Procollagen C‐protease enhancer protein promotes glioma growth by activating ERK signaling

Abstract

Background

Procollagen C‐proteinase enhancer (PCOLCE) promotes tumor progression in multiple cancers. However, the specific role of PCOLCE in gliomas remains enigmatic. In this study, we focused on analyzing PCOLCE expression and its correlation with clinicopathological parameters in glioma specimens; moreover, we explored the effects of PCOLCE in glioma proliferation in vitro and in vivo.

Methods

A tissue microarray containing 159 human glioma specimens was pressed to explore the correlation between PCOLCE expression and the survival of glioma patients. Cell Counting Kit‐8 (CCK8), colony formation, and immunoblot assays were used to detect the role of PCOLCE on cell proliferation in glioma. Furthermore, the in vivo role of PCOLCE was investigated using a subcutaneous glioma xenograft model.

Results

The expression of PCOLCE was higher in grade III and IV gliomas than in grade I and II gliomas. High PCOLCE expression was related to a remarkably worse prognosis in glioma patients. Additionally, PCOLCE downregulation impeded glioma cell proliferation. Furthermore, PCOLCE knockdown markedly abrogated p‐ERK expression in glioma cells, whereas, it negligibly influenced p38 and JNK signaling.

Conclusions

These results indicate that PCOLCE is a feasible prognostic biomarker for glioma, and PCOLCE‐induced activation of ERK signaling may be a pro‐growth mechanism in glioma cells.

High procollagen C‐proteinase enhancer (PCOLCE) expression is significantly related to the poor prognosis of patients with glioma. PCOLCE expression was higher in grades III and IV rather than in grades I and II gliomas. Inhibition of PCOLCE can inhibit glioma cell proliferation by abrogating p‐ERK signaling in vitro and in vivo.

Abbreviations

BMP‐1

bone morphogenetic protein‐1

DFS

disease‐free survival

ECM

extracellular matrix

OS

overall survival

PCOLCE

procollagen C‐protease enhancer protein

WHO

World Health Organization

1. INTRODUCTION

The World Health Organization (WHO) estimated 308,102 new cases (1.6%) diagnosed with brain tumors in 2020, while 251,329 (2.5%) deaths due to brain tumors were estimated worldwide. ¹ Glioblastomas (GBs) comprise approximately 49% of all malignant brain tumors; surgery, radiotherapy, and adjuvant therapy are its most common treatments. ² With advances in technologies and genomic sequencing of tumors, molecular targets emerge as a tool to define tumor type in addition to histology according to the WHO classification of CNS tumors. ³ Isocitrate dehydrogenase 1 (IDH1), EGFR amplification, and MGMT promoter methylation are the three most commonly used biomarkers of GB. IDH‐mutant GB, associated with a survival ratio similar to that of low‐grade gliomas, has a better prognosis. ³ , ⁴ GB with MGMT promoter hypermethylation exhibits a better response to temozolomide. ⁵ , ⁶ To date, little efficacy of EGFR inhibitors for the treatment of glioblastoma has been reported. ⁷ Therefore, it is urgent to appraise potential targets for the effective treatment of glioblastoma.

The GB involves a complicated microenvironment in which tumor cells reciprocity with the microenvironment ingredients, including the extracellular matrix (ECM) and stromal cells. ⁸ The ECM of brain tumors comprises basement membrane components, collagen IV, laminin, and fibronectin in the blood vessels; moreover, collagen I and hyaluronan are present around the tumor. ⁹ Collagens are rare in normal brain tissue, whereas, collagen content is greatly elevated in GB, which drives tumor progression. Procollagen C‐proteinase enhancer protein (PCOLCE; 55 kDa) is a secreted glycoprotein that activates bone morphogenetic protein 1 (BMP‐1)/tolloid‐like proteinases (BTPs) to stimulate cleavage of procollagen C‐propeptides, leading to the maturation of collagen precursors to form collagen fibrils. ¹⁰ Abnormal expression of PCOLCE is associated with various diseases, such as fibrosis and cancer. ¹¹ , ¹² Serum PCOLCE is a potential biomarker of diseases, such as liver, muscle, and cardiac fibrosis. ¹³ , ¹⁴ PCOLCE deficiency leads to the dysfunction of corneal repair. ¹⁵ PCOLCE binds to the expansion mutant PABPN1 and becomes entrapped into the nucleus, leading to oculopharyngeal muscular dystrophy. ¹⁶ Furthermore, elevated PCOLCE promotes the metastasis of breast cancer cells to the bones. ¹⁷ High PCOLCE expression correlates with poor prognosis in human osteosarcoma due to promoted cell migration, invasion, and lung metastasis. ¹¹ The glycosylation site at Asn29 in PCOLCE is crucial for its effects on osteosarcoma. ¹¹ PCOLCE is one of the most obviously elevated genes in neurofibromas, and SOX9 binds to PCOLCE to support collagen VI secreting by fibroblasts. ¹⁸ Elevated PCOLCE can regulate immunocyte infiltration in gliomas to enhance the immunosuppressive microenvironment. ¹³ However, further studies are required to clarify the value of PCOLCE in glioma.

