Skip to main content
ACS AuthorChoice logoLink to ACS AuthorChoice
. 2025 Jan 8;17(3):4463–4479. doi: 10.1021/acsami.4c15459

Coordination of Focal Adhesion Nanoarchitecture and Dynamics in Mechanosensing for Cardiomyoblast Differentiation

Jingwei Xiao †, Jing Wen Ang †, Xueying Zhong †, Darren Chen Pei Wong †,‡, Thivakar T †, Ivan Yow †, Chang Jie Mick Lee §,∥,⊥, Roger S-Y Foo §,∥,⊥, Pakorn Kanchanawong †,#, Boon Chuan Low †,‡,¶,*
PMCID: PMC11758775  PMID: 39778877

Abstract

graphic file with name am4c15459_0008.jpg

Focal adhesions (FAs) are force-bearing multiprotein complexes, whose nanoscale organization and signaling are essential for cell growth and differentiation. However, the specific organization of FA components to exert spatiotemporal activation of FA proteins for force sensing and transduction remains unclear. In this study, we unveil the intricacies of FA protein nanoarchitecture and that its dynamics are coordinated by a molecular scaffold protein, BNIP-2, to initiate downstream signal transduction for cardiomyoblast differentiation. Within the FAs, BNIP-2 regulates the nano-organization of focal adhesion kinase (FAK), and the dynamics of FAK, paxillin, and vinculin. Depletion of BNIP-2 resulted in altered focal adhesion numbers and sizes per cell, reduced traction force, and decreased FA sensitivity for mechanosensing. At the molecular level, the loss of BNIP-2 disrupted the FAK-paxillin signaling axis, where FAK inhibition reproduces the effects of BNIP-2 loss by impairing the phosphorylation of both FAK and paxillin. Mechanistically, BNIP-2 preferentially binds to constitutively active FAK and acts as a molecular scaffold to mediate interactions between FAK and paxillin and between paxillin and vinculin. We have validated BNIP-2’s role in the FAK-paxillin signaling axis in human embryonic stem cells (hESC). Furthermore, we showed that depletion of BNIP-2 resulted in changes in signature gene targets at the cardiac progenitor stage of differentiation. In summary, we showed that the intricate interplay of FA nanoarchitecture and dynamics, governed by BNIP-2, is crucial for force transduction and biochemical signaling in driving cardiomyoblast differentiation.

Keywords: Focal adhesion nanoarchitecture, Scanning angle interference microscopy, Mechanotransduction, Cardiomyoblast differentiation, Traction force microscopy, BCH domain scaffold protein, Mechanobiology

1. Introduction

The regulation of mechanical sensing and transduction plays a crucial role in numerous cellular processes, both in normal physiological conditions and disease states.1 During cardiac development, embryonic stem cells and postnatal immature cardiac cells respond to mechanical cues, such as substrate stiffness and intracardiac fluid stress, to drive cardiac morphogenesis,2 cardiomyoblast differentiation,3,4 and maturation.5,6 Of which, the cytoskeleton remodeling, mediated by Rho-family small GTPases, regulates the downstream signaling pathways, and transcriptional factors are the underlying cellular mechanisms for these cellular processes.7 These cytoskeletal changes induce a feedback loop that spatiotemporally controls cellular signaling, influencing processes such as cell migration or induction of cell type-specific differentiation.7,8 For example, actomyosin-based contractility and cortical tension can control the molecular kinetics of the proteins at the adhesion sites, known as focal adhesions (FAs), which are formed between cells and their adhered-on substrates.9−11

FAs are multiprotein complexes at the plasma membrane for mechanosensing and mechanotransduction.12 This integrin-based cell adhesion structure intricately links the actin cytoskeleton to the extracellular matrix (ECM), facilitating the transduction of extracellular mechanical signals into intracellular biochemical signaling via nanoscale interactions between various resident molecules.13−15 The nanoarchitecture of the force-bearing multiprotein complex is stratified into three nanoscale layers: the integrin signaling layer (ISL), the force-transduction layer, and the actin regulatory layer.16 The nanoscale vertical distribution of these layers is tightly regulated, providing the structural basis for a molecular clutch that promotes force transmission and protein–protein interactions within FAs.12,16 Within the ISL, the FA adaptor protein paxillin is phosphorylated by focal adhesion kinase (FAK) and the force-bearing FA adaptor protein vinculin is transiently recruited to a focal complex (immature FAs) in an actomyosin-based force-dependent manner for mechanosensing.17−19 FAK activation status (p-FAK Y397) at individual FAs is reported to be linearly coupled on stiff substrates.20 FAK is found to regulate cardiogenesis in embryonic stem cells21 and the loss of FAK has been associated with defects in cardiac development and hypertrophy.22,23 However, it remains unclear whether and how FA structural organization is regulated spatiotemporally at the molecular level for mechanosensing and mechanotransduction during cardiomyoblast differentiation.

The BCL2/adenovirus E1B 19 kDa protein-interacting protein 2 (BNIP-2), which comprises only a BCH-domain at its C-terminus, is known for its role as a molecular scaffold protein to mediate the interactions between its protein interacting partners for multiple downstream cellular events such as cell differentiation,24,25 vesicle trafficking26,27 and cell migration.28 More specifically, BNIP-2 mediates the interaction between GEF-H1 and RhoA, warranting high cellular contractility in breast cancer cells to impede cell migration.28 Dynamic RhoA activity has been reported to be critical for the mechanosensitivity of the stem cell for lineage commitment.29,30 Since BNIP-2 is a key regulator of actomyosin-based contractility and that focal adhesions (FAs) are crucial in Rho activation,30 we speculate that BNIP-2 could function as a scaffold for the dynamic regulation of focal adhesion nanostructures and their signaling for cardiomyoblast differentiation. Interestingly, BNIP-2 expression was also found to be downregulated in heart cells with Lamin A/C mutations which were found to be associated with cardiomyopathy, a disorder in which the heart muscle loses its ability to pump blood efficiently.31

To elucidate the role(s) of BNIP-2 at the FA for mechanosensing, we first established BNIP-2 interactomes with FA proteins. We employed scanning angle interference microscopy (SAIM) to examine BNIP-2’s effect on the nano-organization of FAs and found that BNIP-2 regulates the Z-position of FAK within the FA nanoscale architecture. Further studies showed that BNIP-2 is involved in regulating force generation, FA size and numbers, and the dynamics of key FA proteins, including FAK, paxillin, and vinculin. Analysis of best-fit lines plotting the total FA area per cell against the traction force showed decreased sensitivity in cells depleted of BNIP-2. Our findings reveal that the loss of BNIP-2 disrupts FA signaling and impedes cardiomyoblast differentiation in both H9c2 cells and human embryonic stem cells (hESCs). Moreover, we observed that FAK inhibition (FAKi) phenocopies the effects of BNIP-2 loss by impairing phosphorylation of both FAK and paxillin, suggesting that BNIP-2 is crucial for regulating FAK. Our study demonstrates that BNIP-2 functions as a molecular scaffold between FAK and paxillin to coordinate the nanoscale architecture of FAs for force generation and downstream signal propagation. All in all, we have shown that BNIP-2 is essential for force transduction during cardiomyoblast differentiation by regulating the FA nanoscale architecture and dynamics through FAK activities.

2. Results and Discussion

BNIP-2 Is Associated with Focal Adhesion for Cardiomyoblast Differentiation

In our previous study, we demonstrated that BNIP-2 promotes actomyosin-based contractility through RhoA activation.25,28 In addition, other studies have linked the spatiotemporal regulation of Rho-family GTPase catalytic activity to focal adhesion proteins such as paxillin.32,33 Hence, we speculated that BNIP-2 potentially plays a role in the mechanosensing within the FA complex. To this end, we conducted an analysis of our previous data from an unbiased Turbo-ID labeling assay in transfected HEK293T cells to identify plausible BNIP-2 interactors at the FA.25 The mass spectrometry result, along with STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) analysis,34 revealed paxillin, a common marker of FAs, and other proteins within the FAs as interacting partners of BNIP-2 (Figure 1A). To validate these findings, we performed immunofluorescence staining in H9c2, a rat cardiomyoblast cell line, and showed the accumulation of BNIP-2 at the areas of cell protrusion (Figure S1A). Line scan analysis further revealed that BNIP-2 colocalizes with paxillin at the FA of H9c2 cells. Interestingly, BNIP-2 also colocalized with vinculin and FAK at the FA (Figure S1B–C). We corroborated these findings using biochemical assays, namely, proximity ligation assay (PLA) (Figure 1B) and co-immunoprecipitation (co-IP), confirming the interactions of BNIP-2 with paxillin, vinculin, and FAK within the FA complexes (Figure 1C-E).

Figure 1.

Figure 1

BNIP-2 is associated with focal adhesion for cardiomyoblast differentiation. (A) Protein network analysis of BNIP-2 TurboID biotinylated proteins enriched at the focal adhesion is retrieved from STRING (https://string-db.org/). The line represents physical interaction identified by STRING, and unconnected proteins have no previously recorded interactions. Proteins are displayed using gene symbols. (B) Images of interaction between BNIP-2 and FA proteins (from left to right, IgG control, paxillin, vinculin, and FAK) in H9c2 myoblasts using proximity ligation assay (PLA). (C-E) Immunoblot analyses of the interaction between BNIP-2 and FA proteins (left to right, paxillin, vinculin, and FAK) by co-immunoprecipitation (co-IP) in HEK293T cells. (F) Immunofluorescence images of actin, cardiac troponin T (cTnT) and DAPI in undifferentiated (Day 0) and differentiated (Day 3) H9c2 cells. Where indicated, cells were treated with 5 μM FAK inhibitor and 1 μM ATRA in low serum medium (1% FBS) for 3 days. (G) Immunofluorescence analysis of FA area in H9c2 myoblasts treated with 40 μm ROCK inhibitor (Y-27632) Scale bar, 10 μm. Quantification of FA area is shown (Bottom). Mean ± s.e.m., n = 3308 FAs from 20 cells (control) and 4928 FAs from 23 cells (Y-27632). Unpaired two-tailed Student’s t test; ****P < 0.0001. (H) Immunoblot analyses of cardiac troponin T (cTnT) and myosin light chain 2v (MYL2v) in differentiated H9c2 cells. Where indicated, cells were treated with 40 μM ROCK inhibitor (Y-27632) and 1 μM ATRA in low serum medium (1% FBS) for 3 days. Quantification of level of cTnT and MYL2v relative to Day 3 cells under control condition (Bottom). Mean ± s.e.m., n = 3 independent experiments. Unpaired two-tailed Student’s t test; *P < 0.05 and **P < 0.01.

With the knowledge that the level of FAK phosphorylation is linearly coupled to the stiffness of the substrate,20 we conjectured that inhibiting FAK would hinder cardiomyoblast differentiation since FAK is critical for force sensing and mechanotransduction at the FA. To address this hypothesis, we treated H9c2 cells with FAK inhibitor (FAKi) PF-573228 to suppress FAK activation at the Y397 autophosphorylation residue and monitored its effect on cardiomyoblast differentiation over a 3-day period. Unsurprisingly, FAKi resulted in reduced expression of cardiac biomarkers, including cardiac troponin T (cTnT) and cardiac Myosin Light Chain 2 (Myl2v), compared to untreated cells (Figure 1F, S1D). Rho-kinase inhibitor Y-27632 was then used to reduce force generation in H9c2 cells, resulting in a reduced FA size (Figure 1G) and impeding cardiomyoblast differentiation as denoted by the decreased levels of cTnT (Figure 1H). These results imply that Myl2-regulated cellular contractility and the Rho-ROCK pathway are crucial for cardiomyoblast differentiation. Interestingly, there was a notable increase in myl2v expression after Y-27632 treatment, suggestive of a possible feedback control mechanism to compensate for the loss of ROCK/myosin-based contractility, the mechanism of which awaits further investigation. Overall, these findings showed the importance of mechanosensing and cellular contractility for cardiomyoblast differentiation. As the FA complexes are force-bearing and force-generating sites of the cell, it is pertinent to investigate how BNIP-2 at the FA complex could affect FA dynamics and its nano-organization.

