in silent mutation. (c.30C>A/ p. Gly10Gly) was seen in 4 (1.41%) (4 males, 0 females) of HOSCC patients. It refers to exon 2 where cytosine is substituted by adenine which resulted in silent mutation. (c.81T>C/ p. H27H) was also seen in 25 (8.86%) (20 males, 5 females) of HOSCC patients. It refers to exon 2 where the thymidine is substituted by cytosine resulting in silent mutation.

Pathogenicity of the mutations

The pathogenicity of the mutations were predicted using various bioinformatics softwares SIFT, PolyPhen 2, GnomAD. The analysis revealed that the mutations (c.16C>A/ p.L6M) of exon 1, (c.359T>C/p.L120P) of exon 2, (c.382 C>T/ p.R128W) of exon 2 were found to be pathogenic mutations in NHOSCC. In addition, mutations like (c.96 C>A/ p.Y32X) of exon 2, (c.166C>A/p.L56M) of exon 2 were found to be pathogenic in HOSCC (Table 4).

Table 4.

HRAS mutation, nucleotide change, amino acid change of the patients

Exon	Nucleotide	Amino acid	Number of mutations n%	NH/H	Novelty
1	c.16C > A	p.L6M	2 (0.7%)	NH	Novel Pathogenic
2	c.359 T > C	p.L120P	3 (1.06%)	NH	Novel Pathogenic
2	c.382 C > T	p.R128W	7 (2.48%)	NH	Novel Pathogenic
2	c.317C > T	p.S106L	4 (1.41%)	NH	Reported Mutation
2	c.399C > T	p.L133L	4 (1.41%)	NH	Reported Synonymous
2	c.81 T > C	p. H27H	10 (3.54%)	NH	Reported Synonymous
2	c.408C > G	p.S136R	9 (3.19%)	NH	Novel non- Pathogenic
2	c.417C > T	p.I139I	6 (2.12%)	NH	Novel Synonymous
2	c.30 C > A	p. G10G	4 (1.41%)	H	Reported Synonymous
2	c.67 C > T	p.L23L	8 (2.83%)	H	Novel synonymous
2	c.81 T > C	p. H27H	25 (8.86%)	H	Reported Synonymous
2	c.96 C > A	p.Y32X	6 (2.12%)	H	Novel Pathogenic
2	c.166 C > A	p.L56M	3 (1.06%)	H	Novel Pathogenic
4	c.507 G > T	p. R169R	9 (3.19%)	NH	Novel synonymous

Microbial analysis

Total bacterial quantification

After the quantitative real time polymerase chain reaction, by using the associated Ct values (Fig. 2A), which were used to extrapolate and represent the copy numbers for the test samples as copies/mL, the standard curve (Fig. 2B) was plotted for the serially diluted samples. The total oral bacterial count of NHOSCC and HOSCC patients was compared and the analysis revealed that that there is no significant difference (p=0.929) (Fig. 2C) (Table 5) in the total bacterial count between the NHOSCC patients and HOSCC patients. Mann-Whitney U test was used to statistically analyze the total bacterial count between cases and controls.

Fig. 2.

A shows the Amplification plot demonstrating different ct values corresponding to different copy number of DNA isolated from samples of different groups, B shows the standard curve generated using standard dilutions of DNA with varying copy numbers and C shows the bar graph displaying the difference in abundance of total bacterial count between HOSCC and NHOSCC

Table 5.

Comparison of total bacterial count between HOSCC and NHOSCC

Age (Years)		Group			p-value
		HOSCC	NHOSCC	Total
Microbial count	N	282	282	564	0.929
	Mean	177456	173355	175405
	Std. Dev	597880	534552	566601
	Median	19405	22630	21572
	Minimum	1	1	1
	Maximum	4374076	4374076	4374076
	1st Quartile	3467	2728	3221
	3rd Quartile	79004	92591	85008

