EVOLUTION. For the article “Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins,” by Gregory J. Adcock, Elizabeth S. Dennis, Simon Easteal, Gavin A. Huttley, Lars S. Jermiin, W. James Peacock, and Alan Thorne, which appeared in number 2, January 16, 2001, of Proc. Natl. Acad. Sci. USA (98, 537–542), the authors note that column 199 in Table 1 is incorrectly marked as parsimoniously informative. The insert sequence at position 199 has been incorrectly entered as an A instead of a T. The A should be deleted and replaced by a dot (.). The corrected table appears below. Also, on page 540, right column, third paragraph, line 16, the phrase “and because there are 14 nucleotide differences” should read “and because there are 13 nucleotide differences.” The phylogenetic analysis did not include this error, so the interpretation of the data is not affected.
Table 1.
Nucleotide sequence variation at sites that vary among ancient Australian, the Feldhofer and the Insert sequences
| Nucleotide Site | |
| 111111111111111222222222222222222222222222233333333333333 | |
| 79001122345668889001223344444555566677888899901112345556688 | |
| 83781269984393499198340413479368923448467803911780715672817 | |
|---|---|
| CRS | ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA |
| Bonobo | ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC.. |
| Chimpanzee | ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C.. |
| Feldhofer | GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C... |
| Insert | -......A.......A...T..G.....C...A.CTATG..CTC.TC.....TC..C.. |
| LM3 | ....................T.G...........CT.T....T..T......TC....G |
| LM4 | .................T...........G................C............ |
| LM15 | ....................T........................T.......C....G |
| LM55 | ...........G.......................T....................... |
| KS1 | .C............T.....T.........................CG..T........ |
| KS7 | ..............T.....T..................T...........C....... |
| KS8 | ...................T.G..............TG.......C............ |
| KS9 | .C..................T..............T............C.........G |
| KS13 | .C............T.....T....C.G.................TC............ |
| KS16 | ....................T...................T.............C..C. |
| Aboriginal | TG CT TCC A CA TCG C C A T CC CT T |
| Polymorphism | CA TC CTT T TC CTA T T G C TT TC C |
| GJA | .....................C........................C............ |
| AT | ......C.................................................... |
| Contaminant | .....................C........................C............ |
| K13 Cntmnt | ——–––––.............T.........................––––––––––––– |
Nucleotide sites are numbered as in the CRS less 16,000 (50), so that, for example, our site 78 corresponds to site 16,078 in the CRS. Variation in living Aboriginal Australians is shown for individual sites rather than as continuous linear sequences. The following additional sites are variable in samples from living Aboriginal Australians (41): 51, 72, 75, 86, 137, 158, 172, 176, 179, 188, 192, 193, 213, 221, 239, 245, 260, 261, 266, 270, 271, 291, 294, 295, 303, 304, 319. Only differences from the CRS are shown. Information about the bone samples is in refs 48, 52, and references therein. GJA—Greg J. Adcock; AT—Alan Thorne.