BNIP-2 Anchors FAK Localization at Integrin Signaling Layer

Within the FA, many molecular components stratify into a multilayered structure that is critical for mechanosensing and mechanotransduction within the cell.16 The SAIM is a high-resolution technique for the imaging of fluorescence proteins with nanometer precision along the optical axis.35−37 We performed SAIM to obtain precise measurements along the Z-axis of various FA components at the FA in H9c2 cells expressing shRNA targeting BNIP-2 (shBNIP-2) and nontargeting control (shControl). The knockdown efficiency of BNIP-2 and its isoforms by shRNA was validated by immunoblotting (Figure S2A). The representative map of the FA proteins relative to the surface of the imaging substrate in shControl and shBNIP-2 cells is shown in Figure 2A. Figure 2B illustrates the distribution of the median Z-position for different FA proteins, accompanied by the respective counts of cells and FA region of interest (ROIs) measured for each protein. The median Z-position of the given FA is stated beside the box plot.

Figure 2.

Figure 2

BNIP-2 facilitates FAK localization at the integrin signaling layer. (A) Topographic map of FA proteins with color-coded nanoscale Z-position of control and BNIP-2 knockdown H9c2 cells expressing fluorophore-tagged FA proteins. The color bar indicates the Z-position relative to the surface of the substrate. Scale bar, 10 μm (original) and 5 μm (zoomed). (B) Histogram and box plot of FA Z-positions. The median Z-position of each FA is indicated beside the box plot and represents the Z-center of individual FA region of interest (ROI) relative to the surface of the substrate. The number of ROIs and cells is labeled at the top of the plot. Data are presented as median ± interquartile.

Integrin-linked kinase (ILK) is used to demarcate the plasma membrane Z-position, and both the shControl and shBNIP-2 cells had similar Z-position (ZControl = 53.6 nm, and ZKD = 54.5 nm). With the exception of FAK (ZControl = 59.3 nm vs ZKD = 73.7 nm), we observed minimal to no significant changes in the relative Z-position of other FA components in BNIP-2 knockdown cells after accounting for the size of the FA components and fluorophore tags. FAK was observed to be at a significantly higher Z-position in the shBNIP-2 cells than shControl cells.

FAs are highly conserved multiprotein complex—the vertical distribution of each FA component is highly consistent regardless of the mean FA size and cell type. The knockdown of BNIP-2 causes FAK’s Z-position to displace toward paxillin instead of toward ILK suggested the unfavorable spatial constraints at the ISL. Talin, a component of FA within the force transduction layer, is a force-bearing protein which specifies the molecular geometry of the integrin-talin-actin module for force transmission.36 Yet, there is no prominent change in talin’s Z-position in BNIP-2 knockdown cells. Therefore, the depletion of BNIP-2 resulting in the displacement of Z-position of FAK suggested that BNIP-2 is not only involved in coordinating FA nano-organization at the ISL, but could also potentially mediate FA signaling through FAK. Since BNIP-2 is known to induce actomyosin-based intracellular contractility RhoA28 and intracellular contractility is intricately linked with focal adhesion activity and dynamics, we would like to further investigate how BNIP-2’s effect on FA nano-organization is associated with the FA number, size, dynamics, and cardiomyoblast differentiation.

BNIP-2 Regulates Cellular Contractility and Focal Adhesion Area for Cardiomyoblast Differentiation

We first performed knockdown of BNIP-2, with or without treatment of cells with FAKi, followed by initiation of differentiation. Importantly, with just BNIP-2 knockdown, the expression levels of cardiac differentiation markers cTnT and Myl2v decreased (Figure 3A). Further treatment of BNIP-2 knockdown cells with FAKi resulted in a further decrease in the cTnT and Myl2v expression levels. This result suggests that BNIP-2 knockdown phenocopies the effects of FAKi during cardiomyoblast differentiation, implying their convergent roles in supporting cardiomyoblast differentiation.

Figure 3.

Figure 3

BNIP-2 regulates cellular contractility and focal adhesion areas for cardiomyoblast differentiation. (A) Immunoblot analyses of BNIP-2, cardiac troponin-T (cTnT), ventricular myosin light chain-2 (MYL2v), FAK, and phosphorylated p-FAK Y397 in undifferentiated (Day 0) or differentiated (Day 3) under the control or BNIP-2 knockdown H9c2 cells (left panel). Where indicated, cells were treated with 5 μM FAK inhibitor and 1 μM ATRA in low serum medium (1% FBS) for 3 days. Level of cTnT and MYL2v relative to Day 3 cells under control condition (right). Mean ± s.e.m, n = 3 independent experiments. Unpaired two-tailed Student’s t test; *P < 0.05, **P < 0.01 and ***P < 0.001. (B) Representative image showing traction force measurements of H9c2 cells expressing siControl and siRNA targeting BNIP-2 and GFP-paxillin (left). The traction force is calculated from the displacements of fluorescent beads on the PDMS gel. Scale bar, 10 μm. (C) Quantification of traction forces per cell. Mean ± s.e.m., n = 26 (siControl) and 22 (siBNIP-2) cells. Morphometric analyses of (D) Total FA area per cell, (E) Mean individual FA area per cell, and (F) FA number per cell of H9c2 myoblasts. (C–F) Morphometric analysis of FAs, n = 34 (siControl) and 26 (siBNIP-2) cells. Median ± interquartile; Unpaired two-tailed Student’s t test; *P < 0.05, **P < 0.01 and ***P < 0.001. (G) Histogram of relative distribution frequency of FA sizes in control and BNIP-2 knockdown cells. (H) Polynomial linear fitting line of traction force and total area of FAs in siControl (blue) and siBNIP-2 (magenta) H9c2 cells. Each data point represents individual cells in four independent experiments. n = 19 (siControl) and 18 (siBNIP-2) cells.

To further delineate the role of BNIP-2 in mediating cellular contractility at the FAs, cells were cultured on a fibronectin-coated, elastically deformed substrate made from poly(dimethylsiloxane) (PDMS) with fluorescent beads. The displacement of the fluorescence beads was used to calculate the traction forces generated by cell contractility. The quantitative stress map generated based on the traction force exerted by the cells showed a marked reduction of traction force in BNIP-2 knockdown cells (Figure 3B–C). The efficiency of the siRNA targeting BNIP-2 and its isoforms was validated by immunoblotting (Figure S2B). Since FA size has been suggested to positively correlate with traction force,38,39 we have also obtained quantitative measurements of the FA size based on GFP-Paxillin signals. Although there were no significant differences in the total FA area per cell between the control and BNIP-2 knockdown cells (Figure 3D), morphometric analysis of FA showed that BNIP-2 depletion increased the mean individual FA area per cell while reducing the total number of FAs per cell (Figure 3E, F). Analysis of the distribution frequency of the individual FA area per cell also showed that BNIP-2 knockdown cells typically form larger FAs (Figure 3G). As cell area is a possible confounding factor of FA size,40 we also compared the cell size of control vs BNIP-2 knockdown cells and found no significant differences (Figure S2C-E).

To understand the correlation between mechanosensing and force transmission by BNIP-2, best-fit lines of total FA area per cell are plotted against traction force per cell using a linear regression model for siControl and BNIP-2 knockdown cells (Figure 3H). The gradient of the line denotes the expected change in traction force with per unit increase in the focal adhesion size. This value is used as an estimate to the cell’s focal adhesion sensitivity of mechanosensing capability. Although both siControl and BNIP-2 knockdown cells showed positive correlation between FA sizes per cell with traction force, the latter exhibited a less sensitive correlation toward traction force exerted with increasing total FA area per cell as compared to siControl cells. The difference in sensitivity between siControl and siBNIP-2 cells implied how the responsiveness of the FA has decreased due to the depletion of BNIP-2.

Summing up, these results illustrated the involvement of BNIP-2 in regulating FA area and numbers and the traction force of the cells, thus modulating the responsiveness of the FA for mechanosensing capability for force transmission. Interestingly, contrary to previous reports,38,39 the mean individual FA area of each cell does not positively correlate with the traction of each cell. However, it has been reported that FA is a poor predictor of force transmission in the absence of detailed understanding of FA dynamics.41 This prompted us to closely examine the effects of BNIP-2 on FA dynamics closely.

BNIP-2 Modulates Focal Adhesion Dynamics

In the canonical view of FA dynamics in migrating cells, nascent adhesion increases in size and develops into FA, and the mature FA will then undergo cycles of disassembly and reassembly.42 This precise spatiotemporal regulation of the FA dynamics is governed by a few mechanisms which include cytoskeletal dynamics and signaling pathways.43 However, as there is a lack of heterogeneity in most FA studies since most are conducted in motile cells or fibroblasts,15 the dynamicity of FA in nonmotile cardiomyoblasts is unknown. More importantly, since the traction force and FA numbers were decreased significantly in BNIP-2 knockdown cells (Figure 3B–F), it is imperative to understand the role of BNIP-2 lies in regulating FA dynamics. Using paxillin and vinculin as the markers for early and mature FAs formation, respectively, the assembly and disassembly rates of these proteins were tracked by performing live imaging of mApple-paxillin and mCherry-vinculin for 1 h at intervals of 1 min. The fluorescent intensities from the time-lapse movies were tabulated and fitted with a best-fit polynomial model to determine the phase lengths of assembly and disassembly (Figure 4A-C). Surprisingly, there was a reduction in paxillin assembly and disassembly rates and vinculin disassembly rates with BNIP-2 knockdown, despite no significant change in vinculin assembly rates. This observation calls for a closer look at the mobility of each FA component at the molecular level in greater detail.

Figure 4.

Figure 4

BNIP-2 modulates focal adhesion dynamics. (A) Time-lapse images of control and BNIP-2 knockdown H9c2 cells expressing mApple-paxillin. ROI 1 refers to the paxillin assembly at the FA and ROI 2 refers to the paxillin disassembly at the FA. Scale bar, 10 μm. (B) Calculation of FA assembly and disassembly rates in siRNA control and siRNA-targeting BNIP-2 H9c2 cells expressing mApple-paxillin (left) or mCherry-vinculin (right). (C) Quantitative analyses of assembly and disassembly rates of paxillin and vinculin (right). N = 3; Median ± interquartile; Unpaired two-tailed Student’s t test; **P < 0.01, ***P < 0.001, and ****P < 0.0001. FRAP-relative fluorescence intensity curves of control, BNIP-2-knockdown, and FAKi-treated H9c2 cells expressing (D) mApple-paxillin (left), (E) mCherry-vinculin (middle), and (F) mApple-FAK (right). The fluorescence intensity is normalized by the average prebleach intensity, mean ± s.d. The number of FRAP regions is presented (number of FAs {number of cells}).

