Skip to main content
NCBI home page
Neural Regeneration Research logoLink to Neural Regeneration Research
. 2024 May 17;20(8):2420–2432. doi: 10.4103/NRR.NRR-D-23-01725

CNKSR2 interactome analysis indicates its association with the centrosome/microtubule system

Lin Yin 1,2, Yalan Xu 1,2, Jie Mu 1,3, Yu Leng 1,2, Lei Ma 1,2, Yu Zheng 1,2,4, Ruizhi Li 1,2, Yin Wang 1, Peifeng Li 1, Hai Zhu 4, Dong Wang 1, Jing Li 1,*
PMCID: PMC11759008  PMID: 39359098

graphic file with name NRR-20-2420-g001.jpg

Keywords: autism spectrum disorder, centrosome, CNKSR2, intellectual disability, interactome, mass spectrometry, microtubule, neurodevelopmental disease, protein complexes, protein–protein interactions

Abstract

The protein connector enhancer of kinase suppressor of Ras 2 (CNKSR2), present in both the postsynaptic density and cytoplasm of neurons, is a scaffolding protein with several protein-binding domains. Variants of the CNKSR2 gene have been implicated in neurodevelopmental disorders, particularly intellectual disability, although the precise mechanism involved has not yet been fully understood. Research has demonstrated that CNKSR2 plays a role in facilitating the localization of postsynaptic density protein complexes to the membrane, thereby influencing synaptic signaling and the morphogenesis of dendritic spines. However, the function of CNKSR2 in the cytoplasm remains to be elucidated. In this study, we used immunoprecipitation and high-resolution liquid chromatography-mass spectrometry to identify the interactors of CNKSR2. Through a combination of bioinformatic analysis and cytological experiments, we found that the CNKSR2 interactors were significantly enriched in the proteome of the centrosome. We also showed that CNKSR2 interacted with the microtubule protein DYNC1H1 and with the centrosome marker CEP290. Subsequent colocalization analysis confirmed the centrosomal localization of CNKSR2. When we downregulated CNKSR2 expression in mouse neuroblastoma cells (Neuro 2A), we observed significant changes in the expression of numerous centrosomal genes. This manipulation also affected centrosome-related functions, including cell size and shape, cell proliferation, and motility. Furthermore, we found that CNKSR2 interactors were highly enriched in de novo variants associated with intellectual disability and autism spectrum disorder. Our findings establish a connection between CNKSR2 and the centrosome, and offer new insights into the underlying mechanisms of neurodevelopmental disorders.

Introduction

Neurodevelopmental disorders refer to a heterogeneous group of psychological conditions that affect the brain’s development, physiology, and function, leading to intellectual, social, and emotional difficulties (Li et al., 2024). The most common neurodevelopmental disorders include intellectual disability (ID), attention deficit hyperactivity disorder, and autism spectrum disorder (ASD) (Morris-Rosendahl and Crocq, 2020; Parenti et al., 2020; Knight et al., 2024; Lee and Jung, 2024; Zhao et al., 2024). The symptoms of neurodevelopmental disorders vary with the specific conditions, with developmental delay, language defect, hyperactivity, and epilepsy being the most common manifestations. The pathogenic mechanisms are very complex and remain poorly understood.

The application of genetic and genomic technologies in medicine and neuroscience over the past 20 years has greatly advanced our understanding of neurological and psychiatric diseases. Genetics and genome wide association studies have identified a cohort of mutations associated with neurodevelopmental disorders (State and Levitt, 2011; Pavlowsky et al., 2012; Fromer et al., 2014; Pinto et al., 2014; Schizophrenia Working Group of the Psychiatric Genomics Consortium, 2014). Nevertheless, translating these genetic findings into a physiological understanding of how the variants of these genes affect brain function has been challenging. Our previous studies of the postsynaptic density (PSD) found that the protein–protein interaction (PPI) network and phosphorylation signaling network intersect at multiple highly connected nodes, and proteins encoded by the high-risk neurodevelopmental disease-related genes are enriched in the interactomes of the nodes (Li et al., 2016, 2017). Given the finding that many of these node proteins are scaffolding proteins serving as platforms for the interplay of proteins, we postulated that disruption of the normal PPIs of these hub proteins leads to dysregulated cellular function (e.g., synaptic signaling) and plays a role in the etiology of neurodevelopmental disorders.