In this study, we showed that PCOLCE was elevated expression in glioma samples and is related to poor prognosis in glioma. In vitro and in vivo results indicated that the pro‐proliferative role of PCOLCE potentially depends on the activation of ERK signaling.

2. MATERIALS AND METHODS

2.1. Tumor tissue microarray

Human glioma tissue microarray (TMA, Cat. HBraG159Su01) was obtained from Shanghai Outdo Biotech Co., Ltd. The TMA contained 159 glioma tissues; two tissues were exfoliated, and 157 glioma tissues were used to analyze PCOLCE expression.

2.2. Immunohistochemistry and scoring

Slides of glioma tissue were heated at 63°C for 1 h, dewaxed, and rehydrated using xylene, and graded alcohol, respectively. After antigen retrieval by sodium citrate (pH 6.0) for 15 min, the endogenous peroxidase was stifled by 3%H₂O₂ and non‐specific binding was intercepted by 10% goat serum for 30 min. Subsequently, the slides were incubated with PCOLCE rabbit polyclonal antibody (ab154261, 1:1000, Abcam) overnight at 4°C. The two‐step EnVision System (Dako, Osaka, Japan) was used for immunohistochemical staining. Finally, the slides were counterstained with hematoxylin for 2 min. Tissue sections were scored based on the proportion of stained cells and intensity of staining; a score of 0 indicated negatively stained cells, whereas, scores of 1, 2, 3, and 4 indicated 1%–25%, 26%–50%, 51%–75%, and 76%–100% stained cells, respectively. The slides were allocated a score of 0, 1, 2, and 3 for negative, mild, moderate, and intense staining, respectively, using a high‐power (×400) microscope. Finally, the expression of PCOLCE was measured by the following two classifications, including high expression (intensity score × proportion score ≥ 8) or low expression (intensity score × proportion score < 8).

2.3. The Cancer Genome Atlas and Chinese Glioma Genome Atlas database

Glioma patient information was downloaded from the The Cancer Genome Atlas (TCGA) database and analyzed using R analysis. GEPIA2.0. and Chinese Glioma Genome Atlas (CGGA) databases were also used to analyze the function of PCOLCE in glioma survival and the differential PCOLCE expression at various stages of glioma.

2.4. Cell culture

The T98G and U87 cells were purchased from the Chinese Academy of Sciences. U87 cells were cultured in DMEM (Thermo Fisher Scientific, USA) with 10% FBS (Sigma), supplemented with 1% penicillin‐streptomycin. T98G cells were cultured in MEM (Thermo Fisher Scientific, USA) supplemented with 10% FBS (Sigma), 1% non‐essential amino acid, and 1 mM sodium pyruvate. Lentiviruses generated using either PCOLCE shRNAs ao shRNA/control (shNC) were packaged in HEK293T cells using the pMD2.G and psPAX2 plasmids. Stable cell lines were generated by selecting them using puromycin (10µg/ml). shRNAs targeting PCOLCE, PCOLCE‐sh1 (5’‐CCGGTGCGGTG AAGAAAGGAGTCAGTTATCCTCGAGGATAACTGACTCCTTTCTTCATT TTTG‐3’), PCOLCE‐sh2(5’‐CCGGTGCCGTGACTGTCAGTCTTATCTCGAGATAAGACTGACAGTCACGGCATTTTTG‐3’), and PCOLCE‐sh3 (5’‐CCGGCGCTGACCTTCGAGAAGTTTGCTCGAGCAAACTTCTCGAAGG TCAGCGTTTTTG‐3’), were obtained from Shanghai Genechem Co., Ltd.