Next, fluorescence recovery after photobleaching (FRAP) was performed to measure the mobility of fluorophore-tagged paxillin, vinculin, and FAK in BNIP-2 knockdown or FAKi treated cells to examine the recovery kinetics within the focal adhesion (Figure 4D-F, S3A-C). The recovery kinetics of paxillin [T1/2 (Control) = 6.9 s, and T1/2 (KD) = 4.0 s] (Figure 4D, S3B) and FAK [T1/2 (Control) = 8.2 s, and T1/2 (KD) = 3.4 s] (Figure 4E, S3B) were significantly faster in BNIP-2 knockdown cells. However, the recovery kinetic of vinculin was slower after BNIP-2 knockdown [T1/2 (Control) = 4.3 s, and T1/2 (KD) = 6.5 s] (Figures 4F, Figure S3B). Although BNIP-2 knockdown cells showed decreased paxillin [Immobile fraction (Control) = 0.53, Immobile fraction (KD) = 0.36] (Figure 4D, Figure S3C) and FAK [Immobile fraction (Control) = 0.19, Immobile fraction (KD) = 0.17] (Figure 4E, Figure S3C) immobile fractions, the changes in the FAK immobile fraction are minimal. Vinculin, on the other hand, showed increased immobile fraction with BNIP-2 knockdown [Immobile fraction (Control) = 0.36, Immobile fraction (KD) = 0.40], exhibiting an opposite trend from paxillin and FAK (Figure 4F, Figure S3C). Interestingly, although paxillin and vinculin are protein markers of focal adhesions, they exhibited distinctively different kinetics. The differential dynamics of FA proteins suggested that BNIP-2 affects the dynamics of nonforce dependent components in the ISL layer of FAs (paxillin and FAK) and is necessary for paxillin stability. As vinculin recruitment to the focal adhesion is force-dependent,17,44 the reduced vinculin turnover in BNIP-2 knockdown conditions could be due to a decrease in cellular contractile force. FAK is a regulator of integrin-mediated cell adhesions where its inhibition is reported to enlarge FA areas and slow down FA disassembly.45,46 The effects of BNIP-2 knockdown on the recovery kinetics and immobile fractions of paxillin, vinculin, and FAK phenocopied that of FAKi (Figure 4D-F, S3B,C). FAKi had no further impact on the effects brought about by BNIP-2 knockdown, suggesting that depletion of BNIP-2 has an impact similar impact as FAKi.

Although both time-lapse assays of the FA assembly/disassembly rates and FRAP assays seem to contradict each other, they describe the global and local dynamics of FA respectively. The FA time-lapse assay studies the rates of assembly and disassembly of the FA by taking into account the net influx and/or emission of FA-based components to provide spatiotemporal insights into the FA structures. On the other hand, the FRAP assay measures the mobility of FA-based components at the molecular level and the cell’s ability to recover the FA-based components at the FA structures after photobleaching by considering various kinetic properties such as diffusion coefficient, mobile fraction, and T1/2. FRAP assay alone does not show the exact molecular interaction between paxillin and BNIP-2, but supplementation of the FA time-lapse assay alongside the FRAP assay strongly suggests that reduced levels of BNIP-2 affect its interaction with FA components and correlates with changes in FA component kinetics leading to an increase in FA area but a decrease in FA numbers. With a lesser number of FAs, H9c2 cells with BNIP-2 knockdown have less force-bearing anchor points to transmit forces to its adhered substrate as depicted by reduction of traction forces for siBNIP-2 H9c2 cells.

BNIP-2 Is a Mechanotransducer at the Focal Adhesion by Scaffolding FA Complex

Activation of FAK phosphorylates paxillin, promoting the dynamics and translocation of FA proteins.47,48 Since we have shown BNIP-2 affects cellular contractility (Figure 3B) and FA protein dynamics (Figure 4), we hypothesize that BNIP-2 promotes force transmission by activating the FAK-paxillin signaling pathway. BNIP-2 knockdown cells showed a marked reduction in p-FAK Y397 (activation marker) and p-paxillin Y118, but with little or no significant changes in the level of phosphorylated vinculin (Figure 5A, Figure S4A). Notably, the expression level of total paxillin was also lower in BNIP-2 knockdown cells than in siControl cells, implying that the depletion of BNIP-2 may reduce paxillin stability. Tyrosine phosphorylation of vinculin at Y822 is crucial for cell–cell mechanotransduction,49 and it could modulate ligand binding to control focal adhesion morphology in cancer cells.50 There is no significant change in the level of p-vinculin Y822, indicating that BNIP-2’s specificity in modulating vinculin is only at the FA.

Figure 5.

Figure 5

BNIP-2 scaffolds FA machinery for mechanotransduction. (A) Immunoblot analyses of BNIP-2, FAK, paxillin, vinculin, phosphorylated p-FAK Y397, p-paxillin Y118, and p-vinculin Y822 in shControl and shBNIP-2 cells treated with FAKi H9c2 cells (left). The expression level of each given protein is relative to untreated shControl cells (middle). Level of phosphorylation of each given protein relative to untreated shControl cells (right). The phosphorylated level was normalized to the total protein expression of each given protein. Mean ± s.e.m., n = 3 independent experiments. Unpaired two-tailed Student’s t test; *P < 0.05, **P < 0.01, and ***P < 0.001. (B, C) Knockdown of BNIP-2 reduces the interactions between (B) paxillin and FAK/ (C) paxillin and vinculin in HEK293T cells expressing GFP-tagged paxillin and FLAG-tagged FAK or mCherry-vinculin. Immunoprecipitation and immunoblot detection of FAK or vinculin with anti-GFP-trap magnetic agarose beads are shown. GFP vector is used as a control for unspecific binding by the anti-GFP-trap magnetic beads. (D) Immunoblot analyses of FAK, phosphorylated p-FAK Y397, paxillin, phosphorylated p-paxillin Y118, and GFP in H9c2 myoblasts expressing increasing concentration of GFP-BNIP-2-cBCH. Anti-GFP blot denotes the expression of GFP-BNIP-2-cBCH. (E) Schematic diagram of BNIP-2 acting as a scaffold for FAK, paxillin, and vinculin in wildtype (top) and in the absence of BNIP-2 (bottom). (F) Immunoprecipitation analyses of the interaction between GFP-BNIP-2 and FAK mutants (mApple-FAK Y397D – constitutive active and mApple-FAK Y397F – dominant negative) in HEK 293T cells. GFP vector is used as a control for unspecific binding by the anti-GFP-trap magnetic beads. Immunoprecipitation blot probed using anti-FAK antibody indicates the interaction between BNIP- 2 and FAK mutants. (G) Immunoblot analyses of BNIP-2, FAK, paxillin, phosphorylated p-paxillin Y118, myosin light chain (MLC), and phosphorylated p-MLC T18/S19 in H9c2 myoblasts. Where indicated, cells are either singly and doubly transfected with siControl, siRNA-targeted BNIP-2, FLAG-FAK, and FLAG-FAK Y397D.

As Src, a nonreceptor protein tyrosine kinase enzyme, is an upstream regulator of FAK that forms a complex with p-FAK Y397 and facilitates FAK phosphorylation at Y925 to promote cell motility, growth, and survival,51 we wondered if the observed effects of BNIP-2 knockdown would involve modulation of Src activities. Our results showed that neither BNIP-2 knockdown nor FAKi treatment significantly affects the expression of Src and the status of its phosphorylated and activated form p-Src Y416 (Figure S4B).

We have shown that BCH family of proteins function as scaffold proteins for small GTPases, kinases and metabolic enzymes.25,28,52,53 Since the depletion of BNIP-2 resulted in decreased paxillin phosphorylation (Figure 5A), we hypothesized that the molecular scaffold protein BNIP-2 is the regulator that mediates the interaction and phosphorylation of paxillin by FAK. To verify this, we performed a co-immunoprecipitation between Flag-tagged FAK and GFP-tagged paxillin in stable BNIP-2 knockdown HEK293T cells. As shown in Figure 5B, there was a decrease in the Flag-FAK pulled down by GFP-paxillin in BNIP-2 knockdown cells compared with siControl cells (as denoted by the lighter band intensity in the blot in the presence of shBNIP-2). Similarly, BNIP-2 knockdown also reduced paxillin and vinculin interactions (Figure 5C).

The critical concentration of scaffold protein is crucial for its binding proteins to interact optimally—too little of them can result in reduced scaffolding activities while too much in excess will competitively prevent the individual target proteins from coming together.25,28,52 Since BNIP-2 was able to affect FAK-paxillin and paxillin-vinculin interactions, we sought to understand if the scaffolding behavior of BNIP-2 contributed to the modulation of the FA protein activation and phosphorylation. We transfected GFP-BNIP-2-cBCH, the construct devoid of the BNIP-2 N-terminus, in a dose-dependent manner to investigate changes in protein activation status. The initial increase in the cBCH domain resulted in the increase in FAK and paxillin phosphorylation. However, when the concentration of cBCH domain surpassed the critical level, phosphorylation levels of both FAK and paxillin began to decrease (Figure 5D, S4C).

Previously, the FRAP analyses showed a slower vinculin turnover rate with increased immobile fraction with BNIP-2 knockdown. This decrease in vinculin turnover could be due to the decrease in p-paxillin Y118 which is crucial for the recruitment of vinculin to the FA in a force-dependent manner.17 However, it was unknown how vinculin interacts with paxillin and whether this interaction is direct as vinculin lacks PY-binding SH2 domains necessary for direct binding between vinculin and paxillin.44 The decrease in traction force and the lack of interaction between paxillin and vinculin due to depletion of BNIP-2, suggests that BNIP-2 could also modulate the interaction between them and is crucial for the recruitment of vinculin to the FA. Nonetheless, we demonstrate that BNIP-2 facilitates the activation of FA signaling by acting as a scaffold protein for FAK, paxillin, and vinculin (Figure 5E). Next, we would like to investigate further on how scaffolding of FAK and paxillin by BNIP-2 facilitates paxillin activation.

BNIP-2-BCH and FAK-FERM Domains Are Required for BNIP-2-FAK-Paxillin Signaling

To investigate further the interaction between FAK and BNIP-2, co-immunoprecipitations of BNIP-2 and phosphorylation mutants of FAK, dominant negative (DN) FAK Y397F and constitutively active (CA) FAK Y397D were performed. BNIP-2 has the strongest interaction with CA FAK (FAK Y397D) compared to the wildtype FAK and DN FAK (FAK Y397F) which has the least interaction (Figure 5F). This result suggests that BNIP-2 preferentially binds to activated FAK. To understand the downstream effects of BNIP-2 interactions with CA FAK (Y397D), we performed immunoblot analysis with the overexpression of CA FAK (Y397D) with BNIP-2 knockdown. Notably, overexpression of CA FAK (Y397D) restored phosphorylated p-paxillin Y118 signals that were decreased in BNIP-2 knockdown cells overexpressing WT FAK (Figure 5G). As we have previously shown that BNIP-2 regulates cell contractility (Figure 3B,C), we went on to probe for cellular contractility by using myosin light chain (MLC) and its phosphorylation (MLC-T18/S19).54 Expectedly, overexpressing CA FAK (Y397D) in BNIP-2 knockdown cells restored pMLC levels (Figure 5G). This result consistently supports the notion that FAK/paxillin/MLC activation occurs downstream of BNIP-2.

Next, we sought to understand which domain(s) of FAK and BNIP-2 are essential for their interaction. FAK consists of a FERM domain at the N-terminal, a central catalytic kinase domain, and a focal adhesion targeting (FAT) domain at the C-terminal.55 Both full-length FAK and FAK-FERM domains (with the linker between FERM and kinase domain) were pulled down by GFP-BNIP-2 (Figure S5A), indicating that FAK interacts with BNIP-2 through its FERM domain. We also investigated the domain of BNIP-2 that mediates the interaction with FAK. The BNIP-2 full-length construct is truncated into BNIP-2-cBCH, containing the BCH domain, and BNIP-2 Nter, containing the N-terminal domain (Figure S5B). Only the full-length and BNIP-2-cBCH constructs were able to interact with FAK. Therefore, the FAK-BNIP-2 interaction is mediated by the interaction of BNIP-2-BCH and FAK-FERM domains.

