ABSTRACT
Background
Existing studies have shown that transferrin receptor (TfR) is highly expressed on the surface of lung cancer cells, and nanoparticles (NPs) have been widely used as delivery vehicles. The aim of this study was to investigate the effect of the targeted delivery of Fe3O4 NPs modified with transferrin (Tf) compared with photothermal treatment for lung cancer.
Methods
The morphology and properties of Fe3O4 NPs modified with Tf were tested by internal morphological characterization experiments including transmission electron microscopy, particle size meter infrared spectrometer and other experiments. The delivery of materials was investigated by cell proliferation and apoptosis experiments, and western blot experiment was used to detect yes‐associated protein 1(YAP1) protein expression changes after delivering miR‐15a‐5p. In addition, animal models were constructed to further explore the targeting properties of the material.
Results
The results demonstrated that the nanomaterial has good stability and targeting properties. Meanwhile, we also discovered that the miR‐15a‐5p carried by NPs can inhibit cell growth after its entry to the lung cancer cells. The effect became more evident when the nanomaterials were assisted with laser therapy, as verified by in vivo and in vitro experiments. In terms of the related mechanism, miR‐15a‐5p inhibited YAP1 expression, which affected cell proliferation and apoptosis.
Conclusion
In this study, Fe3O4 NPs modified with Tf delivered miR‐15a‐5p in combination with photothermal therapy for lung cancer. In future research, the targeted delivery of Tf and the photothermal synergy of nanomaterials will provide a theoretical basis for cancer treatment.
Keywords: Fe3O4 nanoparticles, lung cancer, photothermal therapy, targeted delivery, transferrin
The FPPT nanoparticles (NPs) were synthesized by using the solvent heat method. After in vitro and in vivo experimental validation, FPPT NPs showed good photothermal properties and targeting lung tumors. Furthermore, the nanomaterials successfully loaded miR‐15a‐5p into the lung cancer cells, which inhibited cell proliferation and promoted cell apoptosis. This study effectively developed the characteristics of FPPT NPs itself, including photothermal properties and targeted performance, and also used gene therapy to jointly deal with the development of lung cancer, providing a certain theoretical basis for lung cancer.

1. Introduction
Lung cancer is the leading cause of cancer‐related death worldwide, following female breast cancer [1, 2]. Non‐small‐cell lung cancer (NSCLC) accounts for approximately 85% of lung cancer; this disease is associated with a low 5‐year overall survival and can be further divided into adenocarcinoma, squamous cell carcinoma, and large cell carcinoma [3, 4]. Selective targeting of cancer cells poses a major challenge in cancer therapy [5]. Meanwhile, targeted therapy [6, 7] is used to treat cancers with specific vulnerabilities; however, only a few tumor types are currently targeted for this type of treatment.
Nanoparticles (NPs) and microparticles are revolutionizing technologies, from inorganic compounds to bioderived polymers; NPs have greatly promoted the development of biomedical‐related materials due to their unique small‐size, quantum, surface, and interface effects [8, 9, 10]. Photothermal therapy (PTT) is an approach that utilizes a photothermal agent (PTA) to generate sufficient heat when exposed to near‐infrared light, with the aim of eradicating tumor cells and triggering anti‐tumor immune responses. The tumor microenvironment (TME) has complex physiological and pathological immune barriers and limited laser penetration depth, which limits the effectiveness of PTT for treating solid tumors. These challenges prevented PTT from effectively reversing the immunosuppressive microenvironment and controlling the growth of residual tumor cells. Therefore, seeking a combination treatment would be more helpful in coping with cancer [11, 12]. Cisplatin‐loaded gold nanoshells and Bi@Au nano‐acanthospheres mediate chemotherapy–PTT for lung cancer [13, 14]. Nano‐based drug delivery systems exhibit effective targeting, delayed release, and high bioavailability with less toxicity; nanodrugs are expected to improve prognosis through the passive targeting of solid tumors [15, 16]. Nanomaterials are widely applied, and therefore, we constructed a composite nanomaterial for lung cancer research.
Ferric oxide (Fe3O4) is the only metal oxide approved by the Food and Drug Administration for use in the biomedical field. Fe3O4 NPs as drug carriers can improve the efficiency of drug treatment and reduce its side effects. On the one hand, Fe3O4 NPs, which are widely applied in water treatment, have a high surface area, small size, and superparamagnetic properties, are environmentally friendly, and require a simple preparation process. Moreover, they are used in the development of magnetic resonance imaging (MRI) contrast agents and antimicrobial and anticancer drug delivery agents with a good biosafety profile. Therefore, Fe3O4 NPs have a high potential for integration in tumor diagnosis and treatment, especially for lung cancer [17, 18, 19, 20, 21]. We selected Fe3O4 NPs to study the occurrence and development of lung cancer. According to literature, Fe3O4 NPs are mainly synthesized via co‐precipitation and solvothermal methods [22, 23]. Ag NPs fabricated using chitosan–agarose composite functionalized core–shell‐type Fe3O4 NP (Ag/CS‐Agar@Fe3O4) can be used to treat lung and liver cancers [24]. In addition, SiO2‐coated magnetic nano‐Fe3O4 photosensitizers are used for synergistic tumor‐targeted chemotherapy–PTT [25]. Poly(ethylenimine) (PEI) is a highly efficient nonviral gene vector. This compound has a molecular weight of 25 kDa and has been considered a “golden standard”; it prevents gene degradation by neutralization; meanwhile, poly (ethylene glycol) (PEG), a hydrophilic polymer often used to coat magnetic NPs, has many desirable properties [26, 27]. The advantages of these components enabled their application in the synthesis of Fe3O4 NPs. The transferrin receptor (TfR) [28], which is abundantly expressed on the surface of cancer cells, is relatively stable and often used as a potential target for tumor therapy; transferrin (Tf) is a cancer cell‐targeting moiety based on the high expression of TfR in tumor cells [29]. It enables the specific delivery of Tf‐modified NPs to tumor cells. Tf‐modified NPs can be used to treat glioma and lung cancer [30, 31]. These findings provide a novel idea for our research.
MicroRNAs (miRNAs) are small non‐coding RNAs that actively participate in the pathogenesis of numerous diseases [32, 33]. NP carriers offer opportunities for the cell‐specific controlled delivery of miRNAs for therapeutic purposes [34]. Nanomaterials still play an important role in gene delivery therapy. Therefore, the combination treatment modality of miR‐15a‐5p and NPs carrying photothermal therapeutic effects were used to study the effects of lung cancer.