2.5. CCK8 assay

T98G and U87 cells were digested to measure the role of PCOLCE on glioma cell growth according to the Cell Counting Kit‐8 (CCK8) (Jiangsu Keygen Biotech Corp., Ltd.); 1.0×10⁴ cells were cultivated into 96‐well plates and incubated with CCK8 for 1h at 37°C under the controlled condition maintaining 5% CO₂, subsequently, the absorbance was detected by microplate reader at 450 nm.

2.6. Colony‐forming assay

T98G and U87 cells were digested and plated into 6‐well plates (400 cells per well); these cells were cultured for two weeks at 37°C and 5% CO₂. Subsequently, the cells were fixed by incubating them with 4% methanol for 10 min and stained using crystal violet. 10% acetic acid was used to make cells discoloration, and finally, the absorbance of stained cells was detected at 450 nm.

2.7. Western blotting analysis

Briefly, cells or tissues were harvested and lysed using radioimmunoprecipitation assay lysis buffer. Protein concentrations were determined using a BCA quantification kit (Beyotime). Proteins were loaded into the SDS–PAGE gel and transferred to polyvinylidene difluoride membranes followed by incubation with specific primary antibodies. Subsequently, an enhanced chemiluminescence assay was performed to detect protein expression.

2.8. Quantitative real‐time polymerase chain reaction

Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific) and reverse‐transcribed into complementary DNA using a PrimeScript RT reagent kit (Takara, Japan). We used the TB Green Fast qPCR Mix kit (Takara, Japan) for the following analysis. β‐Actin was used as a reference gene, and the 2^−ΔΔCT method was used to calculate and analyze multiple variations. Primer sequences used in Quantitative real‐time polymerase chain reaction (RT‐qPCR) were as follows: PCOLCE (5’‐ CGAAGACTCGGAATGA GAGGG ‐3’).

2.9. Glioma subcutaneous xenograft model

In this study, we used six‐week‐old male nude mice obtained from Shanghai SLAC Laboratory Animal Co. Ltd. The Animal Research Committee of Huzhou Central Hospital approved the animal experiments. U87 cells (NC and shPCOLCE, 1 × 10⁷ cells/100µL/mouse) were subcutaneously injected into the right flanks of mice, four mice per group. Tumor volumes were measured using the following formula: (width² × length) × 0.50. Three weeks after the injection, the mice were euthanized using isoflurane (2%) inhalation, and the tumors were collected for H&E staining, immunohistochemistry, and immunoblot analyses.

2.10. Statistical analysis

Statistical analyses were performed using Student's t‐test or analysis of variance with the Bonferroni post hoc test. The correlation between PCOLCE expression and clinical features was analyzed using the χ² test. Survival analysis was performed using the Kaplan‐Meier method. Univariate and multivariate Cox regression analyses of independent prognostic factors associated with overall survival (OS) and disease‐free survival (DFS) were conducted. All data were analyzed using GraphPad Prism 8.0 or SPSS 26.0.

3. RESULTS

3.1. Bioinformatic analysis of PCOLCE by using TCGA and CGGA database

To verify PCOLCE expression in glioma tissues, we investigated its expression profiles using the GEPIA database. PCOLCE mRNA levels were dramatically elevated in GBMs than in the corresponding normal tissues (Figure 1A). PCOLCE expression was slightly elevated in LGGs; however, no significant difference was detected (Figure 1B). Consistently, CGGA database analysis revealed that PCOLCE expression was gradually upregulated with the progressing grade of GBMs (Figure 1C).

FIGURE 1.

Bioinformatics analysis of procollagen C‐proteinase enhancer (PCOLCE) by using The Cancer Genome Atlas (TCGA) and Chinese Glioma Genome Atlas (CGGA) database. The expression profile of PCOLCE in (A) normal brain and glioblastoma tissues and (B) normal brain and low‐grade glioma tissues was analyzed using GEPIA 2.0 database (GEPIA 2.0 [cancer‐pku.cn]). (C) PCOLCE expression in major stages of glioma was analyzed using the CGGA database. The differential expression of PCOLCE (D) in IDH mutation glioma and wildtype glioma, (E) its correlation with age, (F) in primary and recurrent gliomas, and (G) its correlation with gender as detected using the CGGA database. The correlations of PCOLCE expression level with (H) overall survival and (I) progression‐free survival in glioma were analyzed using the TCGA database.