Looking into the FAK-paxillin signaling axis, BNIP-2 knockdown phenocopies the effects of FAKi treatment, as denoted by the decrease in both p-FAK Y397 and p-paxillin Y118 levels. Based on the FRAP analysis combined with further molecular works through co-immunoprecipitation, we have delineated the role of BNIP-2 as a molecular scaffold between FAK and paxillin to mediate the FAK-paxillin signaling pathway. Overexpression of CA FAK in siBNIP-2 cells resulted in p-MLC signals, and BNIP-2’s preferential binding to CA FAK over KD FAK suggests that BNIP-2 functions upstream of FAK.

BNIP-2 Initiates Differentiation of hESC to Cardiomyocytes

The emergence of human embryonic stem cell-derived cardiomyocytes (hESC-CM) is a significant breakthrough in clinical solutions for large-scale cardiomyocyte transplantation and treatments.56 We employed human embryonic stem cells (hESC) to extend our findings under a physiological context and to draw translational relevance. We first generated BNIP-2 knockout hESC using the LentiCRISPR backbone. Subsequently, we performed differentiation of nontargeting control (NTC) vs BNIP-2 knockout (KO) hESC using well-established protocols.57 The RNA and total protein lysates of NTC and BNIP-2 KO hESCs were collected on day 0, day 3, day 7 and day 14 of differentiation (Figure 6A). We then performed RNA sequencing on the RNA samples that were collected.

Figure 6.

Figure 6

BNIP-2 initiates differentiation of hESC to cardiomyocytes. (A) Schematic of hESC differentiation to cardiomyocytes. (B) Heatmap of focal adhesion genes (PTK2, PXN, and VCL) and cardiomyocyte differentiation markers for Days 0, 3, 7 and, 14 in nontargeting control (NTC) and CRISPR-targeted BNIP-2 knockout hESCs differentiated for Days 0, 3, 7, and 14. FPKM was used for z-score normalization. (C) RT-PCR was performed as validation for RNA sequencing results. RT-PCR assessment of BNIP2 (BNIP-2), TNNT2 (cTnT), VCL (vinculin), PTK2 (FAK), and PXN (paxillin) mRNA levels). Median ± s.e.m, Unpaired two-tailed Student’s t test; *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001. n = 3 independent experiments. Each data point represents an individual measurement. (D) Immunoblot analyses of BNIP-2, cTnT, FAK, paxillin, phosphorylated p-FAK Y397 and p-paxillin Y118 in nontargeting control (NTC) and CRISPR-targeted BNIP-2 KO -1 and -2 hESC induced to differerntiate for days 0, 3, 7, and 14. (E) Expression level of each given protein is relative to NTC. Median ± s.e.m., Unpaired two-tailed Student’s t test; *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001. N = 3 independent experiments.

Principle Component Analysis (PCA) was performed on the samples to assess the similarity in gene profiles across different conditions (Figure S6A). Compared to the NTC, BNIP-2 KO cells showed lower mRNA levels of cardiac markers MYL2 and TNNT2, as well as cardiac progenitor cell markers TBX5 and NKX2-5 as early as 7 days of differentiation (Figure 6B), confirming that BNIP-2 knockout impedes hESC-CM differentiation. Interestingly, the mRNA expression levels of VCL, PTK2 and PXN (which encodes for vinculin, FAK, and paxillin, respectively) increased in BNIP-2 knockout cells (Figure 6B). We also validated this observation using quantitative real-time PCR (Figure 6C). The KEGG pathway enrichment analysis of Day 7 differentially expressed genes between NTC and BNIP-2 knockout hESCs, further indicating the enrichment of the FA pathway and other pathways crucial to cell proliferation, cellular senescence, cardiomyocytes contraction, and ECM-receptor interaction (Figure S6B). This result suggests that BNIP-2’s effect on the mechanobiology of FA sensing could affect multiple downstream cellular processes as part of the regime in hESC-CM differentiation.

Since BNIP-2 knockout impedes hESC-CM differentiation (Figure 6B), we examined the cell stage prior to Day 14 of cardiomyoblast differentiation. At day 5 of differentiation, the hESC cells exhibited multipotency by differentiating into cardiomyocytes, cardiac smooth muscle cells, or endothelial cells.58,59 Interestingly, after 7 days, several markers for endothelial cells such as CDH5 and PECAM1, and for cardiac smooth muscle cells, including TAGLN and ACTA2,60 were upregulated in BNIP-2 knockout cells (Figure S6C). These results show that BNIP-2 plays a crucial role in hESC commitment toward cardiac progenitor cells’ and cardiomyocytes’ lineage.

To validate the RNA expression at the protein levels, we performed immunoblot on hESC-CM. As shown in Figures 6D,E, BNIP-2 KO impeded the induction of the cardiac gene and the expression of cTnT up to day 14 (Figure S4D). Akin to the findings in H9c2 cells (Figure 5A, S4A), the FAK/paxillin signaling was suppressed up to day 3 of differentiation in BNIP-2-KO hESCs, as shown by barely detectable levels of paxillin, phosphorylated p-FAK Y397, and phosphorylated p-paxillin Y118 in BNIP-2 knockout hESCs. All in all, these results showed that BNIP-2 serves as an important driver of hESC differentiation by promoting FA signaling, directing the cardiac progenitor cells to differentiate into cardiomyocytes.

YAP is known to promote embryonic and adult cardiomyocytes’ proliferation.61 YAP sequestered by NF2 at the adherens junction can drive mesendoderm specification in hESC.62 We have also previously reported that BNIP-2 promotes YAP cytoplasmic localization in H9c2 cardiomyoblast differentiation through scaffolding LATS1 and YAP.25 Additionally, Holland et al. showed that disruption of FA components FAK, vinculin, and talin resulted in decreased YAP nuclear localization and transcriptional activity.63 As our RNA sequencing analysis showed an increase of other cell type markers in BNIP-2 KO hESC, it is plausible that modulation of YAP localization through FA and BNIP-2 is crucial for driving other stem cell lineages. Alternatively, BNIP-2 is a molecular scaffolding protein functioning as a molecular switch between proliferation and differentiation, through regulating FA and YAP signaling, something worthy to study in the future.

In summary, BNIP-2 regulates the force transmission that is crucial for cardiomyoblast differentiation in H9c2 and hESC cells via the FAK-Paxillin signaling axis. Functionally, BNIP-2 serves as a signaling scaffold of FA proteins FAK by coordinating the Z position placement of FAK at the FA nanoscale architecture and is necessary for its activation of paxillin (Figure 7). Depletion of BNIP-2 is associated with increased FA size, decreased FA numbers and mobility, and reduced cell contractility, leading to a loss of cardiomyoblast differentiation.

Figure 7.

Figure 7

Schematic model of BNIP-2 scaffolding FAK to promote cardiomyoblast differentiation. BNIP-2 interacts with FAK through its BCH domain to regulate FAK/paxillin signaling and facilitate mechanotransduction. BNIP-2 acts as a scaffold for FAK/paxillin and paxillin/vinculin interactions. Knockdown of BNIP-2 resulted in larger FAs, reduced FA dynamics, and lower contractility in H9c2 cells. We propose that BNIP-2 coordinates the integration of FAK, paxillin, and vinculin at FAs and the local spatial distribution of FAK, leading to the activation of FAK on paxillin signaling to ensure downstream force transmission, thus initiating H9c2 and hESC cardiomyoblast differentiation.

3. Conclusion

Although many reports have shown how substrate stiffness affects cardiomyoblast differentiation, how cardiac progenitor cells sense and regulate downstream signaling pathways and activate transcription factors to drive cardiomyoblast differentiation remains elusive. To address this gap, we employed a multipronged approach comprising bioimaging, biophysical, genetic, and biochemical assays to unveil the underlying mechanism of mechanosensing and mechanotransduction to modulate cardiomyoblast differentiation.

By using both H9c2 and hESC models, we have uncovered a novel mechanotransduction hub at the FAs that drives cardiomyoblast differentiation via a BCH domain-containing scaffold protein, BNIP-2. More specifically, we found that BNIP-2 coordinates FA signaling and dynamics in several ways. Through SAIM, we found that BNIP-2 regulates FA nanoarchitecture at the integrin signaling layer centered aroundFAK. Traction force microscopy and morphometrics analyses of FA showed that BNIP-2 regulates cellular contractility and FA densities per cell, and further analysis showed that BNIP-2 modulates the mechanosensing sensitivity of FA. By correlating the FA time-lapse imaging and FRAP analysis studies with previous findings, we affirmed that BNIP-2 affects mechanosensing and mechanotransduction by regulating the spatial organization of key force-sensing and force-bearing points and their protein dynamics to transmit forces to downstream substrates. Further biochemical analysis showed that FAK phenocopies BNIP-2, suggesting that FAK lies downstream of BNIP-2 within the FAK/paxillin signaling axis. More importantly, the co-immunoprecipitation analyses showed that BNIP-2, particularly the BCH domain, serves as a molecular scaffold to bridge paxillin and FAK, and between paxillin and vinculin. This novel mechanism will offer new motivation to advance our future understanding of cardiac mechanotransduction and costamere-related signaling for potential translational applications.

4. Materials and Methods

4.1. Cell Culture and Transfection

H9c2 myoblasts (ATCC) were cultured in Dulbecco’s modified Eagle’s media (DMEM, Hyclone) supplemented with 10% fetal bovine serum (FBS, Gibco), 1% penicillin-streptomycin (Hyclone), and 1 mM sodium pyruvate (Gibco). To differentiate H9c2 myoblasts, cells were cultured in differentiation media comprising DMEM media supplemented with 1% fetal bovine serum (FBS, Gibco), 1% penicillin-streptomycin (Hyclone), 1 mM sodium pyruvate (Gibco), and 1 μM all-trans retinoic acid (ATRA, Sigma-Aldrich). HEK293T cells were cultured in RPMI 1640 medium (Hyclone) supplemented with 10% FBS (Gibco), 10 mM HEPES, and 1% penicillin-streptomycin (Hyclone). All cells were grown at 37 °C with 5% CO2. All cells were tested negative for mycoplasma. Cells were transfected with jetPRIME (Polyplus-transfection) according to the manufacturer’s instructions. The plasmids or siRNA were mixed with the jetPRIME reagents in 1:2 or 1:1 ratio, respectively.

4.2. Pharmacological Treatments

To induce differentiation, cells were cultured with differentiation media supplemented with 1 μM ATRA. Differentiation media supplemented with ATRA is replaced daily throughout the course of differentiation. For FAKi treatment, cells were treated with the 5 μM FAK inhibitor PF-573228 (Sigma-Aldrich). For ROCK inhibitor treatment, cells were treated with 40 μM ROCK inhibitor Y-27632 (Sigma-Aldrich).

4.3. Plasmid and siRNA Transfection

FLAG-, HA-, and GFP-tagged pXJ40 vectors (gifts from E. Manser, Institute for Molecular and Cell Biology, Singapore) encoding for full length human BNIP-2 were used for overexpression studies.24 BNIP-2 plasmid template was used to generate BNIP-2 truncation constructs (BNIP-2-cBCHand BNIP-2-N-terminus). Paxillin, FAK and Vinculin tagged with mApple or mCherry were from the Davidson collection (Kanchanawong laboratory, MBI). High-fidelity DNA polymerase PfuUltra II (Stratagene) was used for site-directed mutagenesis. Constructs were sequenced to confirm the sequence fidelity.