HSV-1 ELISA analysis

The positivity and negativity of the HSV1 in the cases and controls was statistically analyzed by using Chi-square test. The HSV1 ELISA analysis showed 19.1% (19 males, 10 females) (mean age: 53.793) of HSV1 IgG positive NHOSCC patients and 8.2% (18 males, 2 females) (mean age: 48.4166) of HSV1 IgG positive HOSCC patients (Fig. 3A) (Table 6). Mann Whitney U test was used to compare the HSV1 mean of NHOSCC and HOSCC. P<The mean HSV1 comparison between the NHOSCC patients and HOSCC patients showed statistical significance (p=0.004) (Fig. 3B) (Table 7). In order to identify the association, binary logistic regression was performed and the univariate logistic regression showed patients with HSV1 infection have 2.667 odds (2.667 OR, CI, 1.589-4.484) of getting NHOSCC and it was found to be statistically significant (p<0.001), the multivariate logistic regression showed patients with HSV1 infection have 2.236 odds ( 2.236 OR, CI, 1.130-4.424) of getting NHOSCC and it was found to be statistically significant (p=0.021) (Table 10).

Fig. 3.

A shows the bar graph displaying HSV1 positivity in HOSCC and NHOSCC and B shows the bar graph displaying the difference in HSV1 IgG levels of HOSCC and NHOSCC based on ELISA analysis

Table 6.

Comparison of HSV1 positivity between HOSCC and NHOSCC

				Group				p-value
Factor		HOSCC		NHOSCC		Total
		N	%	N	%	N	%
HSV1 Result	Negative	259	91.8	228	80.9	487	86.3	< 0.001
	Positive	23	8.2	54	19.1	77	13.7
	Total	282	100.0	282	100.0	564	100.0

Table 7.

Comparison of HSV1 IgG levels between HOSCC and NHOSCC

Age (Years)		Group			p-value
		HOSCC	NHOSCC	Total
HSV1	N	282	282	564	0.004
	Mean	.115	.127	.121
	Std. Dev	.116	.091	.105
	Median	.084	.087	.084
	Minimum	.003	.023	.003
	Maximum	.937	.937	.937
	1st Quartile	.065	.072	.068
	3rd Quartile	.131	.157	.138

Table 10.

Binary logistic regression (both Univariate and Multivariate) analysis done for HSV1, regressive changes and Total Antioxidant Capacity (TAC) to identify as risk factors for NHOSCC

	Factors	NHOSCC		Crude OR	95 % for COR		p-value	Adjusted OR	95% for COR		p-value
		N	%		LL	UL			LL	UL
HSV1 Result	Negative (< 0.2)	228	80.9	1.000
	Positive (> = 0.2)	54	19.1	2.667	1.586	4.484	< 0.001	2.236	1.130	4.424	0.021
Regressiv e changes	Absent	187	66.3	1.000
	Present	95	33.7	4.432	2.807	6.998	< 0.001	3.920	2.198	6.993	< 0.001
TAC				1.490	1.379	1.610	< 0.001	1.555	1.443	1.681	< 0.001

Dental analysis

The presence and absence of the regressive changes of the teeth was statistically analyzed using Chi-square test (Figs. 4 and 5). The statistical analysis revealed the presence of regressive changes in 33.7% (60 males, 35 females) (mean age: 53.724) in NHOSCC and 10.2% (29 males, 0 females) (mean age: 49.68) in HOSCC (Table 8). In order to identify the regressive changes as a risk factor for NHOSCC, binary logistic regression was done and the univariate logistic regression showed patients with regressive changes have 4.432 odds (4.432 OR, CI, 2.807-6.998) of getting NHOSCC and it was found to be statistically significant (p<0.001) and the multivariate logistic regression showed patients with regressive changes have 3.920 odds (3.920 OR, CI, 2.198-6.993) of getting NHOSCC and it was found to be statistically significant (p<0.001) (Table 10).

Fig. 4.

Shows the bar graph displaying presence of regressive changes of teeth in HOSCC and NHOSCC

Fig. 5.

Shows the lateral view of the dental stone cast of NHOSCC patient taken for analyzing the association of regressive changes of the teeth with NHOSCC

Table 8.