The connector enhancer of kinase suppressor of Ras 2 (CNKSR2) gene is located on the short arm of the X chromosome and encodes the protein CNKSR2, also known as CNK2 or MAGUIN. Mutation of CNKSR2 is considered a causative factor of X-linked ID, which may cause symptoms such as developmental retardation, ID, problems in psychomotor development and attention, language impairment, and epilepsy (Houge et al., 2012; Polla et al., 2019). CNKSR2 is a multidomain scaffolding protein mainly expressed in the brain and is one of the hub proteins that was identified in our PSD PPI network (Li et al., 2017). Studies have started to determine the molecular characteristics of CNKSR2, and it was found to interact with several signaling molecules, including the RAF proto-oncogene serine/threonine-protein kinase (Yao et al., 2000; Lanigan et al., 2003), zinc finger protein (Lanigan et al., 2003), Vilse/Rho GTPase-activating protein 39, Cytohesin-2 (Lim et al., 2014), and synaptic proteins PSD95 (Yao et al., 1999; Li et al., 2017), densin-180 (Ohtakara et al., 2002), and TRAF2 and NCK-interacting protein kinase (TNIK) (Fu et al., 1999; Li et al., 2017; Zieger et al., 2020).

CNKSR2 is broadly distributed in cells and localized in plasma membrane-associated structures and cytoplasmic components. Past research has primarily focused on its role in synaptic signaling. For example, through the binding of its pleckstrin homology domain to phosphatidylinositol in the membrane, CNKSR2 maintains the membrane localization of its interactor TNIK, and the dysregulation of this process compromises the morphogenesis of dendritic spines (Zieger et al., 2020). However, patients with CNKSR2 mutations have been described to present structural abnormalities such as microcephaly and cortical atrophy (Houge et al., 2012; Kang et al., 2021), suggesting that CNKSR2 might have a role outside the PSD. In this study, we immunoprecipitated and identified CNKSR2 complexes from mouse prefrontal cortex and found a link between CNKSR2 and the centrosome/microtubule system.

Methods

Product information and antibodies used in this study are listed in Additional Table 1. Unless otherwise specified, all the reagents used in this study were of analytical grade and purchased from Macklin Biochemical Technology Co., Ltd. (Shanghai, China).

Additional Table 1.

List of the antibodies used in this study

Target Species Usage Supplier Cat# RRID Incubation time Incubation temperature
Primary antibody CNKSR2 Rabbit IP (4 μg/assay) Abcepta Biotech, Suzhou, Jiangsu Province, China AP69182 AB_3083424 Overnight 4°C
Rabbit WB (1:1000) Bioss Antibodies, Beijing, China bs-8029R AB_3083428 Overnight 4°C
Rabbit IF (1:300) Affinity Biosciences, Liyang, Jiangsu Province, China DF3375 AB_2835757 1.5 h Room temperature
CEP290 Rabbit IP (4 μg/assay); WB (1:1000) Proteintech, Wuhan, Hubei Province, China 22490-1-AP AB_10973679 Overnight 4°C
CEP63 Mouse IF (1:3000) Proteintech Wuhan, Hubei Province, China 66996-1-lg AB_2882313 1.5 h Room temperature
DYNC1H1 Rabbit IP (4 μg/assay); WB (1:1000) Proteintech Wuhan, Hubei Province, China 12345-1-AP AB_2261765 Overnight 4°C
GAPDH Rabbit WB (1:1000) Sangon Biotech, Shanghai, China D110016 AB_2904600 Overnight 4°C
Rabbit IgG Rabbit IP (4 μg/assay) Sangon Biotech Shanghai, China D110502 AB_3083429 Overnight 4°C
α-Tubulin Rabbit IF (1:300) Proteintech Wuhan, Hubei Province, China 11224-1-AP AB_2210206 Overnight 4°C
Secondary antibody HRP-conjugated Goat Anti-Rabbit IgG Goat WB (1:10000) Sangon Biotech Shanghai, China D110058 AB_2940954 1h Room temperature
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 546 Donkey IF (1:250) Thermo Fisher Scientific, Eugene, Oregon, USA A10040 AB_2534016 1.5 h Room temperature
CoraLite647-conjugated AffiniPure F(ab')2 Fragment Donkey Anti-Rabbit IgG (H+L) Donkey IF (1:200) Proteintech Wuhan, Hubei Province, China SA00014-7 AB_2935619 1.5 h Room temperature
Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 546 Donkey IF (1:250) Thermo Fisher Scientific, Eugene, Oregon, USA A10036 AB_11180613 1.5 h Room temperature
Open in a new tab