2. Materials and Methods
2.1. Synthesis of Materials
2.1.1. Synthesis of Fe3O4
A total of 0.6 g iron chloride hexahydrate (Aladdin, China) and 0.2 g sodium citrate (Aladdin, China) were weighed on an electronic balance (HZ&HUAZHI, USA), dissolved in 20 mL ethylene glycol (Aladdin, China), and reacted for 1 h at 27°C using a magnetic stirrer (IKA, China). Then, 1.2 g sodium acetate (Aladdin, China) and 0.75 mL ultrapure water were added to the above mixture. The temperature was kept constant, and the reaction was continued for 1 h (the solution was wine red at this point). The mixed solution was poured into a hydrothermal kettle, reacted in an oven at 200°C for 10 h, transferred to a 50 mL Eppendorf tube after cooling to room temperature, and centrifuged at 8000 rpm for 15 min. Then, 20 mL, 0.8 mol/L sodium hydroxide (Aladdin, China) solution was added dropwise to a part of the product, and the mixture was stirred for 4.5 h. The resulting product was washed thrice with ethanol absolute (YongDa Chemical Reagent, China) and ultrapure water. The speed and centrifugation time were kept constant. A small amount of sample was placed in a Zetasizer (Malvern, UK) to detect the particle size and potential. The sample of Fe3O4 particles was added to the copper grid, and the morphology of NPs was observed through transmission electron microscopy (TEM; FEI Tecnai G2, USA).
2.1.2. Synthesis of PEI‐PEG
PEI (Sigma, China) was dissolved in 10 mL dimethyl sulfoxide (DMSO; Solarbio, China), added with bifunctional NHS‐PEG‐MAL (Biofount, China), poured onto 20 mL triethanolamine (Biofountt, China), and reacted at room temperature for 48 h. The product was purified through dialysis.
2.1.3. Synthesis of Fe3O4–PEI‐PEG–Tf (FPPT)
The mixture of Fe3O4, PEI‐PEG, and Tf (Sigma, China) was stirred at room temperature for 24 h, and the particle size and potential were measured using a Zetasizer.
2.1.4. Infrared Spectrum Analysis
Fe3O4, PEI, Fe3O4–PEI‐PEG (FPP), and FPPT were centrifuged and dried to prepare their corresponding powders, and infrared measurement was carried out through potassium bromide tablet method using an infrared spectrometer (NICOLET iS10, Thermal Science, Shanghai, China).
2.1.5. Tf Connection Verification
For gel‐staining experiments, the Tf sample was used as a control and stained with Coomassie Brilliant Blue R‐250 (Biotopped, China). The bands were observed after decolorization using a versatile imaging system (Thermo Fisher Scientific, USA).
2.2. Cell Culture
Human lung cancer cell lines A549 and NCI‐H520 were purchased from Shanghai Institute of Cell Biology, China. The cells were cultured in Roswell Park Memorial Institute 1640 medium (Gibco, Life Technologies, China) supplemented with 10% fetal bovine serum (Gibco, Life Technologies, China) in a humidified incubator at 37°C with 5% CO2.
2.3. Cell Transfection
FPPT and miRNA were gently mixed for 20–30 min at room temperature to form FPPT‐NC or FPPT‐miR‐15a‐5p. The sequences were as follows:
NC, 5′‐GTTCTCCGAACGTGTCACGT(T)‐3′;
miR‐15a‐5p, 5′‐TAGCAGCACATAATGGTTTGTG‐3′.
FPPT was transfected with green fluorescent protein (GFP) and observed through a fluorescence microscope, or FPPT was transfected with fluorescent miRNA and detected using a BD Accuri C6 Plus Flow Cytometer (BD Biosciences).
2.4. Agarose‐Electrophoresis Tentative Delay
FPPT and pc3.1‐luci plasmid were mixed at different weight ratios, incubated in sterile water at room temperature for 30 min, and subjected to agarose electrophoresis. An ultraviolet spectrophotometer was used to analyze the electrophoresis results (Tanon 2500, Shanghai, China).
2.5. Luciferase Activity Analysis
The pc3.1‐luci plasmid was transfected with FPPT. Cells were seeded into 24‐well plates at a density of approximately 1 × 104 cells. Subsequently, 20 μL FPPT/pc3.1‐luci mixtures with different weight ratios were added. After 48 h, a chemiluminescence detector was used for detection luciferase activity (TECAN Infinity 200 Pro, Switzerland).
2.6. In Vitro Cytotoxicity and Proliferation Assay
The biocompatibility and anticancer effect of FPPT were evaluated through 3‐(4,5‐dimethythiazol‐2‐yl)‐2,5‐diphenyl tetrazolium bromide (MTT) assay. Normal human renal epithelial cells (293T) were treated with different concentrations (4, 6, 8, 12, and 16 μg/mL) of FPPT in a 96‐well plate for 24 h. MTT was added, and culturing was continued for 4 h. A total of 150 μL DMSO was added, and the absorbance was measured at 491 nm on a microplate reader (Multiskan FC; Thermo Fisher Scientific, Inc. USA).
The colony formation experiment was conducted as follows: A total of 1.0–1.5 × 103 cells (A549, NCI‐H520) were inoculated into a 10 cm Petri dish, cultured at 37°C, 5% CO2 for about 7–14 days, fixed with 4% formaldehyde (Biosharp, China), and stained with crystal violet (Solarbio, China). Images were captured using a camera (Nikon, Japan).
2.7. Cell Apoptosis Assay
Apoptosis detection was performed at 48 h after transfection using Annexin V‐fluorescein isothiocyanate/propidium according to the manufacturer's protocol (Annexin V; BD, USA).
2.8. Dual Luciferase Reporter Gene Assay
Based on the online miRNA target gene database (http://www.targetscan.org/), the target gene of miR‐15a‐5p was selected. The 293 T cells were co‐transfected with miR‐15a‐5p and yes‐associated protein 1 (YAP1) wild‐type (WI) and mutant (MU) plasmid vectors using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific Inc. USA). The absorbance values of firefly luciferase and Renilla luciferase were detected in the dark using a chemiluminescence detector. The absorbance of firefly luciferase in each well was compared with that of Renilla luciferase.
2.9. Western Blot Analysis
The total protein was extracted from transfected cells using radioimmunoprecipitation assay lysis buffer (Beyotime, China). The blots were incubated with primary antibodies at 4°C. The following antibody diluents were used: anti‐YAP1 (1:6000; cat. no. 13584‐1‐AP; ProteinTech, USA), anti‐TfR (1:1000; cat. no. AF5343; Affinity Biosciences, USA), and anti‐glyceraldehyde‐3‐phosphate dehydrogenase (1:6000; cat. no. BS65483M; Bioworld Technology Inc. USA). Following incubation for 2 h with goat anti‐rabbit IgG H&L horseradish peroxidase conjugate secondary antibody (1:6000; cat. no. BS13278; Bioworld Technology, Inc. USA), the protein bands were visualized using BeyoECL Plus (Beyotime Institute of Biotechnology, China).