Comparison of regressive changes of teeth between HOSCC and NHOSCC

				Group				p-value
Factor		HOSCC		NHOSCC		Total
		N	%	N	%	N	%
Regressive changes	Absent	253	89.7	187	66.3	440	78.0	< 0.001
	Present	29	10.3	95	33.7	124	22.0
	Total	282	100.0	282	100.0	564	100.0

Biochemical analysis

Mann Whitney U test was used to compare the means of TAC values between cases and controls. The Mann Whitney u test showed statistical significance (p<0.001) on comparing the means of total TAC of the NHOSCC (178 males, 126 females) (mean age: 54.35) and HOSCC (260 males, 22 females) (mean age: 53.128) (Fig. 6) (Table 9). In order to identify the total anti-oxidant capacity as a risk factor for NHOSCC, binary logistic regression was done and the univariate logistic regression showed patients with lower total antioxidant capacity have 1.490 odds (1.490 OR, CI, 1.379-1.610) of getting NHOSCC and was found to be statistically significant (p<0.001) and the multivariate logistic regression showed patients with lower total antioxidant capacity have 1.555 odds (1.555 OR, CI, 1.443-1.681) of getting NHOSCC and was found to be statistically significant (p<0.001) (Table 10 and Fig. 6).

Fig. 6.

Shows the bar graph displaying the difference in TAC levels of HOSCC and NHOSCC based on ELISA analysis

Table 9.

Comparison of total antioxidant capacity (TAC) between HOSCC and NHOSCC

Age (Years)		Group			p-value
		HOSCC	NHOSCC	Total
TAC	N	282	282	564	< 0.001
	Mean	12.9751	6.8268	9.9010
	Std. Dev	6.1840	3.3132	5.8338
	Median	11.6546	6.5629	8.7269
	Minimum	5.2051	.7923	.7923
	Maximum	31.4274	21.8380	31.4274
	1st Quartile	9.4482	4.3565	6.4781
	3rd Quartile	14.0307	8.5996	11.9941

Discussion

In this study, the prevalence and association of HRAS mutation, oral microflora, HSV-1, regressive changes of teeth, total antioxidant status with NHOSCC were assessed.

The RAS GTPase family (HRAS, KRAS, NRAS) plays important role in various physiological functions like cell signaling, controlling the cellular differentiation, proliferation, survival​ [42]​. The RAS proteins are activated by external stimuli. RAS switches between its active form (GTP) and the inactive form (GDP) in healthy cells. But when RAS gets altered, it remains in the active form (GTP form) for a prolonged period of time preventing the cells from responding to the death signals [43]. This leads to uncontrolled proliferation of cells resulting in tumorigenesis. Mutations in the RAS members are known to be the important drivers of cancer [44]. RAS mutation accounts for about 30% of all human tumors [23]. The frequency of KRAS mutation is found to be 32% in lung cancer, 40% in colorectal cancers, 85-90% in pancreatic cancer ​ [45–47]. HRAS mutation is more frequently detected in oral cancer [48, 49].

In our study, the coding exons of the HRAS gene in the tumor samples of NHOSCC and HOSCC were examined. We detected 100 (17.7%) of HRAS mutations in OSCC among which 54 (9.57%) of HRAS mutations were seen in NHOSCC patients and 46 (8.15%) of HRAS mutations were seen in HOSCC patients. We identified 6 novel mutations in OSCC. We have identified mutations in codon 16 (C>A) in 2 cases with an amino acid change from leucine to methionine, codon 359 (T>C) in 3 cases with an amino acid change from leucine to proline, codon 382 (C>T) in 7 cases with an amino acid change from arginine to tryptophan. A novel synonymous mutation in codon 507 (G>T) in 9 cases. These mutations were identified in NHOSCC patients. Mutation in codon 96 (C>A) in 6 cases with an amino acid change from tyrosine to stop, codon 166 (C>A) in 3 cases with an amino acid change from leucine to methionine was identified in HOSCC patients. Previously reported mutations like mutation in codon 317 (C>T) in 4 cases with an amino acid change from serine to leucine, reported synonymous mutations like codon 399 (C>T) in 4 cases, codon 81 (T>C) in 10 cases, codon 408 (C>G) in 9 cases, codon 417 (C>T) in 6 cases were also reported in our study in non -HOSCC. Previously reported synonymous mutations in codon 30 (C>A) in 4 cases, Codon 67 (C>T) 8 cases, codon 81 (T>C) in 25 cases were also reported in our study in HOSCC.