As IDH1 mutation is a good prognostic biomarker of gliomas, we explored PCOLCE expression in wildtype and gliomas with IDH1 mutation and demonstrated that dramatically suppressed PCOLCE level in IDH1 mutant glioma than in the wildtype (Figure 1D). Subsequently, patients aged≥ 42 years exhibited higher PCOLCE expression than younger patients (Figure 1E). Interestingly, further analysis showed no variation in PCOLCE expression with varying progression status and patient sex (Figure 1F,G).

Moreover, Kaplan–Meier analysis of TCGA data further revealed that high PCOLCE expression was related to poor prognosis of GBM, indicating worse OS and progression‐free survival (PFS) rates in GBM patients compared with those in the subgroup with low PCOLCE expression (Figure 1H,I).

3.2. Glioma microarray reflects that PCOLCE is highly expressed in glioma and correlates with poor progression

Immunohistochemistry assay using a tissue microarray revealed that a total of 56 (36.6%) gliomas exhibited high PCOLCE expression, whereas, low PCOLCE expression was observed in 101 (55.4%) glioma samples (Figure 2A); PCOLCE protein expression was elevated in grade III‐IV (n = 67) gliomas than in grade I‐II (n = 90) gliomas (Figure 2B,C). Additionally, Kaplan–Meier analysis of specimens revealed a worse OS in glioma with high PCOLCE expression (Figure 3A). Similarly, high expression of PCOLCE was an independent prognostic marker for worse DFS (p < 0.0001) (Figure 3B). Moreover, it indicated that the elevated expression of PCOLCE is a prognostic factor in glioma development and is associated with poor OS and DFS in specimens with grades I‐II and III‐IV (Figure 3C–F).

FIGURE 2.

Procollagen C‐proteinase enhancer (PCOLCE) is overexpressed in different grades of glioma. (A) The differential expression of PCOLCE protein was assessed using IHC staining of a glioma tissue microarray including 159 glioma tissues; representative pictures are shown. Scale bars, 100µm. (B) The IHC scores of PCOLCE in grades I, II, III, and IV of glioma. (C) The comparison of the IHC score of PCOLCE between the grades I‐II and III‐IV of glioma. *p < 0.05, **p < 0.01, **p < 0.001.

FIGURE 3.

Procollagen C‐proteinase enhancer (PCOLCE) is correlated with poor survival in glioma. The correlation of PCOLCE expression levels (high and low) with (A, B) the overall and disease‐free survival rates in glioma, (C, D) overall survival rate in grades I‐II and III‐IV glioma, and (E, F) disease‐free survival rate in grade I‐II and III‐IV of glioma patients detected through glioma microarray staining.

Consistently, analysis of clinicopathological parameters validated the correlations of high PCOLCE expression with age (≥42) and stage of the disease (both p < 0.05, Table 1). EGFR amplification was significantly elevated in the high PCOLCE expression group compared to the low PCOLCE expression group (30/34 vs. 25/66, p = 0.013). However, the expressions of indicators, including EMA, PCNA, CD34, S100, GFAP, and PD‐L1, were not associated with PCOLCE expression (Table 1).

TABLE 1.

Correlation between procollagen C‐proteinase enhancer (PCOLCE) expression and clinical pathological characteristics of glioma patients.

	PCOLCE expression levels
Feature	Low	High	p‐value
Age (year)			0.004
<42	57	18
≥42	44	38
Gender			0.248
Female	40	17
Male	61	39
Grade			0.001
I	15	2
II	53	20
III	27	21
IV	6	13
EMA			0.134
0	34	31
I	9	2
PCNA			0.107
I	17	3
II‐III	41	21
CD34			1.000
0	6	4
I–II	63	36
S‐100			0.220
0	5	4
I	36	28
II	31	18
III	14	3
GFAP			0.261
0	3	1
I	35	28
II	48	24
III	9	2
EGFR			0.013
Low	66	25
High	34	30
PD‐L1			0.078
Low	75	34
High	26	22

As expected, univariate analyses indicated that high PCOLCE, age, tumor grade, sex, and S‐100 crucially influenced OS and DFS in our cohort (all p < 0.05, Tables 2 and 3). Furthermore, multivariate analysis revealed that tumor grade was an independent prognostic factor for poor OS (Table 2), whereas, age and tumor grade were distinct prognostic factors for poor DFS (Table 3). Therefore, PCOLCE expression was elevated in gliomas and higher PCOLCE expression was related to worse OS and DFS.