2.10. In Vivo Experiments
2.10.1. Mouse Subcutaneous Tumor
A total of 20 female nude mice (weighing 18 g) were purchased from Pengyue Company in Jinan, Shandong Province (BALB/c‐nu; age, 5 weeks) and they were kept in a laminar airflow cabinet under specific pathogen‐free conditions with a controlled temperature (23 ± 2°C), 12/12‐h light/dark cycle and humidity (40%–70%) with free access to food and water. The mice used in the subsequent experiments enjoyed the same living conditions. A total of ~5 × 106 A549 cells were resuspended into 100 μL PBS. The FPPT‐NC and FPPT‐miR‐15a‐5p‐treated cells were injected subcutaneously on the left and right sides of the upper back of mice for tumor development. The tumors were measured using a Vernier caliper every 7 days, for a total of three times. The other two groups also included FPPT‐NC and FPPT‐miR‐15a‐5p, but only one tumor was implanted subcutaneously to the mice. In addition, the tumor volume was measured every 7 days. After two measurements, FPPT was injected into the tumor and irradiated using a 1.5 W/cm2 laser (808 nm) for 3 min. Tumor volumes were measured again after 7 days. After 21 days, 20 mice were euthanized by injection of sodium pentobarbital (150–200 mg/kg). All mice were euthanized, and mouse dorsal xenografts were removed, photographed, and weighed. The tumor volume is calculated as volume = (tumor width)2 × (tumor length)/2.
2.10.2. Construction of Mouse Lung Metastasis Model
A total of 1 × 107 A549 cells stably expressing GFP were harvested and injected into the nude mice (BALB/c‐nu; age, 6 weeks; weight, 20 g) through tail vein injection. The feeding conditions are as described in Part Mouse subcutaneous tumor. Nude mice were divided into experimental groups (n = 3/group) with different treatments (FPPT‐GFP−, FPP‐GFP+, and FPPT‐GFP+). Finally, the most successful mouse model was used for subsequent experiments.
2.10.3. Immunohistochemistry
One month later, three mice were anesthetized by injection of pentobarbital sodium (0.1%), followed by perfusion fixation and removal of lung tissues using surgical instruments. And the lung tissues were fixed in 4% formaldehyde solution prepares paraffin sections. Subsequently, lung tissues were routinely processed using paraffin and sectioned at a thickness of 5 μm for immunohistochemical experiments.
2.10.4. NP Targeting
FPPT was injected into the lung metastasis mouse model via the tail vein. The specific groups comprised those treated with PBS, FPP‐Cy7, and FPPT‐Cy7 (5 mg/kg). The distributions of FPP and FPPT were observed using Small Animal Microscopic Scanning Stereo Imager (PE IVIS Spectrum CTI, USA).
2.10.5. Biodistribution
The mice (BALB/c‐nu; age, 6 weeks weight, 20 g; n = 3) were injected with PBS and FPPT via the tail vein. The feeding conditions are as described in Part Mouse subcutaneous tumor. Then, 1 week later, major organs of the mice, including the heart, kidney, liver, lung, and spleen, were removed and fixed in 4% formaldehyde solution. Subsequently, these tumors and organs were routinely processed using paraffin, sectioned at a thickness of 5 μm, stained with hematoxylin and eosin (HE), and examined using an upright biological microscope (Leica).
All animal experiments were approved by the Animal Experiment Ethics Committee of Binzhou Medical University (approval number: 2022–564) and we have adhered to the ARRIVE guidelines (https://arriveguidelines.org/).
2.11. Statistical Analysis
The results are expressed as mean ± standard deviation. t test was conducted for the comparison between two groups, and the analysis of variance was implemented for the comparison of multiple groups. p value < 0.05 was considered statistically significant. All data were analyzed using Graphpad 8.0.
3. Results
3.1. Synthesis and Characterization of Fe3O4 Nanomaterials
We first synthesized spherical and etched Fe3O4 NPs, which were modified with PEI, and detected their particle size and potential. The NPs had sizes of 374.9 and 274.2 nm (Figure 1A) potentials of 33.5 and 34.5 mV (Figure 1B). Compared with the etched NPs, the amounts of spherical NPs required to achieve the optimal transfection effect was smaller than that of the latter during the test on the optimal transfection ratio of A549 and H520 cells (Figure 1C–F). The spherical NPs also exhibited a better GFP transfection effect (Figure 1G,H). Thus, after comprehensive consideration, we selected the spherical NPs for the subsequent experiments.
FIGURE 1.

Characterization of two different Fe3O4 nanomaterials. (A, B) Particle size and zeta potential diagram of Fe3O4 and etched Fe3O4. (C–F) Luciferase reporter gene assays of pc3.1‐luci plasmid mixed with FP and etched FP at different weight ratios of A549 and H520 cells. (G, H) Transfection of GFP by two types of NPs in A549 and H520 cells. FP, Fe3O4–PEI; etched‐FP, and etched Fe3O4–PEI.
3.2. Synthesis and Characterization of FPPT NPs
FPPT NPs were synthesized as shown in Figure 2A. Western blot was used to detect the expression of TfR on the cell membranes of BEAS‐2B, A549, and H520 cells to indirectly comprehend the expression of Tf, and the results showed the high expression of TfR on the cell membrane of cancer cells, which provided a basis for the subsequent experiments (Figure 2B). We first synthesized Fe3O4 NPs and then linked them with PEI‐PEG and Tf. The NPs were synthesized and loaded with miR‐15a‐5p into lung cancer tumor cells. The morphology of the nanomaterials was photographed through TEM (Figure 2C). In addition, we simultaneously performed SEM shooting and mapping element analysis (Figure S1A–D). Coomassie Brilliant Blue staining experiments revealed that compared with the Tf samples, FPPT was successfully connected to Tf (Figure 2D). A particle size analyzer was used to detect the particle size and potential of Fe3O4 and FPPT, and the results were (147.4 nm, −21.7 mV) and (226.0 nm, 22.3 mV), respectively (Figure 2E,F). The characteristic peaks of the DMPO‐•OH adduct appeared in the paramagnetic resonance spectra, indicating the presence of •OH in FPPT NPs (Figure 2G). Through the H2O2‐TMB colorimetric reaction, it showed that the catalytic activity of FPPT NPs was gradually increased with the increasing concentration (Figure 2H). Next, the changes in the heating curves of different concentrations of materials under laser irradiation were examined. The temperature of FPPT gradually increased with time and reached the maximum after 6 min. The thermal stability curve showed the good thermal stability of FPPT (Figure 2I–K). The band at 568 cm−1 indicated the characteristic absorption of Fe–O bonds. The grafting of PEI to Fe3O4 was confirmed by the strong N–H (1560 cm−1, ∼3450 cm−1) and C–H (2924 cm−1) bonds. Successful PEGylation was proven by the Fourier transform infrared spectroscopy spectra of FPP and FPPT, in which C–H (1108 and ∼2880 cm−1) vibration peaks were observed. In addition, graft copolymers exhibited a strong, broad absorption at around 3445 cm−1 (N–H) (Figure 2L). In summary, the NPs have good properties and can be used in subsequent research.
FIGURE 2.