Chang et al previously conducted a study analyzing the mutations of RAS, BRAF, PIK3CA, TP53 genes in Taiwanese patients with OSCC and concluded that missense mutation of HRAS gene was seen in 10/79 OSCC patients. The mutation showed GGC>AGC (G12S) in 9 cases and GGC>TGC (G12C) in 1 case [50]. Koumaki et al conducted a study on analyzing the status of HRAS and BRAF mutations in Greek population and reported one novel missense mutation (Ala53Val), one silent mutation, four mutations in intron 1, two mutations in the 5’ UTR region ​ [37]. Munirajan et al detected a point mutation in codon 59 (GCC>ACC) in oral cancer sample of Indian population [38]. Murugan et al conducted a study analyzing the status of RAS mutation in Vietnamese population with OSCC and concluded that HRAS mutation was seen in 10/56 OSCC patients. They reported two novel mutations namely the insertion mutation in between codon 10 and 11 and missense mutation in codon 62 (GAG>GGG) [39]. Saranath et al conducted a mutational analysis in Indian population which concluded 20/57 samples showed HRAS mutation. It involved codons 12,13,61. Majority of the mutations were in 61.2 (Glutamine to Arginine) and 12.2 (Glycine to Valine) ​ [40]. Uchibori et al conducted a study in the Japanese population to analyze HRAS mutation in OSCC patients and reported a mutation in codon 13 (c.38G>T) of exon 2 with an amino acid change from glycine to valine (p.Gly13Val) [41]. Zanarudin et al detected one point mutation in the Caucasoid population and in the Asian population 3 (2.4%) exhibited mutations G12S, G12D [51].

The oral microflora includes diverse range of bacterial, viral and fungal species. Though the resident oral microflora performs a physiological non-pathoangenic commensal community contributing to the host defense system, the role of oral microflora in oral carcinogenesis is still a debate [52]​. Studies suggest that there is no direct causative role of oral microflora in the pathogenesis of oral cancer. But it may serve as a synergistic factor with other factors like alcohol and tobacco [53]. HSV-1 is considered to be a co-carcinogen in OSCC which potentiates the tumorigenic effect of other carcinogens ​​. Host cell shut off and induction of cellular proteins like heat shock proteins are considered as the possible mechanisms of HSV-1 induced OSCC ​ [54].

In our study, we found out that there is no significant difference in the total bacterial count between the NHOSCC patients and HOSCC patients. And we also found that the HSV1 comparison between the NHOSCC patients and HOSCC patients showed statistical significance (p=0.004).and patients with HSV1 infection have 2.667 odds ( 2.667 OR, CI, 1.589-4.484) of getting OSCC and it was found to be statistically significant (p<0.001).

Jain reported that there is a statistical significant difference between HSV-1 IgG level among the control group and cancer/precancer group. However there was a statistically insignificant difference between the HSV-1 IgG level among the cancer and pre-cancer group ​ [55]. Kassim et al. conducted a study to search for HSV-1 proteins in tissue sections of OSCC patients and concluded that the presence of HSV-1 genome in high proportion of the lesions suggest strong statistical support to the pathogenic relation between HSV-1 and OSCC [56]. But Mokhtari et al. studied the presence of HSV-1 in OSCC Iranian patients and concluded that, HSV-1 may not play an important role in OSCC ​ [57]. Similarly, Delavarian et al. investigated the presence of viruses in OSCC and concluded that viruses have no important role in OSCC ​ [58].

The regressive changes of teeth is physiological wearing away of the tooth substance. The regressive morphological changes are attrition, abrasion and erosion. These changes will lead to the alteration in the morphology of tooth structure resulting in sharp tooth [59]. These morphological changes occur in occlusal, labial, lingual, mesial, distal aspect of the tooth ​ [60]. Prolonged presence of sharp tooth will lead to chronic mechanical irritation (CMI). This CMI causes chronic inflammation and inflammation is considered as the 7th hallmark of cancer since 2009 ​ [61]​. It produces several alterations in the oral mucosa. Another mechanism that is considered to be the pathogenic pathway of CMI in oral cancer is the increased activity of Poly ADP Ribose Polymerase (PARP) which leads to DNA damage and carcinogenesis [62]. There are many reviews concluding that there is a strong association of CMI and OSCC ​ [31, 63, 64]. Whereas studies answering the association of CMI with OSCC remains perplexing.