CEP290: Centrosomal protein of 290 kDa; CEP63: centrosomal protein of 63 kDa; CNKSR2: connector enhancer of kinase suppressor of Ras 2; DYNC1H1 : dynein cytoplasmic 1 heavy chain 1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; HRP: horseradish peroxidase.

Animal procedures

Six 8-week-old C57BL/6J mice (two male and four female), weighing 20–26 g, were purchased from Jinan Pengyue Animal Co., Ltd. (Jinan, Shandong Province, China, license No. SCXK (Lu) 20220006) for breeding. The mice were bred and maintained in the homeothermic animal room of Qingdao University. The animal room is a specific-pathogen-free environment with a temperature of 23°C, humidity at 50%, and a 12-hour light/dark cycle. All animal procedures strictly abided by the regulations for administering laboratory animals of the Chinese Ministry of Science and Technology and the relevant regulations of the Animal Care and Use Committee of Qingdao University and were approved by the Ethics Committee of the Medical College of Qingdao University (Approval No. QDU-AEC-2022303) on April 29, 2022.

Mice were monitored daily to track pregnancy and neonatal age. Mice used in the experiments included embryonic-day-14 (E14) embryos (n = 35) from eight pregnant females weighing 22–25 g, postnatal-day-7 (P7) mice (n = 5) weighing 3.1–3.8 g, postnatal-day-14 (P14) mice (n = 5) weighing 4.6–5.2 g, and 2-month-old (adult) mice (n = 5) weighing 20–26 g. Male and female mice were selected randomly. Mice were sacrificed by cervical dislocation after being anesthetized by an inhalation overdose of isoflurane (0.06%; RWD Life Science, Shenzhen, Guangdong Province, China, Cat# R510-22-10). The prefrontal cortices (Spijker, 2011) of P7, P14, and adult mice were isolated, snap-frozen in liquid nitrogen, and stored at –80°C until use, as previously described (Li et al., 2017). For E14 embryos, the whole brains were used.

Cell culture

The mouse neuroblastoma cell line Neuro 2A (N2A; stock No. 1101MOU-PUMC000291, RRID: CVCL_0470) was obtained from the Cell Resource Center, Peking Union Medical College (which is part of the National Science and Technology Infrastructure, the National Biomedical Cell-Line Resource, NSTI-BMCR; http://cellresource.cn) on May, 2021. The N2A cell line is a commonly used cell model for studying neural cell development, function, and disease (Mao et al., 2000; Zeng and Zhou, 2008; Tremblay et al., 2010). The cells used in this study were passaged in the laboratory for no more than seven passages. Unless otherwise specified, the cells were cultured in proliferation medium, composed of Dulbecco’s modified eagle medium (DMEM; Servicebio, Wuhan, Hubei Province, China, Cat# G4510) supplemented with 10% fetal bovine serum (FBS; Gibco, Penrose, Auckland, New Zealand, Cat# 10091148) and 100 U/mL penicillin - 100 μg/mL streptomycin (Gibco, USA, Cat# 15140122).