Synthesis and characterization of FPPT NPs. (A, B) Expression of TfR in BEAS‐2B, A549, and H520 cells. (C) TEM images of Fe3O4. Scale bars = 100 nm. (D) Electropherogram of FPPT successfully connected to Tf. (E, F) Particle size and zeta potential diagram of FPPT, respectively. (G) ESR analysis of OH generated by FPPT using DMPO as a trap. (H) UV–visible spectra of TMB treated with different concentrations of FPPT NPs. (I–K) Heating curve of FPPT at different concentrations and its thermostability curve. (L) IR spectra of Fe3O4, PEI, FPP, and FPPT. **p < 0.01 and ****p < 0.0001. TEM, transmission electron microscopy; Tf, transferrin; FPPT, Fe3O4–PEI–PEG–Tf; FPP, Fe3O4–PEI–PEG; TfR, transferrin receptor.
3.3. Targeting of Lung cancer Cells by FPPT and Its Biocompatibility Analysis
The lung metastasis model was established through the injection GFP‐expressing A549 cells into the mouse tail vein. The lung tissues of mice were removed, and immunohistochemical experiments were performed. In addition, the specific marker molecule of lung adenocarcinoma (CK7) was selected as the detection index. The results showed that the mice injected with A549 cells expressed CK7 in their lung tissues, and those without A549 cell injection showed no CK7 expression (Figures 3A and S2A). Then, the Cy7‐labeled material was injected. The capture of fluorescence in the lungs of the FPPT group was indicated by Small Animal Microscopic Scanning Stereo Imager. The results revealed that FPPT can target the lungs (Figures 3B and S2B). During perfusion of the fixed mice, the mouse heart, liver, spleen, lung, and kidney were removed and photographed again, and clearer results were obtained (Figure 3C).
FIGURE 3.

FPPT targeting lung cancer cells and biocompatibility analysis of FPPT. (A) CK7 expression in lung tissues of FPPT/GFP–, FPP/GFP+, and FPPT/GFP+ treatment groups. (B) Small‐animal imaging observations of targeting at 24 h after tail vein injection. (C) Small‐animal imaging observations of targeted organs in isolated organs after 24 h. (D) Toxic effects observed on mouse organs following intraperitoneal injection with PBS or FPPT. FPP, Fe3O4–PEI–PEG; FPPT, Fe3O4–PEI–PEG–Tf.
To detect the toxicity of FPPT in vivo, we dissected the organs of mice intraperitoneally injected with FPPT and performed HE staining. The results indicated that the injected material caused no substantial organ damage compared with the PBS‐injected group (Figure 3D). Therefore, FPPT has the function of lung targeting, and its toxicity is inevident and can be degraded.
3.4. Best Transfection Efficiency and Laser‐Promoted Transfection
A549 cells with different concentrations of FPPT were transfected to detect the cytotoxicity of FPPT. No remarkable toxicity toward the cells was observed with the increase in the amounts of nanomaterials (Figure 4A). We performed agarose delay experiments to verify the capability of FPPT to carry pc3.1‐luci plasmid. The experimental results showed that at the weight ratio of 6:1, almost all the plasmids can be carried, and all can be carried at higher concentrations (Figure 4B). We used luciferase as a reporter gene in A549 cells to verify the conditions for obtaining the highest transfection efficiency. The transfection efficiency was the highest at the weight ratio of 6:1 (Figure 4C). In addition, we transfected small RNA with fluorescence (Fam) using FPPT and performed laser irradiation. Then, flow cytometry was used for fluorescence detection. The laser‐irradiation group exhibited the strongest fluorescence (Figure 4D). Thus, FPPT can achieve the optimal transfection efficiency under laser assistance.
FIGURE 4.

Best transfection efficiency and laser‐promoted transfection. (A) Cytotoxicity of FPPT at different concentrations. (B) Electrophoretic‐mobility delay analysis and (C) luciferase reporter gene assays of pc3.1‐luci plasmid mix with FPPT at different weight ratios. (D) Release of Fam‐labeled miRNA carried by FPPT in A549 cells. FPPT, Fe3O4–PEI–PEG–Tf.
3.5. FPPT‐miR‐15a‐5p Repressed the Progression of Lung Cancer Cells In Vitro
We first detected the expression of miR‐15a‐5p in normal BEAS‐2B cells and A549 and H520 lung cancer cells. Reverse transcription quantitative polymerase chain reaction results showed the very low expression level of miR‐15a‐5p in A549 and H520 cells compared with that in BEAS‐2B cells (Figure 5A). We conducted MTT experiments to verify the effect of miR‐15a‐5p carried by FPPT on cell growth. The results showed that the miR‐15a‐5p carried by FPPT can inhibit cell proliferation, which became more considerably inhibited after the combination of FPPT with laser in A549 and H520 cells (Figure 5B,C). In addition, we inoculated the cells transfected with FPPT–miR‐15a‐5p and control cells into two large culture dishes. The cells were stained, photographed, and counted, and the results were consistent with those of the MTT assay (Figure 5D,E). Cell apoptosis experiments showed that the FPPT–miR‐15a‐5p group promoted the apoptosis of A549 cells, the cell numbers in the FPPT–miR‐15a‐5p + laser group further increased during apoptosis, and the same result was obtained for H520 cells (Figure 5F,G).
FIGURE 5.

FPPT‐miR‐15a‐5p repressing lung cancer cell proliferation and apoptosis in vitro. (A) miR‐15a‐5p expression in BEAS‐2B, A549, and H520 cells. (B, C) MTT assay showing that FPPT‐miR‐15a‐5p overexpression combined with laser inhibited the proliferation of A549 and H520 cells. (D, E) Plate colony formation test showing the considerably reduced number of cell clones after the overexpression of FPPT‐miR‐15a‐5p combined with laser in A549 and H520 cells. (F) Cell apoptosis of FPPT‐miR‐15a‐5p overexpression combined with laser. *p < 0.05, **p < 0.01, and ***p < 0.001. FPPT, Fe3O4–PEI–PEG–Tf.
3.6. miR‐15a‐5p Targeted YAP1 and Affected Proliferation by Down‐Regulating the Expression of YAP1
The 3′‐untranslated region (UTR) of YAP1 was targeted via miR‐15a‐5p using the Targetscan website to predict the target gene of miR‐15a‐5p, which may be the mechanism by which miR‐15a‐5p inhibits the progression of cancer cells. Figure 6A shows the mutation site. The wild‐type and mutant YAP1‐3′‐UTR were co‐transfected with the FPPT‐NC and FPPT‐miR‐15a‐5p groups, and the results of dual luciferase reporter gene assay confirmed that FPPT‐miR‐15a‐5p targeted the 3′‐UTR of YAP1 (Figure 6B). We extracted proteins from A549 and H520 cells for Western blot experiments and observed that miR‐15a‐5p can reduce the expression of YAP1 protein (Figure 6C). In addition, when A549 cells were co‐transfected with miR‐15a‐5p and YAP1, the expression of YAP1 was re‐increased, as verified by Western blot (Figure 6D). And western blot experiments were performed on H520 cells to obtain consistent findings (Figure 6E,F). MTT experiments indicated that the capability of miR‐15a‐5p to suppress cell proliferation was inhibited after the replenishment of YAP1on A549 and H520 cells (Figure 6G,H). We also conducted colony formation experiments after YAP1 replenishment in A549 and H520 cells, and the results showed their accelerated proliferation ability after YAP1 replenishment (Figure 6I,J).