In our study, we found out that 33.7% of the NHOSCC patients had regressive changes of teeth and 10.2% of HOSCC patients had regressive changes of teeth and the difference was statistically significant (p<0.001). Also on analyzing the regressive changes of tooth as a risk factor for NHOSCC, it was concluded that patients with regressive changes of teeth have 4.432 odds (4.432 OR, CI, 2.807-6.998) of getting OSCC and it was found to be statistically significant (p<0.001).

Yoitha prabhunath et al observed that CMI caused due to the cusp of carabelli (CoC) on the lateral border of tongue showed incidence of micronuclei on the CoC associated lateral border of tongue. This study explains about the genetic damage in healthy induviduals due to CMI in the lateral border of tongue​ [65]. Piemonte et al concluded that the CMI reproducibility displayed a correlation coefficient of 1 (p<0.0001) and CMI could be considered as a risk factor of oral cancer [66].

Oxidative stress is caused due to the imbalance in the reactive oxygen species (free radicals) and the antioxidant capacity in the cells ​ [67]. Free radicals are normally produced as byproducts of oxygen metabolism and they also play vital roles in physiological functions like cell signaling. Free radicals at lower concentrations play important role in invading the pathogens. The phagocytes synthesize and store free radicals and release them when invading the microbes and it also plays an important role in inducing the mitogenic response [68]. Whereas, during pathological conditions, the level of free radicals increases rapidly that eventually leads to oxidative stress. This affects the cellular structures like membranes, lipids, proteins, deoxyribonucleic acid (DNA) and lipoproteins [69]. Carcinogenesis involves both cellular and molecular alterations. The most common byproducts of DNA oxidation are hydrolyzed DNA bases that initiates chemical carcinogenesis. It is also known to affect the structure of the DNA like strand breaks, DNA protein cross links, base and sugar lesions [70].

Antioxidants are the first line of defense against the free radicals. In our study, we observed that the NHOSCC samples had less total antioxidant capacity when compared to the HOSCC samples. On analyzing total antioxidant status as a risk factor for NHOSCC, our study showed that patients with lower total antioxidant capacity have 1.490 odds (1.490 OR, CI, 1.379-1.610) of getting OSCC and was found to be statistically significant (p<0.001).

There is a decrease in the total antioxidant capacity in cancer. This observation has been in agreement with the observations of Nigar et al, who noted reduction in the total antioxidant levels in patients with cervical cancer when compared to normal controls ​ [71]​. Bhat et al observed decreased total antioxidant capacity in OSCC patients when compared to the healthy individuals. But it was not found to be statistically significant and they have explained the statistically insignificant result may be due to the limited sample size of the study [72]. Khalaf et al concluded that reduced levels of ceruloplasmin and glutathione were seen in breast cancer patients when compared to the controls ​ [73]. Xiang et al observed decreased level of total antioxidant status in lung cancer patients when compared to the controls but it was not statistically significant ​ [74]. Wu et al concluded that the total antioxidant status of the colorectal cancer patients was decreased significantly than the controls [33].

However, Patel et al. concluded from their case control study that the level of total antioxidant status of oral cancer patients were higher when compared to the control group. They also explained that the increase in the antioxidant status of the oral cancer patients might be due to the supplementation with multivitamins by the patients as a part of their treatment ​ [75]​. Similarly, Madhulatha et al. observed a significant increase in the antioxidants like ceruloplasmin, malondialdehyde, glutathione in the oral cancer patients when compared to the controls ​ [76]. Gokul et al. observed a significant increase in malondialdehyde (MDA), Nitric oxide (NO) in OSCC patients when compared to that of controls. But the enzymes superoxide dismutase (SOD) and catalase were significantly reduced in OSCC patients than the control group ​ [77]. Bagul et al. concluded that increased levels of superoxide dismutase and glutathione peroxidase were observed in OSCC patients when compared to controls and this may be because of the immune response to the oxidative stress ​ [78].