TABLE 2.

Univariate and multivariate analyses of prognosis factors correlated with the overall survival of glioma patients.

	Univariate analysis			Multivariate analysis
Variables	HR	95% CI	p‐value	HR	95% CI	p‐value
PCOLCE level	3.199	1.863–5.493	<0.001	1.399	0.744–2.632	0.298
Gender	1.650	0.912–2.988	0.098
Age (≥42)	1.964	1.126–3.424	0.017	1.526	0.800–2.910	0.200
Grade	6.992	4.594–10.641	<0.001	6.501	4.005–10.551	<0.001
EMA	0.410	0.126–1.335	0.139
PCNA	6.652	0.888–49.850	0.065
CD34	0.505	0.196–1.301	0.157
S‐100	0.631	0.436–0.913	0.015	0.822	0.549–1.229	0.340
GFAP	0.716	0.478–1.071	0.104
EGFR	1.317	0.771–2.248	0.314
PD‐L1	0.926	0.518–1.658	0.797

TABLE 3.

Univariate and multivariate analyses of factors correlated with the disease‐free survival in glioma patients.

	Univariate analysis			Multivariate analysis
Variables	HR	95% CI	p‐value	HR	95% CI	p‐value
PCOLCE level	2.459	1.606–3.764	<0.001	0.824	0.373–1.818	0.631
Gender	1.582	1.000–2.503	0.050	1.196	0.520–2.751	0.673
Age (≥42)	1.925	1.249–2.968	0.003	2.364	1.020–5.481	0.045
Grade	4.382	3.231–5.942	<0.001	5.431	2.794–10.554	<0.001
EMA	0.487	0.208‐1.142	0.098
PCNA	5.510	1.694–17.925	0.005	3.670	0.797–16.903	0.095
CD34	0.360	0.176–0.736	0.005
S‐100	0.677	0.509–0.899	0.007	0.837	0.515–1.358	0.471
GFAP	0.827	0.600–1.140	0.246
EGFR	2.035	1.330–3.116	0.001	1.725	0.823–3.617	0.149
PD‐L1	1.272	0.821–1.971	0.282

3.3. PCOLCE activates ERK signaling to promote the proliferation of glioma

In our shRNA‐mediated loss‐of‐function study conducted to determine the functional role of PCOLCE in gliomas, the knockdown efficiency was confirmed by qRT‐PCR and immunoblots (Figure 4A,B). Interestingly, the CCK8 assay revealed that PCOLCE knockdown markedly inhibited cell growth (Figure 4C). Colony formation consistently decreased after PLCOLCE knockdown in T98G and U87 cells (Figure 4D).

FIGURE 4.

Procollagen C‐proteinase enhancer (PCOLCE) promotes the proliferation of glioma by activating ERK signaling. (A) The mRNA and (B) protein levels of PCOLCE were measured using Quantitative real‐time PCRpolymerase chain reaction (qRT‐PCR) and western blot, respectively. (C) CCK8 and (D) colony formation assays were performed and quantified in the indicated stable cells as described in the Materials and Methods. (****p < 0.0001). (E, F) The protein expression levels of ERK, p38, and JNK signaling pathways in T98G (E) and U87 (F) cells after knocking down of PCOLCE were detected by western blotting.

Previous studies have reported that JNK and p38 mitogen‐activated protein kinase (MAPK) signaling, as well as ERK signaling, play a stimulative role in the cell proliferation and growth of gliomas. ¹⁹ , ²⁰ Hence, we further examined these three pathways to elucidate the mechanism underlying the effects of PCOLCE on glioma growth. Immunoblotting results showed that the knockdown of PCOLCE significantly inhibited p‐ERK expression, whereas, little effect was observed on the expression of p‐p38 and p‐JNK after PCOLCE knockdown (Figure 4E,F). These results demonstrated that PCOLCE potentially promotes glioma proliferation by activating ERK signaling.