The siRNA sequences targeting rat BNIP-2 were purchased from Dharmacon (siBNIP-2–1:5′-CGUUAGAAGUUAAUGGAAAUU-3′; siBNIP-2–2:5′-GGAUGAAGGUGGAGAAGUUUU-3′). The specificity of the sequences was verified by RT-PCR for RNA interference efficiency and Western blotting. Both sequences showed 70 to 80% suppression efficiency on BNIP-2. siBNIP-2-1 was used for subsequent experiments.

4.4. Generation of Knockdown Stable Cell Line

For generation of BNIP-2 knockdown cells, BNIP-2 targeting sequences were cloned into pGFP-V-RS vectors (OriGene). The rat BNIP-2 targeting sequence (shBNIP-2:5′- GGAAGGTGTGGAACTGAAAGA-3′) was purchased from Integrated DNA Technologies (IDT) and transfected into H9c2 cells. Twenty-four hours after transfection, cell growth medium was changed to puromycin-containing medium. Cells were selected for single clones and tested for knockdown efficiency by Western blot analysis. HEK293T BNIP-2 knockdown stable cells were generated as described.28 Western blotting was performed for measuring the knockdown efficiency.

4.5. Human Embryonic Stem Cell Differentiation Assays

H1 human embryonic stem-cell (H1-hESC) line was maintained in mTeSR1 medium (STEMCELL Technologies) under 5% CO2 at 37 °C and cultured when the confluency reaches 80%. Culture vessels were coated Geltrex (ThermoFisher Scientific, catalog #: A1413202) for 30 min prior to seeding of cells.

The cardiomyocyte differentiation GiWi protocol (GSK3/Wnt inhibitor) with RPMI differentiation medium was adopted as previously described.57 Briefly, 2 days before the induction of differentiation, cells were detached from the culture vessel with Accutase (Invitrogen) at 37 °C for 5 min and resuspended in media supplemented with 10 μM ROCK inhibitor Y27632 (STEMCELL Technologies). Cells were then seeded onto the Geltrex-coated plates (12-well) with a density of 200,000 cells/cm2. The medium was replaced by the culture medium (without ROCK inhibitor) 24 h after cell seeding. On Day 0 of differentiation, media were replaced with fresh RPMI/B27 without insulin (Gibco) supplemented with 8 μM CHIR99021 (STEMCELL Technologies, catalog #: 72054). On Day 1, fresh RPMI/B27 media without insulin was replaced after 24 h. On Day 3, 10 mM IWP2 (catalog #: I0536, Sigma-Aldrich) was added to conditioned media and fresh media (RPMI/B27 without insulin). On Day 5, fresh media (RPMI/B27 without insulin) were added without the Wnt inhibitor. Cells were then maintained in RPMI/B27 with insulin (catalog #: 17504044, Gibco) from day 7 onward and refreshed every 3 days throughout the course of differentiation.

4.6. Lenti-hESC CRISPR-Targeted Knockout Production and Transduction

To design sgRNAs, the NGG PAM sites targeting exon 1, 3, and 4 of the BNIP-2 gene loci were identified for designing sgRNAs using a web browser-based program (http://crispor.tefor.net/) as described previously.64 The “Rule set 2” scoring model was used for prioritizing top sgRNA candidates:65

  • Non_Targeting_sgRNA1:5′-AAAACAGGACGATGTGCGGC-3′;

  • Non_Targeting_sgRNA2:5′-AACGTGCTGACGATGCGGGC-3′;

  • BNIP2_sgRNA1 (Exon 3): 5′-ACTAGCTATAACTGGACCAG-3′;

  • BNIP2_sgRNA3 (Exon 1): 5′-GATAACATCCCGACCTCCTC-3′;

  • BNIP2_sgRNA2 (Exon 4): 5′-GACAATACAGAGCCATCACT-3′;

  • BNIP2_sgRNA4 (Exon 1): 5′-GGTCTCCACCGCCGACCGAG-3′.

The annealed sgRNA constructs were cloned into the Esp31-digested LentiCRISPR v2 backbone (Addgene no. 52961) using T4 DNA ligase (catalog #: M0202, New England Biolabs, NEB). Non_Targeting_sgRNA1 and Non_Targeting_sgRNA2 were used for generating control hESC stable cell generation (NTC); BNIP-2_sgRNA1/BNIP-2_sgRNA3 and BNIP-2_sgRNA2/BNIP-2_sgRNA4) were used for generating BNIP-2 knockdown hESC KO-1 and KO-2.

To generate virus containing sgRNA constructs, HEK293T cells cultured on 10 cm dish in DMEM supplemented with 10% FBS were cotransfected with 10 μg of sgRNA plasmid construct, 7.5 μg of pMDLg/pRRE, 2.5 μg of pRSV-Rev, and 2.5 μg pMD2.G (Addgene #12251, #12253, and #12259) using 50 μL of PEI and 3 mL of Opti-MEM I Reduced Serum Medium (catalog #31985070, ThermoFisher Scientific). Cells were transfected when they reached 70% confluence. After overnight incubation, the medium was changed to DMEM supplemented with 5% FBS. The supernatant was collected and filtered twice after 24 and 48 h, and then concentrated using Lenti-Pac Lentivirus Concentration Solution (catalog #: LPR-LCS-01, GeneCopoeia) before transduction. The hESC cell culture medium was supplemented with 8 μg/mL Polybrene to increase the transduction efficiency. Cells were selected by supplementing 1 μg/mL Puromycin (Sigma catalog #: P9620) into the medium for 2 days and subcultured for at least 5 days prior to cardiomyocyte differentiation.

4.7. Antibodies

The following primary antibodies have been used in this work: rabbit anti-BNIP2 polyclonal (catalog no. HPA026843, RRID:AB_1845403), rabbit anti-vinculin polyclonal (catalog no. V4139, RRID:AB_262053), rabbit anti-phospho-vinculin polyclonal (Tyr822) (catalog no. V4889, RRID:AB_477624), and mouse anti-vinculin monoclonal (catalog no. V9131, RRID:AB_477629) from Sigma-Aldrich; rabbit anti-BNIP2 polyclonal (catalog no. GTX114283, RRID:AB_11177115) from GeneTex; mouse anti-GAPDH (anti–glyceraldehyde-3-phosphate dehydrogenase) monoclonal (catalog no. sc-47724, RRID:AB_627678), mouse anti-cardiac troponin T (cTnT) monoclonal (catalog no. sc-20025, RRID:AB_628403), and mouse IgG (catalog no. sc-2025, RRID:AB_737182) from Santa Cruz Biotechnology; rabbit anti-myosin light chain 2v (D5l1C) monoclonal (catalog no. 12975, RRID:AB_2798075), rabbit anti-myosin light chain 2 polyclonal (catalog no. 3672, RRID:AB_10692513), rabbit anti-phospho-myosin light chain 2 (Thr18/Ser19) polyclonal (catalog no. 3674, RRID:AB_2147464), rabbit anti-src polyclonal (catalog no. 2108, RRID:AB_331137), rabbit anti-phospho-src (Tyr416) polyclonal (catalog no. 2101, RRID:AB_331697), rabbit anti-FAK polyclonal (catalog no. 3285, RRID:AB_2269034), rabbit anti-phospho-FAK (Tyr397) polyclonal (catalog no. 3283, RRID:AB_2173659), rabbit anti-phospho-FAK (Tyr925) polyclonal (catalog no. 3284, RRID:AB_10831810), rabbit anti-paxillin polyclonal (catalog no. 2542, RRID:AB_10693603), and rabbit anti-phospho-paxillin (Tyr118) polyclonal (catalog no. 2541, RRID:AB_2174466) from Cell Signaling Technology; mouse anti-FAK monoclonal (catalog no. 610088, RRID:AB_397495), and mouse anti-paxillin monoclonal (catalog no. 610052, RRID:AB_397464) from BD Biosciences; rabbit anti-GFP polyclonal (catalog no. A-11122 (also A11122), RRID:AB_221569) were obtained from Life Technologies (Invitrogen).

4.8. Immunofluorescence

Cells were fixed with prewarmed 4% paraformaldehyde in PBS for 15 min at 37 °C. After fixation, the cells were washed thrice with 1× PBS for 5 min at room temperature. Samples were permeabilized with blocking buffer comprising 3% bovine serum albumin and 0.1% Triton X-100 in 1× PBS for 30 min at room temperature. Next, cells were incubated with respective primary antibodies for 1 h at room temperature. The primary antibodies were diluted in an appropriate ratio in blocking solution as shown in the antibodies section. After primary antibody incubation, cells were washed thrice with 1× PBS. For secondary antibody staining, cells were incubated in Alexa Fluor conjugated secondary antibodies for 30 min in the dark at room temperature. Cells were washed three times with 1× PBS before image acquisition.

4.9. Traction Force Microscopy (TFM)

The substrates used for TFM are prepared and codes used for analysis are as previously described.66 Briefly, the substrate of the plate was made by spin coating 15 kPa PDMS on a glass-bottom dish. The dish was salinized with 5% APTES, coated with dark red fluorescent beads (catalog: #F8807, ThermoFisher Scientific). The plate was washed with distilled water, passivated with 100 mM Tris, pH 7.4 (first base), and coated with 10 μg/mL fibronectin. Cells are seeded and incubated overnight at 37 °C prior to image acquisition. Cells and beads were imaged using a Yokogawa CSU-W1 Spinning Disk microscope (Nikon). After that, 10% SDS (1stbase) was added to the substrate for 1 h to lyse the cells and reversed the substrate deformation. To quantify focal adhesion size, GFP-paxillin transfection of H9c2 cells was performed and imaged. OriginPro 2019b (OriginLab) was used for generating the linear fitting curve.

4.10. Confocal and Super-Resolution Microscopy

Confocal images were acquired using a Yokogawa CSU-W1 Spinning Disk microscope (Nikon) equipped with a 60× 1.20 NA water immersion objective or 100× 1.45 NA oil immersion objective. Super- resolution imaging was performed using a Yokogawa CSU-W1 Spinning Disk microscope equipped with a LiveSR module and 100X liveSR (oil immersion objective).

4.11. Focal Adhesion Morphometrics and Quantification

Focal adhesion quantification was carried out in ImageJ and MATLAB. “Subtract background” was applied with the rolling ball radius set to 50 pixels, followed by contrast enhancement and the Gaussian blur with a sigma of 0.5. Particles with an area of between 0.1 and 25 μm2 were considered and segmented for further analysis. The area of each focal adhesion was recorded as a region of interest (ROI) in ImageJ, and the number and total area of focal adhesions per cell were calculated by using MATLAB.

4.12. Fluorescence Recovery after Photobleaching (FRAP)

FRAP images were acquired on an Olympus IX81 inverted microscope (iLAS2 module) equipped with a 100× 1.49 NA oil immersion objective under Total Internal Reflection Fluorescence (TIRF) mode. FRAP experiments were performed at 37 °C with 5% CO2. H9c2 cells expressing mApple-paxillin, mApple-FAK, or mCherry-vinculin were seeded on 27 mm glass-bottom dishes and incubated overnight before the FRAP experiments. The photobleaching setting was set up as 5 s at 1-s intervals for prephotobleaching imaging, 600 ms for photobleaching, and 60 s at 500 ms intervals for postbleach imaging. For FAKi treatment, cells were incubated for 1 h in the culture medium supplemented with 5 μM FAK inhibitor PF-573228 (Sigma-Aldrich) before FRAP experiments.