In our study, the sequencing results of HRAS gene revealed 3 novel pathogenic mutations in NHOSCC (c.16C > A/p.L6M (missense mutation), c.359 T > C/p.L120P (point mutation), c.382C > T/p.R128W (missense mutation)). The microbial analysis revealed that there is no significant difference in the total bacterial count between NHOSCC and HOSCC. Whereas the HSV-1 ELISA analysis revealed that there is a significant association between HSV-1 and NHOSCC. The dental analysis revealed the regressive changes of teeth has a significant association with NHOSCC. The TAC ELISA analysis revealed significant association with NHOSCC.

Limitations

Our study did not include healthy individuals. This can be used as a key for the future research for the inclusion of apparently healthy individuals in their research work to get precised results. The ratio of male and female was unmatched in our study which could be considered as an important point in future research to include matched male and female ratio and get more precise estimates. In the near future, functional studies could be performed to confirm the pathogenic association of HRAS mutation and NHOSCC.

Conclusion

In conclusion, the frequency of HRAS mutation in NHOSCC is high and it can be a prognostic marker. However, functional studies should be performed to confirm the pathogenic association in the near future. HSV-1, regressive changes of tooth and total antioxidant capacity have strong association with NHOSCC. Our study is first of its kind in analyzing the HRAS mutation, association of total microbial count, HSV-1, regressive changes of teeth and total antioxidant capacity in NHOSCC. The findings highlighted the involvement of the risk factors in NHOSCC and have extended a hidden site to explore. Future studies should be conducted to unleash the hidden paradox of NHOSCC and sketch out targeted treatment plan for improving the quality of life of the affected patients.

Abbreviations

OSCC

Oral Squamous Cell Carcinoma

NHOSCC

Non-Habit associated Oral Squamous Cell Carcinoma

HOSCC

Habit associated Oral Squamous Cell Carcinoma

GLOBOCAN

Global Cancer Observatory

HRAS

Harvey Rat Sarcoma Virus

NRAS

Neuroblastoma ras viral oncogene

KRAS

Kristen rat sarcoma virus

HSV-1

Herpes Simplex Virus-1

TAC

Total Antioxidant Capacity

ADH3

Alcohol Dehydrogenase 3

DNA

Deoxyribo Nucleic Acid

AGE

Agarose Gel Electrophoresis

NCBI

National Centre for Biotechnology Information

PCR

Polymerase Chain Reaction

PBS

Phosphate buffer Saline

OD

Optical Density

A

Adenine

G

Guanine

C

Cytosine

T

Thymidine

L

Leucine

M

Methionine

P

Proline

R

Arginine

W

Tryptophan

S

Serine

I

Isoleucine

Y

Tyrosine

X

Stop

H

Histidine

Gly

Glycine

Authors’ contributions

MM: Conceptualization, software, formal analysis, investigation, data curation, writing-original draft preparation, visualization, project administration, funding acquisition. PR: Conceptualization, validation, formal analysis, investigation, writing—review and editing, supervision, project administration, funding acquisition. PA: Methodology, software, data curation, writing—original draft preparation. PR: Validation, investigation, resources, supervision. BK: Software, formal analysis, validation, supervision. VP: Validation, investigation, resources, supervision. SJ: Methodology, investigation, writing—review and editing. BK: Methodology, software, data curation, visualization. AP: Methodology, software, data curation, visualization.

Funding

This research was funded by Indian Council of Medical Research Nurturing Clinical Scientist Scheme (ICMR-NCS) (HRD/Head-NCS-2019–02).

Data availability

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The institutional ethical committee approval was obtained from Saveetha Dental College and hospitals, Chennai, Tamil Nadu (IHEC Ref. No: IHEC/SDC/OPATH-1601/21/189) and Malabar Cancer Centre, Thalassery, Kerala (No: 1617/IRB-IEC/13/MCC/16–5-2023/3, CDSCO Reg. No: ECR/780/Inst./KL/2015/RR-21). All the procedures involving the human participants were in accordance with the ethical standards of the institution. Informed consent in regional language (Tamil or Malayalam) or English was received from all the patients included in the study. After receiving the informed consent from the patients, the samples were collected.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.