Immunoprecipitation

Immunoprecipitation (IP) and mass spectrometry (MS) analysis were performed as previously described (Li et al., 2017). The lysis buffer used to extract the whole-cell proteins (sodium deoxycholate [DOC] buffer) contained 50 mM Tris (pH 9), 10 mM Na3VO4, 50 mM NaF, 40 mM β-glycerol phosphate, 20 μM ZnCl2, 1% DOC and protease inhibitor cocktail (EMD Millipore, Billerica, MA, USA; Cat# 535140). The lysis buffer used for extracting cytosolic fractions (Triton buffer) contained 50 mM N-2-hydroxyethylpiperazine-N-ethane-sulphonicacid (pH 7.4), 2 mM ethylene diamine tetraacetic acid (EDTA), 2 mM ethylene glycol tetraacetic acid, 10 mM Na3VO4, 30 mM NaF, 40 mM β-glycerol phosphate, protease inhibitor cocktail and 1% Triton X-100. The CNKSR2 antibody (host: rabbit, concentration: 1 mg/mL) used for IP experiments was purchased from Abcepta Biotech (Suzhou, Jiangsu Province, China, Cat# AP69182, RRID: AB_3083424), and rabbit total IgG, used as the negative control antibody, was purchased from Sangon Biotech (Shanghai, China, Cat# D110502, RRID: AB_3083429). For each IP assay, 4 μg of antibody was incubated in 600 μL of lysate containing 2 mg of total protein at 4°C overnight, and 40 μL slurry of protein A/G magnetic beads (Selleck, Houston, TX, USA, Cat# B23202) were used to bind the antibodies at 4°C for 4 hours. After incubation, the beads were washed three times with washing buffer containing 25 mM Tris (pH 8.1), 150 mM NaCl, 1 mM EDTA, and 1% Triton-X 100, and proteins were eluted in 40 μL 2× sample loading buffer (100 mM Tris-HCl [pH 6.8], 4% [w/v] sodium dodecyl sulfate [SDS], 0.2% [w/v] bromophenol blue, 20% [w/v] glycerol) for SDS-polyacrylamide gel electrophoresis. Three independent biological replicates were conducted.

In-gel digestion and labeling

The IP eluates were successively treated with 10 mM dithiothreitol and 40 mM iodoacetamide for cysteine reduction and alkylation, respectively, and then desalted by 10% SDS-polyacrylamide gel electrophoresis. The whole lanes were cut for in-gel digestion after being stained with a Coomassie Brilliant Blue Fast Staining solution (Solarbio Life Sciences, Beijing, China, Cat# P1300-B). Briefly, lanes were cut into 2 mm square pieces and destained by repeated, alternating incubation in 50 mM triethylammonium bicarbonate (Santa Cruz Biotechnology, Santa Cruz, CA, USA, Cat# sc-229407) and 60% acetonitrile (Pierce Biotechnology, Rockford, IL, USA, Cat# 51101)/0.1 formic acid (FA) (Pierce Biotechnology, Cat# 85178) solutions. After all the blue color had disappeared, the gel pieces were dehydrated in 100% ACN, dried in a vacuum concentrator, and then incubated in the digestion solution containing 5 ng/μL trypsin (Promega, Madison, WI, USA, Cat# V5280) in 50 mM triethylammonium bicarbonate (Merck KGaA, Darmstadt, Germany, Cat# 18597) at 37°C overnight. The following day, the digested peptides were extracted with 60% ACN/0.1% FA and dried in a vacuum concentrator. Then, the peptides were resuspended in 10 μL of 1 M triethylammonium bicarbonate solution and labeled by the iTRAQTM reagents (Sigma-Aldrich, Burlington, MA, USA, Cat# 4370280) according to the manufacturer’s instructions. IP samples from E14, P7, P14, and adult mice prefrontal cortex were labeled with iTRAQTM reagents containing the 114, 115, 116, and 117 Da mass tags respectively. The samples were mixed in equal amounts, desalted by repeated reconstitution in 1 mL water with 0.1% FA and dried out three times, and finally reconstituted in 10 μL 3% ACN/0.1% FA for high-performance liquid chromatography- tandem mass spectrometry (MS/MS) analysis.