4.13. Quantitative Analyses of FRAP

Region of interest (ROIs) of the unbleached area of focal adhesions for bleach-control, empty area for background measurements, and bleached area of focal adhesions were manually selected on images for focal adhesion turnover quantification. The integrated intensity of each ROI was measured in ImageJ, followed by background/photobleaching correction by applying eq 1:

4.13. 1

where IFRAP is the integrated intensity of each FRAP ROI, IBackground and IUnbleach were the integrated intensities of background ROI and bleach correction ROI (unbleached ROI), and IBackground and AFRAP were the area of the background ROI and bleach correction ROI respectively.

FRAP intensities data were normalized relative to the average prebleach fluorescence intensity of each image. Data fitting was performed to acquire the half-life time T1/2 via MATLAB using eq 2

4.13. 2

where I is the normalized intensity during the FRAP recovery, I0 is the normalized end-value of recovered intensity (mobile fraction), and t is the time post bleaching.

4.14. Calculation of Focal Adhesion Assembly and Disassembly Rates

Live imaging was acquired using confocal microscopy (60× objective) as described in the confocal microscopy method. H9c2 cells expressing shRNA and mApple-paxillin/mCherry-vinculin were seeded on 27 mm glass-bottom dishes for 24 h before imaging. Images were acquired at 37 °C with 5% CO2 for 1 h at 1 min intervals. Focal adhesions were manually tracked frame by frame in ImageJ, where the integrated intensity was measured. Intensities of each time-lapse image were normalized in MATLAB, followed by data fitting with a polynomial model of degree 5 to determine the phase lengths of assembly and disassembly. Data points in each phase were then processed with the linear fitting model (y-ax + b) to calculate the rates in the time series.

4.15. Scanning Angle Interference Microscopy (SAIM)

Scanning angle interference microscopy was performed for determining the protein position in the z-axis as previously described.35,37 Cells were seeded on silicon wafer (Bonda Technology) containing a layer of thermal SiO2 (∼500 nm) coated with 10 μg/mL of fibronectin (catalogue FC010, Sigma-Aldrich). Following cell seeding, cells were then transfected with focal adhesion proteins tagged with mApple or mCherry for 24 h before fixation. Cells were fixed by prewarmed 4% paraformaldehyde for 15 min at 37 °C and washed with 1× PHEM buffer three times (2 mM MgSO4, 10 mM EGTA, 25 mM HEPES, and 60 mM PIPES; pH 7.0). To acquire the image, wafers with cells were placed facing downward in a 27 mm glass-bottom dish filled with PHEM buffer. The images were acquired using TIRF microscopy (Nikon Eclipse Ti inverted microscope) equipped with a 60× 1.49 NA objective (Nikon Instruments). Measurement was done by acquiring raw images at a series of incident angles from 0° to 56° (with an increment of 4°). ROIs of focal adhesions were determined by threshold or Otsu-based segmentation. The Z-positions were processed and computed using IDL-based custom-written software as described previously.36 The topographic images were generated using color code to present the Z-position. The median value of the Z-position of each focal adhesion protein tabulated was used as the representative protein position on the Z-axis relative to the silicon wafer.

4.16. Immunoblotting

Cells were washed with cold 1× PBS and lysed in cold radioimmunoprecipitation assay (RIPA) buffer [150 mM NaCl, 0.25 mM EDTA, 1% Triton X-100, 1% (w/v) NaDoc, and 50 mM tris/HCl (pH 7.3)] containing protease inhibitors. The lysed cells were centrifuged at a top speed for 20 min at 4 °C upon incubating them on ice for 30 min. Protein lysates of the centrifuged samples were transferred to new 1.5 mL tubes and tested for their concentration levels using the Pierce BCA protein assay kit (Thermo Scientific, 23225). Ensuring that the protein concentration levels are standardized across all samples, 4× Laemmli sample buffer was added, and the prepared samples were boiled for 5 min in 95 °C. For Western blot analysis, the samples were subjected to a 4–20% SurePAGE Bis-Tris gel (Genscript, M00656 or M00657) and transferred on polyvinylidene difluoride (PVDF) membranes (Millipore, IPVH85R). PVDF membranes were blocked in tris-buffered saline with 0.1% Tween 20 (TBST) containing 5% BSA for 1 h at room temperature and then probed with targeted primary antibodies, diluted either in 5% BSA containing TBST or PBST, at 4 °C for overnight. Following the primary antibody incubation, the samples were washed in TBST three times for 5 min each and incubated with HRP-conjugated secondary antibodies at room temperature for 1 h. The samples were washed again in TBST three times for 5 min each and developed using the Clarity Western ECL substrate (Bio-Rad) prior visualizing the protein bands with the ChemiDoc Touch (Bio- Rad).

4.17. Co-immunoprecipitation

HEK293T cells were transfected with FLAG, HA, or GFP tagged plasmids and anti-FLAG M2 agarose beads (Sigma-Aldrich), anti-HA magnetic beads (Thermofisher Scientific), or anti-GFP-trap magnetic agarose beads (ChromeTek) were used for immunoprecipitation. The transfected cells were lysed using cold RIPA buffer, 24 h post-transfection, and incubated on ice for 30 min. The lysed cells were then centrifuged at a top speed of 4 °C for 20 min. The lysates were collected and incubated with equal amounts of beads at 4 °C for immunoprecipitation. The beads were washed with cold RIPA lysis buffer three times before resuspending them in 2× Laemmli sample buffer and boiling them for 5 min at 95 °C. Western blotting was done subsequently to analyze the immunoprecipitation.

4.18. Real-Time PCR

Total RNA extraction of each sample was done using a Qiagen RNeasy mini kit. cDNA of the extracted RNA was synthesized by performing reverse transcription with the SuperScript IV VILO Master Mix (Invitrogen). RT-PCR was further conducted by preparing the PCR samples using the SsoFast EvaGreen Supermix (BioRad) which required an equal amount of cDNA for all samples. The BioRad CFX96 Touch Real-Time PCR machine was used to run the prepared samples and measure their mRNA expression levels. The relative mRNA expression levels of the samples were normalized to the respective GAPDH mRNA levels and calculated using the ΔCt values. The primers used for the RT-PCR are listed in Table 1.

Table 1. Primers Used.

Gene Primer Sequence Species
BNIP2 Forward: 5′- CTGCTTTTTGCGACCTGGC -3′ Human
  Reverse 5′- AATCCAGGGAGCCAATGTCC -3′ Human
TNNT2 Forward 5′- GGAAGAGGCAGACTGAGCGGGA -3′ Human
  Reverse 5′- TCCCGCGGGTCTTGGAGACTT -3′ Human
PTK2 Forward 5′- GCCTTATGACGAAATGCTGGGC-3′ Human
  Reverse 5′- CCTGTCTTCTGGACTCCATCCT -3′ Human
PXN Forward 5′- CTGATGGCTTCGCTGTCGGATT -3′ Human
  Reverse 5′- GCTTGTTCAGGTCAGACTGCAG -3′ Human
VCL Forward 5′- TGAGCAAGCACAGCGGTGGATT -3′ Human
  Reverse 5′- TCGGTCACACTTGGCGAGAAGA -3′ Human
GAPDH Forward 5′-CCCTTCATTGACCTCAACTACA -3′ Human
  Reverse 5′-ATGCCAAAGTTGTCATGGAT -3′ Human

4.19. Proximity Ligation Assay (PLA)

Duolink PLA (Sigma-Aldrich) is a fluorogenic-based assay to detect protein–protein interactions via the amplification of the signal by DNA polymerization between two hybridized complementary oligonucleotides. The experiment was conducted according to the manufacturer’s protocol. Briefly, H9c2 cells were seeded on 12 mm glass-bottom dishes overnight and fixed using prewarmed 4% paraformaldehyde for 15 min at 37 °C. Cells were blocked in Duolink blocking solution at 37 °C for 1 h followed by incubation with primary antibodies diluted in Duolink antibody diluent at room temperature for 1 h. After washing the samples with the wash buffer, samples were then incubated with oligonucleotide-labeled secondary antibodies (PLUS and MINUS PLA probes) diluted in the antibody diluent at 37 °C for 1 h. The PLA probe acts as a primer for the DNA polymerase. If the two proteins labeled are in close proximity to each other, the connector oligos join the PLA probes to become ligated, resulting in a closed, circular DNA template which can be amplified by DNA polymerase. This circular DNA amplified was visualized by complementary oligonucleotide probes with a fluorescent label. Samples were mounted with Duolink mounting media with DAPI, and images were acquired using confocal microscopy (60× objective).

4.20. Image Analysis

Quantification of immunofluorescence images was performed using ImageJ and MATLAB. Analysis of Western blotting was conducted using ImageLab (Bio-Rad). The area of segmented focal adhesions was measured using “Analyze Particles” in ImageJ.

4.21. High-Throughput RNA Sequencing Analyses

Total RNA was harvested using RNeasy mini kit (Qiagen) according to manufacturer’s protocol. Total RNA was sent to BGI Tech Solutions Co., Ltd. for RNA sequencing in Hong Kong. Samples were sequenced using the DNBseq platform with 30 million sequencing depth. Differential expression was calculated with DESeq2. The BGI’s Dr. Tom analysis platform was conducted for generating a heatmap and GO_enrichment bubble plot. PCA scores plot was generated using the principal components analysis in R studio. FPKM was performed for all of the measurements.

4.22. Statistical Analysis

The Western blotting and immunofluorescence data were presented as means ± SEM. The statistic graph of SAIM results was generated using OriginPro 2019. The interquartile range was presented for each focal adhesion protein, and the median value was labeled in the graph. All statistical tests were created using GraphPad Prism 9.1.1. Differences were considered statistically significant if the p-value is less than 0.05, where *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001. At least three independent biological repeats were performed for all experiments involving statistical comparison.

Acknowledgments

This work was supported by the Mechanobiology Institute Singapore and funded by the National Research Foundation and Singapore Ministry of Education AcRF Tier 3 Grants MOE2016-T3-1-002 and MOET32021-0003 to B.C.L. with Research Scholarship to J.X (MOE2016-T3-1-002), and Singapore Ministry of Education AcRF Tier 2, MOE2019-T2-2-014, to P.K. X.Z. and J.W.A are supported by Mechanobiology Institute Graduate Scholarship. We also acknowledge funding support by Singapore National Research Foundation under Mid-Sized Grant program (NRF-MSG-2023-0001) to P.K. and B.C.L. We thank core facilities of Mechanobiology Institute of Singapore for the support and assistance provided.

Data Availability Statement

All data supporting the current study findings are available from the corresponding author on reasonable request. Working models were created with BioRender.com.

Supporting Information Available

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsami.4c15459.

  • Validation of BNIP-2 interaction with Paxillin, vinculin, and FAK; Immunoblot analyses and quantification of effects of FAKi in H9c2 cardiomyoblast differentiation; Analyses and quantification of FA size and cell area in BNIP-2 knockdown cells; Detailed quantification of FRAP analyses of paxillin and vinculin in BNIP-2 knockdown and FAKi treatment; Immunoblot analyses and quantification of BNIP-2’s role as a scaffold, co-immunoprecipitation studies of BNIP-2 and FAK interaction; Analyses of BNIP-2’s influence cellular fate in hESC-derived cardiomyocyte differentiation (PDF)

Author Contributions

◆ J.X. and J.W.A. contributed equally. J.X., J.W.A., X.Z., D.C.P.W., P.K., B.C.L. conceived and designed the experiments. J.X. conducted experiments and performed analysis. X.Z. performed and analyzed the scanning angle interference microscopy experiments. M.L.C.J. performed the hESC cardiomyocyte differentiation and CRISPR-targeted knockdown. J.X., J.W.A. D.C.P.W and B.C.L. wrote the manuscript. T.T. and I.Y. helped with the manuscript revision. All authors discussed the results and commented on it. This manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

National Research Foundation – Singapore (NRF-MSG-2023-0001) to B.C.L and P.K. Ministry of Education – Singapore (MOE2016-T3-1-002) to B.C.L Ministry of Education – Singapore (MOET32021-0003) to B.C.L Ministry of Education – Singapore (MOE2019-T2-2-014) to P.K.