3.4. Knockdown of PCOLCE inhibited glioma xenografts growth

To investigate whether PCOLCE enhances the tumorigenic capacity of glioma cells in vivo, U87 cells stably expressing shNC or shRNA/PCOLCE (shPCOLCE) were used to generate the mouse xenograft model of glioma. Consistent with in vitro results, PCOLCE knockdown dramatically suppressed tumor growth and decreased the tumor volume (Figure 5A,B); moreover, it downregulated the Ki67 expression in xenograft tissues (Figure 5C,D). Additionally, western blot analysis revealing p‐ERK expression in xenograft tumors indicated that PCOLCE knockdown reduces p‐ERK expression (Figure 5E). Therefore, elevated PCOLCE levels effectively boost glioma progression, possibly by suppressing ERK phosphorylation.

FIGURE 5.

The downregulation of procollagen C‐proteinase enhancer (PCOLCE) inhibits glioma tumor growth in vivo. Nude mice were sacrificed 21 days after inoculation, (A) xenograft tumors were harvested and photographed; (B) volumes of the tumors were measured. (C, D) HE and IHC analyses for Ki67 in the xenografts of the NC or shPCOLCE groups. Bars represent mean ± SD. *p < 0.05, two‐tailed Student's t‐test. (E) The protein expression levels of p‐ERK, ERK, and PCOLCE in xenograft tumors were detected via western blotting analysis.

4. DISCUSSION

PCOLCE is a glycoprotein that stimulates the activity of BMP‐1, a zinc metalloproteinase regulating collagen deposition in the ECM by cleaving C‐propeptides from procollagen I, II, and III. ¹⁰ Previous studies have shown that PCOLCE is involved in the progression of multiple diseases, including fibrosis, corneal repair, and cancers. This study reflects that PCOLCE exerts an undesirable factor in human glioma samples.

We demonstrate the role of PCOLCE in glioma using TCGA and CGGA databases. The elevated PCOLCE expression in gliomas indicates that it may function as an oncogene. The microarray containing 159 clinical glioma samples validated that PCOLCE expression was upregulated in stage III compared to that in grades I‐II, whereas, it did not significantly differ between grades III and IV. However, bioinformatics analysis reflected significantly higher PCOLCE expression in patients with grade IV glioma than in patients with grade III glioma; this difference may be attributable to the inadequate number of grade IV cases included in our microarray. Additionally, further comparative analysis of PCOLCE expression between grades I‐II and III‐IV disease using the microarray revealed that PCOLCE expression was positively related to an increase in the malignancy of brain glioma, which was partially supported by bioinformatics analysis.

Subsequently, while analyzing the prognostic value of PCOLCE in glioma using a microarray, we found that high PCOLCE expression was inversely correlated with both OS and DFS. Specifically, patients with high PCOLCE expression showed worse OS and DFS rates at stages III and IV. Furthermore, the correlation between PCOLCE expression and clinicopathological features, such as age and tumor grade in gliomas was demonstrated.

Overall, we propose that PCOLCE is associated with glioma progression. Zhao et al. reported that inhibition of PCOLCE significantly induces cell apoptosis and cell cycle arrest in glioma cells, which further supports the pro‐tumor role of PCOPLE in glioma. ¹³ Furthermore, PCOLCE was reported to exert a crucial role in promoting the osteosarcoma metastasis. ⁴ Previously, a crucial effect of the MAPK signaling pathway in the pathogenesis and progression of gliomas has been reported. ²¹ Most gliomas exhibit changes in the MAPK signal pathway. ²² ERK signaling has been reported to support glioma growth. ²⁰ This study significantly aids in understanding the role of PCOLCE in gliomas; it indicates that PCOLCE potentially promotes glioma cell proliferation via activated ERK signaling in vitro and in vivo, as we speculated that PCOLCE may act as an oncogene for glioma by activating ERK signaling.

AUTHOR CONTRIBUTIONS

M.C. and L.R. contributed to the conception and design of this study. Z.M. organized the database, performed statistical analysis, and wrote the initial draft of the manuscript. D.H. wrote the Discussion section of the manuscript. All the authors read and approved the submitted version.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflict of interest.

ETHICS STATEMENT

The human glioma tissue microarray study was approved by the Clinical Research Ethics Committee of Shanghai Outdo Biotech Co., Ltd. (no. YB M‐05‐02). Animal studies were approved by the Animal Research Committee of Huzhou Central Hospital (No. 202304001).

Ma Z, Huang D, Ru L, Chen M. Procollagen C‐protease enhancer protein promotes glioma growth by activating ERK signaling. Asia-Pac J Clin Oncol. 2025;21:48–57. 10.1111/ajco.14127

DATA AVAILABILITY STATEMENT

Data will be made available on request.