MS analysis

High-performance liquid chromatography-MS/MS analysis was performed using an EASY-nLCTM 1200 liquid chromatography system (Thermo Scientific, Bremen, Germany) coupled with a Q-ExactiveTM mass spectrometer (Thermo Scientific, San Jose, CA, USA). The peptide sample was loaded onto a capillary column in-house packed with reverse phase C18 resin (Dr. Maisch GmbH, Ammerbuch, Germany, Cat# R13. AQ. 0001) and successively eluted at a flow rate of 300 nL/min during a 110-minute 8%–32% B gradient. The solvents used were water with 0.1% FA (Fisher Scientific, Cat# LS118) (Solvent A) and 80% ACN/20% H2O/0.1% FA (Fisher Scientific, Cat# LS122) (Solvent B). The MS/MS analysis was performed in a data-dependent acquisition mode with the dynamic exclusion time set as 30 seconds. One full scan, with a mass range of 375–1400 m/z, was followed by 10 tandem MS scans. The precursor ions were fragmented at a normalized collision energy of 33%, and the isolation window was set to 2 m/z.

MS data were processed using Proteome Discoverer (PD) v2.3 (Thermo Scientific, Waltham, MA, USA) and searched using the Sequest algorithm against the mouse database (uniprot_proteome_mouse_17027_20200114.fasta), which was downloaded from the UniProt website (https://www.uniprot.org/) (UniProt Consortium, 2023) and combined with its decoy sequences. The mass tolerance used for database searching was set as 10 ppm for precursor ions and 0.02 Da for fragment ions. Trypsin was used as the digesting enzyme, and no more than two missed cleavage sites were allowed. The static modification was set as cysteine carboxyamidation (57.021 Da), and dynamic modifications were set as iTRAQ4plex (+144.102 Da) for lysine, tyrosine, and the N-terminal amino group of peptides. The Fixed Value PSM Validator, a functional module of the PD software, was used for peptide identification validation. Peptides with high confidence were considered true hits. Proteins accepted as interactors of CNKSR2 were required to meet both of the following criteria: 1) having at least two unique peptides identified with high confidence; and 2) appearing in the CNKSR2 IP datasets but not in the IgG control datasets. The iTRAQ-based protein quantitation was performed using the quantification algorithms integrated in PD v2.3. A protein abundance ratio higher than 1.5 or less than 0.67, with a P value less than 0.05, was considered a significant change.

Bioinformatics

The enrichment analysis of Gene Ontology molecular function terms of the CNKSR2 interactors was performed using the online bioinformatic platform STRING (https://string-db.org/; Szklarczyk et al., 2021). The pathway and biological process enrichment analysis was conducted on the bioinformatic platform Metascape v3.5.20230501 (https://metascape.org; Zhou et al., 2019).

To better understand how CNKSR2 is distributed within cells, proteomic data on important organelles were collected from various sources, including published studies (van Dam et al., 2013; Alves-Cruzeiro et al., 2014; Sjöstedt et al., 2020; O’Neill et al., 2022) and the databases LocDB (https://www.rostlab.org/services/locDB/) and SynGO (https://syngoportal.org/). Enrichment analysis of the CNKSR2 interactors was conducted using in-house R scripts to calculate the upper tail probability of the hypergeometric distribution (P value). The P values were then corrected by the Benjamini–Hochberg method for multiple testing. The web server SRplot (http://www.bioinformatics.com.cn/srplot) was used for data visualization and graphing.

Lentivirus-mediated knockdown of CNKSR2

Lentiviruses used for downregulating CNKSR2 expression were customized by Ubigene Biosciences Co. Ltd. (Guangzhou, Guangdong Province, China). The target sequence (5′-GAA TTA TGG CTT AGA AAC A-3′) was adopted from a previous study (Ito et al., 2021). A lentivirus with the same plasmid backbone as the knockdown (KD) lentivirus but expressing a randomly shuffled sequence was used as the negative control (NC). Cultured N2A cells were infected with the KD or NC lentivirus on day 1 at a multiplicity of infection of 50. The cells were cultured in the virus-containing medium for 24 hours and in fresh medium without lentivirus for another 24 hours before receiving the second lentivirus infection at a multiplicity of infection of 50. After an additional 2 days of culture in fresh medium, the cells were harvested or fixed for subsequent experiments.