The authors declare no competing financial interest.

Supplementary Material

am4c15459_si_001.pdf (1.4MB, pdf)

References

  1. Di X.; Gao X.; Peng L.; Ai J.; Jin X.; Qi S.; Li H.; Wang K.; Luo D. Cellular mechanotransduction in health and diseases: from molecular mechanism to therapeutic targets. Signal Transduction and Targeted Therapy 2023, 8 (1), 282. 10.1038/s41392-023-01501-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Hove J. R.; Köster R. W.; Forouhar A. S.; Acevedo-Bolton G.; Fraser S. E.; Gharib M. Intracardiac fluid forces are an essential epigenetic factor for embryonic cardiogenesis. Nature 2003, 421 (6919), 172–177. 10.1038/nature01282. [DOI] [PubMed] [Google Scholar]
  3. Hazeltine L. B.; Badur M. G.; Lian X.; Das A.; Han W.; Palecek S. P. Temporal impact of substrate mechanics on differentiation of human embryonic stem cells to cardiomyocytes. Acta Biomaterialia 2014, 10 (2), 604–612. 10.1016/j.actbio.2013.10.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ribeiro A. J. S.; Ang Y.-S.; Fu J.-D.; Rivas R. N.; Mohamed T. M. A.; Higgs G. C.; Srivastava D.; Pruitt B. L. Contractility of single cardiomyocytes differentiated from pluripotent stem cells depends on physiological shape and substrate stiffness. Proc. Natl. Acad. Sci. U. S. A. 2015, 112 (41), 12705–12710. 10.1073/pnas.1508073112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Jacot J. G.; McCulloch A. D.; Omens J. H. Substrate Stiffness Affects the Functional Maturation of Neonatal Rat Ventricular Myocytes. Biophys. J. 2008, 95 (7), 3479–3487. 10.1529/biophysj.107.124545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Young J. L.; Kretchmer K.; Ondeck M. G.; Zambon A. C.; Engler A. J. Mechanosensitive Kinases Regulate Stiffness-Induced Cardiomyocyte Maturation. Sci. Rep. 2014, 4 (1), 6425. 10.1038/srep06425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ohashi K.; Fujiwara S.; Mizuno K. Roles of the cytoskeleton, cell adhesion and rho signalling in mechanosensing and mechanotransduction. J. Biochem 2017, 161 (3), 245–254. 10.1093/jb/mvw082. [DOI] [PubMed] [Google Scholar]
  8. Mason D. E.; Collins J. M.; Dawahare J. H.; Nguyen T. D.; Lin Y.; Voytik-Harbin S. L.; Zorlutuna P.; Yoder M. C.; Boerckel J. D. YAP and TAZ limit cytoskeletal and focal adhesion maturation to enable persistent cell motility. J. Cell Biol. 2019, 218 (4), 1369–1389. 10.1083/jcb.201806065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Pletjushkina O. J.; Belkin A. M.; Ivanova O. J.; Oliver T.; Vasiliev J. M.; Jacobson K. Maturation of cell-substratum focal adhesions induced by depolymerization of microtubules is mediated by increased cortical tension. Cell Adhes Commun. 1998, 5 (2), 121–135. 10.3109/15419069809040286. [DOI] [PubMed] [Google Scholar]
  10. Gupton S. L.; Waterman-Storer C. M. Spatiotemporal feedback between actomyosin and focal-adhesion systems optimizes rapid cell migration. Cell 2006, 125 (7), 1361–1374. 10.1016/j.cell.2006.05.029. [DOI] [PubMed] [Google Scholar]
  11. Bachir A. I.; Horwitz A. R.; Nelson W. J.; Bianchini J. M. Actin-Based Adhesion Modules Mediate Cell Interactions with the Extracellular Matrix and Neighboring Cells. Cold Spring Harb Perspect Biol. 2017, 9 (7), a023234. 10.1101/cshperspect.a023234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Case L. B.; Waterman C. M. Integration of actin dynamics and cell adhesion by a three-dimensional, mechanosensitive molecular clutch. Nat. Cell Biol. 2015, 17 (8), 955–963. 10.1038/ncb3191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kanchanawong P.; Calderwood D. A. Organization, dynamics and mechanoregulation of integrin-mediated cell-ECM adhesions. Nat. Rev. Mol. Cell Biol. 2023, 24 (2), 142–161. 10.1038/s41580-022-00531-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Sun Z.; Guo S. S.; Fässler R. Integrin-mediated mechanotransduction. J. Cell Biol. 2016, 215 (4), 445–456. 10.1083/jcb.201609037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Xia S.; Kanchanawong P. Nanoscale mechanobiology of cell adhesions. Seminars in Cell & Developmental Biology 2017, 71, 53–67. 10.1016/j.semcdb.2017.07.029. [DOI] [PubMed] [Google Scholar]
  16. Kanchanawong P.; Shtengel G.; Pasapera A. M.; Ramko E. B.; Davidson M. W.; Hess H. F.; Waterman C. M. Nanoscale architecture of integrin-based cell adhesions. Nature 2010, 468 (7323), 580–584. 10.1038/nature09621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Pasapera A. M.; Schneider I. C.; Rericha E.; Schlaepfer D. D.; Waterman C. M. Myosin II activity regulates vinculin recruitment to focal adhesions through FAK-mediated paxillin phosphorylation. J. Cell Biol. 2010, 188 (6), 877–890. 10.1083/jcb.200906012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Case L. B.; Baird M. A.; Shtengel G.; Campbell S. L.; Hess H. F.; Davidson M. W.; Waterman C. M. Molecular mechanism of vinculin activation and nanoscale spatial organization in focal adhesions. Nat. Cell Biol. 2015, 17 (7), 880–892. 10.1038/ncb3180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. De Pascalis C.; Etienne-Manneville S. Single and collective cell migration: the mechanics of adhesions. Mol. Biol. Cell 2017, 28 (14), 1833–1846. 10.1091/mbc.e17-03-0134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Zhou D. W.; Fernández-Yagüe M. A.; Holland E. N.; García A. F.; Castro N. S.; O’Neill E. B.; Eyckmans J.; Chen C. S.; Fu J.; Schlaepfer D. D.; et al. Force-FAK signaling coupling at individual focal adhesions coordinates mechanosensing and microtissue repair. Nat. Commun. 2021, 12 (1), 2359. 10.1038/s41467-021-22602-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hakuno D.; Takahashi T.; Lammerding J.; Lee R. T. Focal Adhesion Kinase Signaling Regulates Cardiogenesis of Embryonic Stem Cells*. J. Biol. Chem. 2005, 280 (47), 39534–39544. 10.1074/jbc.M505575200. [DOI] [PubMed] [Google Scholar]
  22. Peng X.; Kraus M. S.; Wei H.; Shen T.-L.; Pariaut R.; Alcaraz A.; Ji G.; Cheng L.; Yang Q.; Kotlikoff M. I.; et al. Inactivation of focal adhesion kinase in cardiomyocytes promotes eccentric cardiac hypertrophy and fibrosis in mice. J. Clin. Invest. 2005, 116 (1), 217–227. 10.1172/JCI24497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Peng X.; Wu X.; Druso J. E.; Wei H.; Park A. Y.-J.; Kraus M. S.; Alcaraz A.; Chen J.; Chien S.; Cerione R. A.; et al. Cardiac developmental defects and eccentric right ventricular hypertrophy in cardiomyocyte focal adhesion kinase (FAK) conditional knockout mice. Proc. Natl. Acad. Sci. U.S.A. 2008, 105 (18), 6638–6643. 10.1073/pnas.0802319105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kang J. S.; Bae G. U.; Yi M. J.; Yang Y. J.; Oh J. E.; Takaesu G.; Zhou Y. T.; Low B. C.; Krauss R. S. A Cdo-Bnip-2-Cdc42 signaling pathway regulates p38alpha/beta MAPK activity and myogenic differentiation. J. Cell Biol. 2008, 182 (3), 497–507. 10.1083/jcb.200801119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Wong D. C. P.; Xiao J.; Chew T. W.; Pan M.; Lee C. J. M.; Ang J. W.; Yow I.; Thivakar T.; Ackers-Johnson M.; Lee N. J. W.; et al. BNIP-2 Activation of Cellular Contractility Inactivates YAP for H9c2 Cardiomyoblast Differentiation. Advanced Science 2022, 9 (31), 2202834. 10.1002/advs.202202834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Yi P.; Chew L. L.; Zhang Z.; Ren H.; Wang F.; Cong X.; Zheng L.; Luo Y.; Ouyang H.; Low B. C.; et al. KIF5B transports BNIP-2 to regulate p38 mitogen-activated protein kinase activation and myoblast differentiation. Mol. Biol. Cell 2015, 26 (1), 29–42. 10.1091/mbc.e14-03-0797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Akamatsu R.; Ishida-Kitagawa N.; Aoyama T.; Oka C.; Kawaichi M. BNIP-2 binds phosphatidylserine, localizes to vesicles, and is transported by kinesin-1. Genes to Cells 2015, 20 (2), 135–152. 10.1111/gtc.12209. [DOI] [PubMed] [Google Scholar]
  28. Pan M.; Chew T. W.; Wong D. C. P.; Xiao J.; Ong H. T.; Chin J. F. L.; Low B. C. BNIP-2 retards breast cancer cell migration by coupling microtubule-mediated GEF-H1 and RhoA activation. Science Advances 2020, 6 (31), eaaz1534 10.1126/sciadv.aaz1534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. McBeath R.; Pirone D. M.; Nelson C. M.; Bhadriraju K.; Chen C. S. Cell Shape, Cytoskeletal Tension, and RhoA Regulate Stem Cell Lineage Commitment. Developmental Cell 2004, 6 (4), 483–495. 10.1016/S1534-5807(04)00075-9. [DOI] [PubMed] [Google Scholar]
  30. Sampayo R. G.; Sakamoto M.; Wang M.; Kumar S.; Schaffer D. V. Mechanosensitive stem cell fate choice is instructed by dynamic fluctuations in activation of Rho GTPases. Proc. Natl. Acad. Sci. U. S. A. 2023, 120 (22), e2219854120 10.1073/pnas.2219854120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Anderson C. L.; Brown K. A.; North R. J.; Walters J. K.; Kaska S. T.; Wolff M. R.; Kamp T. J.; Ge Y.; Eckhardt L. L. Global Proteomic Analysis Reveals Alterations in Differentially Expressed Proteins between Cardiopathic Lamin A/C Mutations. J. Proteome Res. 2024, 23 (6), 1970–1982. 10.1021/acs.jproteome.3c00853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ren X. D.; Kiosses W. B.; Sieg D. J.; Otey C. A.; Schlaepfer D. D.; Schwartz M. A. Focal adhesion kinase suppresses Rho activity to promote focal adhesion turnover. J. Cell Sci. 2000, 113 (20), 3673–3678. 10.1242/jcs.113.20.3673. [DOI] [PubMed] [Google Scholar]
  33. Zhang Y.; Kishi H.; Morita T.; Kobayashi S. Paxillin controls actin stress fiber formation and migration of vascular smooth muscle cells by directly binding to the active Fyn. Faseb j 2021, 35 (12), e22012 10.1096/fj.202101035RR. [DOI] [PubMed] [Google Scholar]