FIGURE 6.

miR‐15a‐5p targeted YAP1 and affected proliferation by down‐regulating YAP1expression. (A) Sequence fragments of YAP1‐3′‐UTR‐WI and YAP1‐3′‐UTR‐MU. Positions 162–168 of the YAP1‐3′‐UTR have a binding site for miR‐15a‐5p. (B) Association between miR‐15a‐5p and YAP1 validated by dual‐luciferase reporter gene analysis. (C) Western blot detection of the expression of YAP1 after the overexpression of miR‐15a‐5p in A549 cells. (D) Expression of YAP1 after co‐transfection of miR‐15a‐5p and YAP1 to A549 cells. (E) Western blot showed the expression of YAP1 after overexpressing miR‐15a‐5p in H520 cells. (F) Expression of YAP1 after co‐transfection of miR‐15a‐5p and YAP1 to H520 cells. (G, H) In A549 and H520 cells, the ability of miR‐15a‐5p to inhibit proliferation was slowed down after YAP1 supplementation. (I, J) YAP1 rescued the decrease in A549 and H520 cells' clone‐forming ability induced by miR‐15a‐5p. **p < 0.01, ***p < 0.001, and ****p < 0.0001.
3.7. FPPT‐miR‐15a‐5p Combined With PTT In Vivo Inhibited Tumor Growth
We have proven that FPPT‐miR‐15a‐5p can inhibit the proliferation of lung cancer cells and promote their apoptosis in vitro. In addition, we focused on whether FPPT‐miR‐15a‐5p can affect tumor progression in vivo. We subcutaneously injected A549 cells transfected with FPPT‐miR‐15a‐5p or FPPT‐NC into the experimental mice. After 2 weeks of tumor volume growth, the mice were laser treated. Xenograft volume and weight were reduced substantially in the FPPT‐miR‐15a‐5p group compared with the FPPT‐NC group. Moreover, the laser group presented smaller and lighter tumors than the no‐laser group. At the same time, the mice did not lose their body weight (Figure 7A–D). Tissue proteins were extracted for Western blot, and the results showed that miR‐15a‐5p can reduce the expression of YAP1 at the tissue level (Figure 7E). Thus, FPPT‐miR‐15a‐5p can inhibit tumor growth in in vivo experiments.
FIGURE 7.

FPPT‐miR‐15a‐5p combined with PTT inhibited tumor growth in vivo. (A) Tumor volume of nude mice subcutaneously injected with A549 cells transfected with FPPT‐miR‐15a‐5p or FPPT‐NC, with or without laser irradiation. (B) Xenografts were dissected from nude mice after 3 weeks of subcutaneous tumor formation. (C) Tumor weight of nude mice subcutaneously injected with A549 cells. (D) Body weight of nude mice. (E) YAP1 expression in tumor tissues. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. FPPT, Fe3O4–PEI–PEG–Tf.
In summary, the detailed mechanistic diagram is shown in Figure 8. The FPPT NPs were synthesized by using the solvent heat method. After in vitro and in vivo experimental validation, FPPT NPs showed good photothermal properties and targeting lung tumors. Furthermore, the nanomaterials successfully loaded miR‐15a‐5p into the lung cancer cells, which inhibited cell proliferation and promoted cell apoptosis. This study effectively developed the characteristics of FPPT NPs itself, including photothermal properties and stability, and also used gene therapy to jointly deal with the development of lung cancer, providing a certain theoretical basis for lung cancer.
FIGURE 8.

Schematic illustration of the FPPT NPs. FPPT, Fe3O4–PEI–PEG–Tf.
4. Discussion
Lung cancer is a highly malignant disease with high aggressiveness and poor prognosis. Thus far, its 5‐year survival rate has shown no improvement, which has brought great challenges to human health; the number of deaths caused by lung cancer is expected to reach 3 million worldwide by 2035 [35, 36, 37]. Viral vectors have high transfection efficiency, and nonviral vectors based on nanotechnology have attracted extensive research attention due to the safety concerns associated with viral vectors [38]. In nanomedicine, NPs have emerged as attractive vehicles for intracellular drug delivery [39]. Some NPs have been clinically translated for the treatment of advanced solid lung tumors, especially NSCLC [40]. NP‐based medicine has unlimited potential, with novel applications continuously being developed in the diagnosis, detection, imaging, and treatment of lung cancer [41]. In our research, Fe3O4 NPs with photothermal properties were synthesized. By comparison, the unetched Fe3O4, which showed better photothermal property and stability than etched Fe3O4, was selected, and various characteristics of the nanomaterial were detected.
Many citrullinated peptide epitopes derived from human proteins, namely, fibrinogen, vimentin, and histone 3, was screened for the specific recognition of neutrophils. The most potent epitope was a mutated fragment of an alpha chain in human fibrinogen that can target therapeutic NPs in human neutrophil [42]. NPs that target programmed death‐ligand 1 and Polo‐like kinase 1 are useful in lung cancer immunotherapy [43]. The expression of TfR on the surface of tumor cells and the influence on Tf (a polypeptide glycoprotein) are several times those of normal cells [44]. The intracellular delivery of anti‐BCR/ABL antibodies using Tf‐modified poly‐lactic‐co‐glycolic acid (PLGA) NPs achieved curative effects and provided a potential therapy for chronic myeloid leukemia [45]. The surface of the nanomaterials was modified with cationic polymers PEI and PEG, and Tf with a targeting effect was modified. Therefore, the studied nanomaterials exhibited good stability and cancer targeting properties. The lung‐targeting effect of the material was validated in small‐animal imaging system experiments. This action is due to the presence of Tf.
5‐Fluorouracil‐impregnated–PLGA‐coated gold NPs were used for enhanced delivery to lung cancer [46]. pH‐sensitive albumin NPs packaged with doxorubicin can be applied to lung cancer‐cell targeting [47]. However, the drug resistance effect produced after drug ingestion limits the therapeutic effect to some extent. NPs can protect miRNAs from the external environment and enhance target‐specific delivery [48]. Thus, FPPT NPs were synthesized to deliver miR‐15a‐5p to lung cancer cells. PTT utilizes external light‐induced thermal therapy to ablate malignant tissues while avoiding damage to healthy ones. Given its simplicity, noninvasiveness, safety, and remote controllability, PTT has attracted widespread attention in clinical applications [49]. Gold nanocage/PEI/miRNA/hyaluronic acid complex effectively delivers miRNAs to target cells, and the combined treatment of gene therapy and PTT considerably enhances its antitumor effect [50]. In our study, when delivered to lung cancer cells, FPPT‐miR‐15a‐5p affected cell proliferation and apoptosis, and given the photothermal properties of nanomaterials, this effect was further enhanced after laser assistance. Weissman et al. also found that MicroRNA‐15a‐5p acts as a tumor suppressor in histiocytosis by mediating CXCL10‐ERK‐LIN28a‐let‐7 axis [51]. Disorders in the Hippo/YAP signaling pathways are associated with the occurrence and development of various diseases [52]. Our study revealed that miR‐15a‐5p can downregulate YAP1 and affect its growth and apoptosis in lung cancer cells. Moreover, it has been reported that miR‐15a may be involved in the treatment of tumors through the erk pathway in other cancers [53]. In future studies, the pathway mechanism is needed to provide direction for further alleviate the current situation of lung cancer.