Western blotting

The N2A cells were gently rinsed with ice-cold phosphate-buffered saline three times before being lysed by sonication in radioimmunoprecipitation assay lysis buffer (Sangon Biotech, Cat# C500005) containing freshly added protease inhibitor cocktail (EMD Millipore; Cat# 535140). The protein concentration was determined using a bicinchoninic acid assay kit (Sangon Biotech; Cat# C503051). For IP samples, the eluates from the CNKSR2 and IgG IP assays were compared with the total tissue lysates (input). Western blotting (WB) experiments were performed as previously described (Xu et al., 2022). For quantitative analysis, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein was used as a loading control protein to assess equal protein loading across samples, and the intensity of the target protein band was divided by the intensity of the GAPDH band of the same sample to obtain a normalized ratio for statistical analysis.

Colocalization analysis of CNKSR2 and CEP63

N2A cells were seeded in low density and cultured in the proliferation medium for 24 hours before being fixed in 4% paraformaldehyde. Centrosomal protein of 63 kDa (CEP63) was used to indicate the location of the centrosome in cells (Löffler et al., 2011). Immunostaining was performed as previously described (Song et al., 2022). Confocal microscopy was performed on a Leica SP8 confocal microscope (Leica Microsystems, Wetzlar, Germany). The images were processed using ImageJ (Fiji, 1.53c) software (National Institutes of Health, Bethesda, MD, USA; Schindelin et al., 2012).

Analysis of cell proliferation

The cell counting kit-8 (CCK8) assay was used for N2A cell proliferation analysis. At 96 hours after the initial lentivirus treatment, N2A cells of the KD and NC groups were digested and seeded in a 96-well plate at a density of 1000 cells per well and cultured in a fresh proliferation medium for 24, 48 and 72 hours before the CCK8 assay. The CCK8 assay was performed using a commercially available CCK8 assay kit (Yeasen Biotechnology, Cat# 40203ES76) according to the manufacturer’s instructions. Absorbance at 450 nm was detected by a BioTek Synergy H1 multimode microplate reader (BioTek, Winusky, VT, USA).

Cell morphological analysis

N2A cells of the KD and NC groups were digested and seeded at low density in a 35-mm petri dish 96 hours after the initial exposure to the lentivirus. The cells were cultured in differentiation medium (DMEM supplemented with 2% FBS, 100 U/mL penicillin - 100 μg/mL streptomycin, and 20 μM retinoic acid [Sigma-Aldrich, Cat# R2625]) for another 48 hours before being fixed in 4% paraformaldehyde. Immunofluorescence (IF) was performed as previously described (Song et al., 2022). Confocal microscopy was performed using a Leica SP8 confocal microscope. The images were processed using the ImageJ (Fiji, 1.53c) software. Only cells expressing enhanced green fluorescent protein (EGFP), a maker of successful lentivirus infection, were counted for morphological analysis. Cell length and width were measured manually using the ImageJ (1.53c) software. The results were converted to values in µm based on the magnification of the images using the “Analyze-Set Scale” tool before being used to calculate the average cell spreading areas and aspect ratios of the cells in the image. For neurite-related analysis, the percentage of neurite-growing cells of the total EGFP-expressing cells was calculated, and the average neurite number and length were measured manually using ImageJ.

Transwell experiment

The transwell experiment was performed using in-house assembled chamber inserts with a 10-μm-thick, 10-μm-pore polyethylene glycol terephthalate membrane (Safelab Technology Co., Ltd., Beijing, China) on the bottom. The membrane was coated with a 1:1 mixture of ECMGELTM (Qingdao CRPS Biotech, Cat# ECM-1A) and DMEM for better cell adhesion. N2A cells of the KD and NC groups were digested and seeded in the upper chamber of the insert 96 hours after the initial exposure to lentivirus, with the upper and lower chambers both filled with DMEM supplemented with 1% FBS. After 4 hours, the medium in the lower chamber was changed to DMEM with 10% FBS. After being cultured for another 72 hours, the cells on top of the membrane were wiped off, and the cells that migrated through the membrane were fixed in 4% paraformaldehyde, stained with crystal violet, and observed under a Nikon ECLIPSE Ti-s microscope (Nikon, Tokyo, Japan). The images were processed using the ImageJ (Fiji, 1.53c) software.