  34. Szklarczyk D.; Kirsch R.; Koutrouli M.; Nastou K.; Mehryary F.; Hachilif R.; Gable A. L.; Fang T.; Doncheva N. T.; Pyysalo S.; et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023, 51 (D1), D638–d646. 10.1093/nar/gkac1000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Paszek M. J.; DuFort C. C.; Rubashkin M. G.; Davidson M. W.; Thorn K. S.; Liphardt J. T.; Weaver V. M. Scanning angle interference microscopy reveals cell dynamics at the nanoscale. Nat. Methods 2012, 9 (8), 825–827. 10.1038/nmeth.2077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Liu J.; Wang Y.; Goh W. I.; Goh H.; Baird M. A.; Ruehland S.; Teo S.; Bate N.; Critchley D. R.; Davidson M. W.; et al. Talin determines the nanoscale architecture of focal adhesions. Proc. Natl. Acad. Sci. U. S. A. 2015, 112 (35), E4864-E4873 10.1073/pnas.1512025112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Xia S.; Yim E. K. F.; Kanchanawong P. Molecular Organization of Integrin-Based Adhesion Complexes in Mouse Embryonic Stem Cells. ACS Biomaterials Science & Engineering 2019, 5 (8), 3828–3842. 10.1021/acsbiomaterials.8b01124. [DOI] [PubMed] [Google Scholar]
  38. Grashoff C.; Hoffman B. D.; Brenner M. D.; Zhou R.; Parsons M.; Yang M. T.; McLean M. A.; Sligar S. G.; Chen C. S.; Ha T.; et al. Measuring mechanical tension across vinculin reveals regulation of focal adhesion dynamics. Nature 2010, 466 (7303), 263–266. 10.1038/nature09198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Balaban N. Q.; Schwarz U. S.; Riveline D.; Goichberg P.; Tzur G.; Sabanay I.; Mahalu D.; Safran S.; Bershadsky A.; Addadi L.; et al. Force and focal adhesion assembly: a close relationship studied using elastic micropatterned substrates. Nat. Cell Biol. 2001, 3 (5), 466–472. 10.1038/35074532. [DOI] [PubMed] [Google Scholar]
  40. McKenzie A. J.; Hicks S. R.; Svec K. V.; Naughton H.; Edmunds Z. L.; Howe A. K. The mechanical microenvironment regulates ovarian cancer cell morphology, migration, and spheroid disaggregation. Sci. Rep. 2018, 8 (1), 7228. 10.1038/s41598-018-25589-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Stricker J.; Aratyn-Schaus Y.; Oakes P. W.; Gardel M. L. Spatiotemporal Constraints on the Force-Dependent Growth of Focal Adhesions. Biophys. J. 2011, 100 (12), 2883–2893. 10.1016/j.bpj.2011.05.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Chastney M. R.; Conway J. R. W.; Ivaska J. Integrin adhesion complexes. Curr. Biol. 2021, 31 (10), R536–R542. 10.1016/j.cub.2021.01.038. [DOI] [PubMed] [Google Scholar]
  43. Mavrakis M.; Juanes M. A. The compass to follow: Focal adhesion turnover. Curr. Opin. Cell Biol. 2023, 80, 102152. 10.1016/j.ceb.2023.102152. [DOI] [PubMed] [Google Scholar]
  44. Carisey A.; Tsang R.; Greiner A. M.; Nijenhuis N.; Heath N.; Nazgiewicz A.; Kemkemer R.; Derby B.; Spatz J.; Ballestrem C. Vinculin regulates the recruitment and release of core focal adhesion proteins in a force-dependent manner. Curr. Biol. 2013, 23 (4), 271–281. 10.1016/j.cub.2013.01.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Hamadi A.; Bouali M.; Dontenwill M.; Stoeckel H.; Takeda K.; Rondé P. Regulation of focal adhesion dynamics and disassembly by phosphorylation of FAK at tyrosine 397. J. Cell Sci. 2005, 118 (19), 4415–4425. 10.1242/jcs.02565. [DOI] [PubMed] [Google Scholar]
  46. Swaminathan V.; Fischer R. S.; Waterman C. M. The FAK-Arp2/3 interaction promotes leading edge advance and haptosensing by coupling nascent adhesions to lamellipodia actin. Mol. Biol. Cell 2016, 27 (7), 1085–1100. 10.1091/mbc.E15-08-0590. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zaidel-Bar R.; Itzkovitz S.; Ma’ayan A.; Iyengar R.; Geiger B. Functional atlas of the integrin adhesome. Nat. Cell Biol. 2007, 9 (8), 858–867. 10.1038/ncb0807-858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Turner C. E. Paxillin and focal adhesion signalling. Nat. Cell Biol. 2000, 2 (12), E231–E236. 10.1038/35046659. [DOI] [PubMed] [Google Scholar]
  49. Bays J. L.; Peng X.; Tolbert C. E.; Guilluy C.; Angell A. E.; Pan Y.; Superfine R.; Burridge K.; DeMali K. A. Vinculin phosphorylation differentially regulates mechanotransduction at cell-cell and cell-matrix adhesions. J. Cell Biol. 2014, 205 (2), 251–263. 10.1083/jcb.201309092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. DeWane G.; Cronin N. M.; Dawson L. W.; Heidema C.; DeMali K. A. Vinculin Y822 is an important determinant of ligand binding. J. Cell Sci. 2023, 136 (12), jcs260104. 10.1242/jcs.260104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Mitra S. K.; Schlaepfer D. D. Integrin-regulated FAK-Src signaling in normal and cancer cells. Curr. Opin Cell Biol. 2006, 18 (5), 516–523. 10.1016/j.ceb.2006.08.011. [DOI] [PubMed] [Google Scholar]
  52. Pan C. Q.; Low B. C. Functional plasticity of the BNIP-2 and Cdc42GAP Homology (BCH) domain in cell signaling and cell dynamics. FEBS Lett. 2012, 586 (17), 2674–2691. 10.1016/j.febslet.2012.04.023. [DOI] [PubMed] [Google Scholar]
  53. Wong D. C. P.; Pan C. Q.; Er S. Y.; Thivakar T.; Rachel T. Z. Y.; Seah S. H.; Chua P. J.; Jiang T.; Chew T. W.; Chaudhuri P. K.; et al. The scaffold RhoGAP protein ARHGAP8/BPGAP1 synchronizes Rac and Rho signaling to facilitate cell migration. Mol. Biol. Cell 2023, 34 (3), ar13. 10.1091/mbc.E21-03-0099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Ikebe M.; Hartshorne D. J. Phosphorylation of smooth muscle myosin at two distinct sites by myosin light chain kinase. J. Biol. Chem. 1985, 260 (18), 10027–10031. 10.1016/S0021-9258(17)39206-2. [DOI] [PubMed] [Google Scholar]
  55. Michael K. E.; Dumbauld D. W.; Burns K. L.; Hanks S. K.; García A. J. Focal adhesion kinase modulates cell adhesion strengthening via integrin activation. Mol. Biol. Cell 2009, 20 (9), 2508–2519. 10.1091/mbc.e08-01-0076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Colzani M.; Malcor J. D.; Hunter E. J.; Bayraktar S.; Polkinghorne M.; Krieg T.; Cameron R.; Best S.; Farndale R. W.; Sinha S. Modulating hESC-derived cardiomyocyte and endothelial cell function with triple-helical peptides for heart tissue engineering. Biomaterials 2021, 269, 120612. 10.1016/j.biomaterials.2020.120612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Lian X.; Zhang J.; Azarin S. M.; Zhu K.; Hazeltine L. B.; Bao X.; Hsiao C.; Kamp T. J.; Palecek S. P. Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt/β-catenin signaling under fully defined conditions. Nat. Protoc. 2013, 8 (1), 162–175. 10.1038/nprot.2012.150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Lalit P. A.; Salick M. R.; Nelson D. O.; Squirrell J. M.; Shafer C. M.; Patel N. G.; Saeed I.; Schmuck E. G.; Markandeya Y. S.; Wong R.; Lea M. R.; Eliceiri K. W.; Hacker T. A.; Crone W. C.; Kyba M.; Garry D. J.; Stewart R.; Thomson J. A.; Downs K. M.; Lyons G. E.; Kamp T. J. Lineage Reprogramming of Fibroblasts into Proliferative Induced Cardiac Progenitor Cells by Defined Factors. Cell Stem Cell 2016, 18 (3), 354–367. 10.1016/j.stem.2015.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Yang L.; Soonpaa M. H.; Adler E. D.; Roepke T. K.; Kattman S. J.; Kennedy M.; Henckaerts E.; Bonham K.; Abbott G. W.; Linden R. M.; et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature 2008, 453 (7194), 524–528. 10.1038/nature06894. [DOI] [PubMed] [Google Scholar]
  60. Litviňuková M.; Talavera-López C.; Maatz H.; Reichart D.; Worth C. L.; Lindberg E. L.; Kanda M.; Polanski K.; Heinig M.; Lee M.; et al. Cells of the adult human heart. Nature 2020, 588 (7838), 466–472. 10.1038/s41586-020-2797-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Xin M.; Kim Y.; Sutherland L. B.; Murakami M.; Qi X.; McAnally J.; Porrello E. R.; Mahmoud A. I.; Tan W.; Shelton J. M.; et al. Hippo pathway effector Yap promotes cardiac regeneration. Proc. Natl. Acad. Sci. U. S. A. 2013, 110 (34), 13839–13844. 10.1073/pnas.1313192110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Lee C. J. M.; Autio M. I.; Zheng W.; Song Y.; Wang S. C.; Wong D. C. P.; Xiao J.; Zhu Y.; Yusoff P.; Yei X.; et al. Genome-Wide CRISPR Screen Identifies an NF2-Adherens Junction Mechanistic Dependency for Cardiac Lineage. Circulation 2024, 149 (25), 1960–1979. 10.1161/CIRCULATIONAHA.122.061335. [DOI] [PubMed] [Google Scholar]
  63. Holland E. N.; Fernández-Yagüe M. A.; Zhou D. W.; O’Neill E. B.; Woodfolk A. U.; Mora-Boza A.; Fu J.; Schlaepfer D. D.; García A. J. FAK, vinculin, and talin control mechanosensitive YAP nuclear localization. Biomaterials 2024, 308, 122542. 10.1016/j.biomaterials.2024.122542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Haeussler M.; Schönig K.; Eckert H.; Eschstruth A.; Mianné J.; Renaud J.-B.; Schneider-Maunoury S.; Shkumatava A.; Teboul L.; Kent J.; et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biology 2016, 17 (1), 148. 10.1186/s13059-016-1012-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Doench J. G.; Fusi N.; Sullender M.; Hegde M.; Vaimberg E. W.; Donovan K. F.; Smith I.; Tothova Z.; Wilen C.; Orchard R.; et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol. 2016, 34 (2), 184–191. 10.1038/nbt.3437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Teo J. L.; Lim C. T.; Yap A. S.; Saw T. B. A Biologist’s Guide to Traction Force Microscopy Using Polydimethylsiloxane Substrate for Two-Dimensional Cell Cultures. STAR Protocols 2020, 1 (2), 100098. 10.1016/j.xpro.2020.100098. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

am4c15459_si_001.pdf (1.4MB, pdf)

Data Availability Statement

All data supporting the current study findings are available from the corresponding author on reasonable request. Working models were created with BioRender.com.


Articles from ACS Applied Materials & Interfaces are provided here courtesy of American Chemical Society

RESOURCES