In summary, Tf‐modified Fe3O4 NPs were constructed for the selective delivery to tumors and better therapeutic effect under the action of laser. The miR‐15a‐5p delivered by FPPT can downregulate the expression of YAP1, which inhibits cell proliferation and promotes apoptosis. This finding provides an idea for the treatment of lung cancer.
Author Contributions
All authors had full access to the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: S.X., Y.L., R.W., and X.W. Acquisition of data: J.A., S.R., and X.Y. Analysis and interpretation of the data: X.W. and L.S. Drafting of the manuscript: X.W. and X.L. Critical revision of the manuscript for important intellectual content: S.X., Y.L., and R.W. Statistical analysis: X.W. and X.L. Obtained funding: S.X., Y.L., and H.S. Administrative, technical and material support: S.X. and Y.L. Study supervision: Y.L.
Ethics Statement
All animal experiments were approved by the Animal Experiment Ethics Committee of Binzhou Medical University (approval number: 2022‐564) and we have adhered to the ARRIVE guidelines (https://arriveguidelines.org/). In order to verify the effect of FPPT‐miR‐15a‐5p on lung cancer cells at the animal level, we conducted the nude mouse tumor bearing experiment. Among them, nude mice were chosen because they were more prone to forming tumor models due to immune deficiency. To verify the targeting of FPPT, we constructed the lung metastasis model, and we still chose the nude mice based on the same considerations. The mice were kept in a laminar airflow cabinet under specific pathogen‐free conditions with a controlled temperature (23 ± 2°C), 12/12‐h light/dark cycle and humidity (40%–70%) with free access to food and water. And mice were euthanized by injection of sodium pentobarbital (150–200 mg/kg). Cautious assessment of animal was performed to confirm death and the remains of animals' bodies were handled by special authorities.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Supplementary Figure 1: (A–D) SEM images and mapping element analysis of Fe3O4.
Supplementary Figure 2: (A) CK7 expression in lung tissues of FPP/GFP‐treatment groups. (B) FPP was visualized in small animals after tail vein injection.
Acknowledgments
We acknowledge professional editing support from ShineWrite.com (service@shinewrite.com) in editing the English text of a draft of this manuscript.
Funding: This work was supported by the National Natural Science Foundation of China (82002604), The Support Plan for Youth Entrepreneurship and Technology of Colleges and Universities in Shandong (2021KJ101), The Shandong Province Taishan Scholar Project, (ts201712067), The Support Plan for Youth Entrepreneurship and Technology of Colleges and Universities in Shandong (2019KJK014), and The Shandong Science and Technology Committee (ZR2023MH223, ZR2020QH221, and ZR2022LSW002).
Xiaoxu Lan, Xiao Wang, and Liying Shao contributed equally to this study.
Contributor Information
Shuyang Xie, Email: xieshuyang@bzmc.edu.cn.
Youjie Li, Email: youjie1979@163.com.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
- 1. Zhu H., Chen C., Guo H., Zhang B., and Hu Q., “The Causal Role of Immune Cells on Lung cancer: A Bi‐Directional Mendelian Randomization (MR) Study,” Aging (Albany NY) 12 (2024): 16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Zhang Q., Li J., Chen Z., et al., “VE‐822 Upregulates the Deubiquitinase OTUD1 to Stabilize FHL1 to Inhibit the Progression of Lung Adenocarcinoma,” Cellular Oncology (Dordrecht) 46, no. 4 (2023): 1001–1014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Cheng Y., Lu X., Li F., et al., “NDFIP1 Limits Cellular TAZ Accumulation via Exosomal Sorting to Inhibit NSCLC Proliferation,” Protein & Cell 14, no. 2 (2023): 123–136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Niu C., Lin H., Zhang Z., Wang Q., and Wei Y., “Impact of Pulmonary Rehabilitation on Exercise Capacity, Health‐Related Quality of Life, and Cardiopulmonary Function in Lung Surgery Patients: A Retrospective Propensity Score‐Matched Analysis,” Frontiers in Medicine (Lausanne) 11 (2024): 1450711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Lev S., “Targeted Therapy and Drug Resistance in Triple‐Negative Breast Cancer: The EGFR Axis,” Biochemical Society Transactions 48, no. 2 (2020): 657–665. [DOI] [PubMed] [Google Scholar]
- 6. Eichner L. J., Curtis S. D., Brun S. N., et al., “HDAC3 Is Critical in Tumor Development and Therapeutic Resistance in Kras‐Mutant Non‐Small Cell Lung Cancer,” Science Advances 9, no. 11 (2023): eadd3243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Makhlin I., Fallowfield L., Henry N. L., Burstein H. J., Somerfield M. R., and DeMichele A., “Targeted Therapies, Sequencing Strategies, and Beyond in Metastatic Hormone Receptor‐Positive Breast Cancer: ASCO Guideline Clinical Insights,” JCO Oncology Practice Published online, August 27, 2024: OP2400547. [DOI] [PubMed] [Google Scholar]
- 8. Lawson M. K., “Improvement of Therapeutic Value of Quercetin With Chitosan Nanoparticle Delivery Systems and Potential Applications,” International Journal of Molecular Sciences 24, no. 4 (2023): 3293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Yang F., Wang X., Sun J., et al., “Mesopore‐Encaged Active MnO x in Nano‐Silica Selectively Suppresses Lung cancer Cells by Inducing Autophagy,” Biomaterials Science 11, no. 6 (2023): 2056–2064. [DOI] [PubMed] [Google Scholar]
- 10. Fan Y., Ou Y., Xiao T., et al., “Coordination‐Driven Nanomedicine Mitigates One‐Lung Ventilation‐Induced Lung Injury via Radicals Scavenging and Cell Pyroptosis Inhibition,” Small 20, no. 46 (2024): e2401056. [DOI] [PubMed] [Google Scholar]