Real-time polymerase chain reaction analysis

The total RNA of the cells was extracted using TRIzolTM Reagent (Invitrogen, Carlsbad, CA, USA, Cat# 15596026). Complementary DNA was prepared using the MonScript RTIII Super Mix with dsDNase (2-step) kit (Monad, Suzhou, Jiangsu Province, China, Cat# MR05201) according to the manufacturer’s instructions. The real-time polymerase chain reaction system was prepared using the MonAmp ChemoHS qPCR Mix kit (Monad, Cat# MQ00401). The primers used in this study are listed in Additional Table 2. The mouse GAPDH gene was selected as the reference gene, and the relative expression of the target genes was calculated by normalizing the Ct values of the target genes to that of the GAPDH gene of the same sample. The PCR cycle began with a predenaturation step at 95°C for 10 minutes, followed by denaturation at 95°C for 10 seconds. This was followed by annealing and extension at 60°C for 30 seconds. These denaturation, annealing, and extension steps were repeated for 40 cycles.

Additional Table 2.

List of the primers used in this study

Gene Primer sequence (5’-3’)
AKAP9 Forward: TGAGTGAGCACCAAGCCAGAGA
Reverse: TCCTCTCCTGAATGTCTCGCTG
CDK5RAP2 Forward: GTGAGAACAGCCTTCCAGGACA
Reverse: AGGCAAGGTCATCAGGTGGACA
CENPE Forward: AGGATCATGCCACCGAGAAGAC
Reverse: GCTGTGTCTCTTGGAGTTTCTGG
CEP135 Forward: CGCTCACTTGATGACTGTCAGC
Reverse: ATGGCGTGAGTCTCTTCGCTCT
CEP152 Forward: CTACACAGCAGGCTGAGAAGGA
Reverse: TGAGGTGGTCTTTCTCCAAGCC
CEP170 Forward: CAACAGTGAGGAGGTGGAAGCA
Reverse: GCAGAGTTGAGAGCCCAGTCTT
CEP192 Forward: ACGACTCAGCTTTCAGGGTG
Reverse: GCAGCGTTAGCTTGCTTCTC
CEP290 Forward: ATGCTGACCGACAGCGGATTCT
Reverse: CTTTTCCCTGGACTGTTGTTGCG
CEP350 Forward: ATGTAACCACATCATGGGATGC
Reverse: CGGGTAGCACTTGCAGACTTC
CEP63 Forward: TCTGGAAGCACAGAGGAAGGCT
Reverse: GACTGGCTAGATAGTTCCACGG
CNKSR2 Forward: CGCCTCTTCCTTTCCCCG
Reverse: GGGTGGCTTTTGTGTTTCGG
CNTROB Forward: GATCCAGATGGAGTCAGAGCTG
Reverse: GTTGGTGCTGTCCACTCAGTTC
CP110 Forward: CAGCAGTTGTCACTCCTCATAGC
Reverse: GCACTGTTCAAGTCAGAGACGTC
DYNC1H1 Forward: GCCATCAGCAAAGACCACCTCT
Reverse: CGCCATCAAAGACAATCCACTGG
DYNC2H1 Forward: TCGCCAAGTAGTTCGTGAGCCT
Reverse: TCTCCACTAGGCATGGTGAGCA
GAPDH Forward: GGAGAAGGCCGGGGCCCACTTGAA
Reverse: GCATGGACTGTGGTCATGAGCCCTTCCAC
MKI67 Forward: GAGGAGAAACGCCAACCAAGAG
Reverse: TTTGTCCTCGGTGGCGTTATCC
ODF2 Forward: ATGTGGGATGCAAGTGGGAG
Reverse: GTGTCTGAGCACCGTGTTCT
PCNT Forward: GAGGAGAAGTCGGTCTTGTGGA
Reverse: GCGGTCCTTTTCAGACTGCTTC
POC5 Forward: TCTACTCGGACAGATGCCCATG
Reverse: GCCAGTCGATAAAGTTCAGCCTC
Tubulinβ Forward: GGCAGTGTTCGTAGACCTGGAA
Reverse: CTCCTTGCCAATGGTGTAGTGG
Open in a new tab