- 11. Wang L., Chen J., Ma C., and Zhang C., “Targeted Nanotherapy Platform Mediated Tumor‐Infiltrating CD8+ T Cell Immune Function Effects for Collaborative Anti‐Tumor Photothermal Immunotherapy for Cervical Cancer,” Nanoscale Advances 6, no. 12 (2024): 3052–3063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Qiu Q., Li J., Ren H., et al., “Zinc Coordination Lipid Nanoparticles co‐Delivering Calcium Peroxide and Chelating STING Agonist for Enhanced Cancer Metalloimmunotherapy,” Small 20, no. 46 (2024): e2402308. [DOI] [PubMed] [Google Scholar]
- 13. Yang S. J., Pai J. A., Shieh M. J., Chen J. L., and Chen K. C., “Cisplatin‐Loaded Gold Nanoshells Mediate Chemo‐Photothermal Therapy Against Primary and Distal Lung Cancers Growth,” Biomedicine & Pharmacotherapy 158 (2023): 114146. [DOI] [PubMed] [Google Scholar]
- 14. Ouyang R., Zhang Q., Cao P., et al., “Efficient Improvement in Chemo/Photothermal Synergistic Therapy Against Lung cancer Using bi@au Nano‐Acanthospheres,” Colloids and Surfaces. B, Biointerfaces 222 (2023): 113116. [DOI] [PubMed] [Google Scholar]
- 15. Jin Y., Rupa E. J., Nahar J., et al., “Hydroponic Ginseng ROOT Mediated With CMC Polymer‐Coated Zinc Oxide Nanoparticles for Cellular Apoptosis via Downregulation of BCL‐2 Gene Expression in A549 Lung Cancer Cell Line,” Molecules 28, no. 2 (2023): 906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Xu W., Yang S., Lu L., et al., “Influence of Lung Cancer Model Characteristics on Tumor Targeting Behavior of Nanodrugs,” Journal of Controlled Release 354 (2023): 538–553. [DOI] [PubMed] [Google Scholar]
- 17. Sun X., Xu Y., Guo Q., et al., “A Novel Nanoprobe for Targeted Imaging and Photothermal/Photodynamic Therapy of Lung Cancer,” Langmuir 38, no. 4 (2022): 1360–1367. [DOI] [PubMed] [Google Scholar]
- 18. Yuan M., Liu D., Shang S., et al., “A Novel Magnetic Fe3O4/Cellulose Nanofiber/Polyethyleneimine/Thiol‐Modified Montmorillonite Aerogel for Efficient Removal of Heavy Metal Ions: Adsorption Behavior and Mechanism Study,” International Journal of Biological Macromolecules 253, no. Pt 3 (2023): 126634. [DOI] [PubMed] [Google Scholar]
- 19. Tang H., Zhou X., Liu L., et al., “Superparamagnetic Iron Oxide‐Erastin‐Polyethylene Glycol Nanotherapeutic Platform: A Ferroptosis‐Based Approach for the Integrated Diagnosis and Treatment of Nasopharyngeal Cancer,” Molecular Pharmaceutics 21, no. 6 (2024): 2767–2780. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Heidarnezhad Z., Ghorbani‐Choghamarani A., and Taherinia Z., “Magnetically Recoverable Fe3O4@SiO2@SBA‐3@2‐ATP‐Cu: An Improved Catalyst for the Synthesis of 5‐Substituted 1H‐Tetrazoles,” Nanoscale Advances 6, no. 17 (2024): 4360–4368. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Chen Y., Zhang Q., Shen J., et al., “Magnetically Actuated Cisplatin‐Loaded Nanoparticle Collectives Enhance Drug Penetration for Potentiated Ovarian Cancer Chemotherapy,” Journal of Colloid and Interface Science 678, no. Pt A (2025): 108–118. [DOI] [PubMed] [Google Scholar]
- 22. Danehchin M. and Esmaeili A. A., “Synthesis of Fe3O4@SiO2@pr‐NH2@DAP as a Magnetic Recyclable Nano‐Catalyst for Efficient Synthesis of Pyranothiazolopyrimidines and 4H‐Pyrans Under Solvent‐Free Condition,” Scientific Reports 13, no. 1 (2023): 14937. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Ma J., Zhang J.‐H., Zhang H.‐W., et al., “Highly Effective Synthesis of Novel Structured Phospholipid Emulsifiers Using Magnetically Recyclable Fe3O4@SiO2/M (M = Zn or Al) Composite,” Food Chemistry 433 (2024): 137313. [DOI] [PubMed] [Google Scholar]
- 24. Cai Y., Karmakar B., Salem M. A., et al., “Ag NPs Supported Chitosan‐Agarose Modified Fe3O4 Nanocomposite Catalyzed Synthesis of Indazolo[2,1‐b]Phthalazines and Anticancer Studies Against Liver and Lung Cancer Cells,” International Journal of Biological Macromolecules 208 (2022): 20–28. [DOI] [PubMed] [Google Scholar]
- 25. Dai Z., Wen W., Guo Z., et al., “SiO2‐Coated Magnetic Nano‐Fe3O4 Photosensitizer for Synergistic Tumour‐Targeted Chemo‐Photothermal Therapy,” Colloids and Surfaces. B, Biointerfaces 195 (2020): 111274. [DOI] [PubMed] [Google Scholar]
- 26. Peng Y., Gao Y., Yang C., Guo R., Shi X., and Cao X., “Low‐Molecular‐Weight Poly(Ethylenimine) Nanogels Loaded With Ultrasmall Iron Oxide Nanoparticles for T(1)‐Weighted MR Imaging‐Guided Gene Therapy of Sarcoma,” ACS Applied Materials & Interfaces 13, no. 24 (2021): 27806–27813. [DOI] [PubMed] [Google Scholar]
- 27. Hoskins C., Cuschieri A., and Wang L., “The Cytotoxicity of Polycationic Iron Oxide Nanoparticles: Common Endpoint Assays and Alternative Approaches for Improved Understanding of Cellular Response Mechanism,” Journal of Nanobiotechnology 10 (2012): 15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Liu P., Zhang H., Wu X., et al., “Tf‐PEG‐PLL‐PLGA Nanoparticles Enhanced Chemosensitivity for Hypoxia‐Responsive Tumor Cells,” Oncotargets and Therapy 9 (2016): 5049–5059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Duran‐Lobato M., Alvarez‐Fuentes J., Fernandez‐Arevalo M., and Martin‐Banderas L., “Receptor‐Targeted Nanoparticles Modulate Cannabinoid Anticancer Activity Through Delayed Cell Internalization,” Scientific Reports 12, no. 1 (2022): 1297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Mao J., Meng X., Zhao C., Yang Y., and Liu G., “Development of Transferrin‐Modified Poly (Lactic‐Co‐Glycolic Acid) Nanoparticles for Glioma Therapy,” Anti‐Cancer Drugs 30, no. 6 (2019): 604–610. [DOI] [PubMed] [Google Scholar]
- 31. Mao K., Zhang W., Yu L., Yu Y., Liu H., and Zhang X., “Transferrin‐Decorated Protein‐Lipid Hybrid Nanoparticle Efficiently Delivers Cisplatin and Docetaxel for Targeted Lung Cancer Treatment,” Drug Design, Development and Therapy 15 (2021): 3475–3486. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Yan L., Su Y., Hsia I., et al., “Delivery of Anti‐microRNA‐21 by Lung‐Targeted Liposomes for Pulmonary Fibrosis Treatment,” Molecular Therapy—Nucleic Acids 32 (2023): 36–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Diaz Mendez A. B., Sacconi A., Tremante E., et al., “A Diagnostic Circulating miRNA Signature as Orchestrator of Cell Invasion via TKS4/TKS5/EFHD2 Modulation in Human Gliomas,” Journal of Experimental & Clinical Cancer Research 42, no. 1 (2023): 66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Lee S. W. L., Paoletti C., Campisi M., et al., “MicroRNA Delivery Through Nanoparticles,” Journal of Controlled Release 313 (2019): 80–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Deng H., Liu H., Yang G., et al., “ACT001 Inhibited CD133 Transcription by Targeting and Inducing Olig2 Ubiquitination Degradation,” Oncogene 12, no. 1 (2023): 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Diao M. N., Zhang X. J., and Zhang Y. F., “The Critical Roles of m6A RNA Methylation in Lung Cancer: From Mechanism to Prognosis and Therapy,” British Journal of Cancer 129, no. 1 (2023): 8–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Ma Z., Wang H., Shi Z., et al., “Inhalable GSH‐Triggered Nanoparticles to Treat Commensal Bacterial Infection in In Situ Lung Tumors,” ACS Nano 17, no. 6 (2023): 5740–5756. [DOI] [PubMed] [Google Scholar]
- 38. Wang H., Qin L., Zhang X., Guan J., and Mao S., “Mechanisms and Challenges of Nanocarriers as Non‐Viral Vectors of Therapeutic Genes for Enhanced Pulmonary Delivery,” Journal of Controlled Release 352 (2022): 970–993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Liu S., Wei W., Wang J., and Chen T., “Theranostic Applications of Selenium Nanomedicines Against Lung Cancer,” Journal of Nanobiotechnology 21, no. 1 (2023): 96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Zheng D., Wang J., Guo S., Zhao Z., and Wang F., “Formulations, Pharmacodynamic and Clinical Studies of Nanoparticles for Lung Cancer Therapy—An Overview,” Current Drug Metabolism 19, no. 9 (2018): 759–767. [DOI] [PubMed] [Google Scholar]
- 41. Carrasco‐Esteban E., Dominguez‐Rullan J. A., Barrionuevo‐Castillo P., et al., “Current Role of Nanoparticles in the Treatment of Lung Cancer,” Journal of Clinical Translation Research 7, no. 2 (2021): 140–155. [PMC free article] [PubMed] [Google Scholar]
- 42. Khatri S., Hansen J., Mendes A. C., et al., “Citrullinated Peptide Epitope Targets Therapeutic Nanoparticles to Human Neutrophils,” Bioconjugate Chemistry 30, no. 10 (2019): 2584–2593. [DOI] [PubMed] [Google Scholar]
- 43. Reda M., Ngamcherdtrakul W., Nelson M. A., et al., “Development of a Nanoparticle‐Based Immunotherapy Targeting PD‐L1 and PLK1 for Lung Cancer Treatment,” Nature Communications 13, no. 1 (2022): 4261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Li S., Guo J., Tian Z., et al., “Piperine‐Loaded Glycyrrhizic Acid‐ and PLGA‐Based Nanoparticles Modified With Transferrin for Antitumor: Piperine‐Loaded Glycyrrhizic Acid‐ and PLGA‐Based Nanoparticles,” AAPS PharmSciTech 22, no. 8 (2021): 276. [DOI] [PubMed] [Google Scholar]
- 45. Jiang G., Huang Z., Yuan Y., Tao K., and Feng W., “Intracellular Delivery of Anti‐BCR/ABL Antibody by PLGA Nanoparticles Suppresses the Oncogenesis of Chronic Myeloid Leukemia Cells,” Journal of Hematology & Oncology 14, no. 1 (2021): 139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Gupta R., Vishwakarma L., Guleri S. K., and Kumar G., “5‐Fluorouracil‐Impregnated PLGA Coated Gold Nanoparticles for Augmented Delivery to Lung Cancer: In Vitro Investigations,” Anti‐Cancer Agents in Medicinal Chemistry 22, no. 12 (2022): 2292–2302. [DOI] [PubMed] [Google Scholar]
- 47. Aziz A., Sefidbakht Y., Rezaei S., Kouchakzadeh H., and Uskokovic V., “Doxorubicin‐loaded, pH‐Sensitive Albumin Nanoparticles for Lung Cancer Cell Targeting,” Journal of Pharmaceutical Sciences 111, no. 4 (2022): 1187–1196. [DOI] [PubMed] [Google Scholar]
- 48. Tryphena K. P., Singh G., Jain N., et al., “Integration of miRNA's Theranostic Potential With Nanotechnology: Promises and Challenges for Parkinson's Disease Therapeutics,” Mechanisms of Ageing and Development 211 (2023): 111800. [DOI] [PubMed] [Google Scholar]
- 49. Cao Y., Li S., Chen C., et al., “Rattle‐Type au@cu(2‐x)S Hollow Mesoporous Nanocrystals With Enhanced Photothermal Efficiency for Intracellular Oncogenic microRNA Detection and Chemo‐Photothermal Therapy,” Biomaterials 158 (2018): 23–33. [DOI] [PubMed] [Google Scholar]
- 50. Yan L. J., Guo X. H., Wang W. P., et al., “Gene Therapy and Photothermal Therapy of Layer‐By‐Layer Assembled AuNCs/PEI/miRNA/HA Nanocomplexes,” Current Cancer Drug Targets 19, no. 4 (2019): 330–337. [DOI] [PubMed] [Google Scholar]
- 51. Weissman R., Diamond E. L., Haroche J., et al., “MicroRNA‐15a‐5p Acts as a Tumor Suppressor in Histiocytosis by Mediating CXCL10‐ERK‐LIN28a‐Let‐7 Axis,” Leukemia 36, no. 4 (2022): 1139–1149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Li L., Wang L. L., Wang T. L., and Zheng F. M., “ACADL Suppresses PD‐L1 Expression to Prevent Cancer Immune Evasion by Targeting Hippo/YAP Signaling in Lung Adenocarcinoma,” Medical Oncology 40, no. 4 (2023): 118. [DOI] [PubMed] [Google Scholar]
- 53. Klein S., Abraham M., Bulvik B., et al., “CXCR4 Promotes Neuroblastoma Growth and Therapeutic Resistance Through miR‐15a/16‐1‐Mediated ERK and BCL2/Cyclin D1 Pathways,” Cancer Research 78, no. 6 (2018): 1471–1483. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary Figure 1: (A–D) SEM images and mapping element analysis of Fe3O4.
Supplementary Figure 2: (A) CK7 expression in lung tissues of FPP/GFP‐treatment groups. (B) FPP was visualized in small animals after tail vein injection.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