AKAP9: A-kinase anchor protein 9; CDK5RAP2: CDK5 regulatory subunit associated protein 2; CENPE: centromere-associated protein E; CEP135: centrosomal protein of 135 kDa; CEP152: centrosomal protein of 152 kDa; CEP170: centrosomal protein of 170 kDa; CEP192: centrosomal protein of 192 kDa; CEP290: centrosomal protein of 290 kDa; CEP350: centrosomal protein of 350 kDa; CEP63: centrosomal protein of 63 kDa; CNKSR2: Connector Enhancer of Kinase Suppressor of Ras 2; CNTROB: Centrobin; CP110: centriolar coiled-coil protein 110; DYNC1H1: dynein cytoplasmic 1 heavy chain 1; DYNC2H1 : dynein cytoplasmic 2 heavy chain 1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; MKI67: proliferation marker protein Ki-67; ODF2: outer dense fiber of sperm tails 2; PCNT: Pericentrin; POC5: protein of centriole 5.

Statistical analysis

For each analysis in this study, at least three biological replicates were performed, and the data are presented as mean ± standard deviation. Raw data were first processed using Microsoft Excel, and the statistical analyses and graphing were performed using GraphPad Prism (8.0.2 software for Windows, GraphPad Software, Boston, MA, USA, www.graphpad.com). The Shapiro–Wilk normality test was used to test the normal distribution of each sample group, and the F test was used to check the homogeneity of variance. Statistical significance was calculated using the unpaired two-tailed Student’s t-test. P < 0.05 was considered significant.

Results

An overview of the CNKSR2 interactome suggests its association with the microtubule and centrosome

Previous studies (Lim et al., 2014; Li et al., 2017; Ito et al., 2021; Maruo et al., 2023) have shown that CNKSR2 is widely localized in the cytoplasm and membrane-related structures within the cell. This study used two types of lysis buffers, with either the detergent Triton X-100 or DOC, to obtain as many proteins as possible from the mouse prefrontal cortex. The detergents DOC and Triton X-100 differ in chemical structures and properties, which influences their behavior and effect in biological applications. The anionic detergent DOC is a bile acid derivative with a steroid structure, making it amphipathic and suitable for solubilizing membrane proteins. Triton X-100 is a non-ionic detergent, milder than DOC, and less likely to denature proteins. Furthermore, DOC dissolves under high pH (pH 9) conditions, whereas the pH of the Triton buffer is 7.4, which is closer to the in vivo condition and is beneficial to the stability of certain protein complexes (Coba et al., 2009; Yu et al., 2013). In our previous experience, we found DOC retrieved more membrane-associated protein complexes, whereas the Triton lysates preserved unique PPIs (Li et al., 2017).

We considered proteins with at least two unique peptides as confident identifications. Under this criterion, 392 and 187 proteins were identified in the DOC and Triton lysates, respectively. We used IgG as the negative control for the IP experiments, and proteins that appeared in the IgG interactomes were excluded from the CNKSR2 interactome as non-specific binders in the corresponding lysates. Dozens of proteins, including many histone and ribosome subunits, were filtered out in this step, leaving 300 proteins in the DOC lysates and 108 in the Triton lysates, accepted as the real interactors of CNKSR2 (Additional Table 3 (268.8KB, pdf) ). Of these 353 proteins, 55 were identified in both groups, and 245 and 53 proteins appeared in only the DOC and Triton lysates, respectively (Figure 1A). Relative quantification of the CNKSR2 interactome at different developmental stages (E14, P7, P14, and adult) of the mouse brain using the iTRAQ labeling reagents showed no statistically significant changes for most of the identified proteins (Additional Table 3 (268.8KB, pdf) ). Therefore, for the subsequent analyses, we considered the identified proteins as CNKSR2 interactors and did not assess their changes at the different developmental stages.

Figure 1.

Figure 1

Open in a new tab

Overview of the CNKSR2 interactome identified in this study.

(A) CNKSR2 interactors identified in the DOC and Triton lysates. (B) Molecular function analysis of the CNKSR2 interactors. (C, D) Pathway and process enrichment analysis of the CNKSR2 interactors identified in the DOC (C) and Triton (D) lysates. The color coding of the protein networks corresponds to that of the biological processes in C and D. CNKSR2: Connector enhancer of kinase suppressor of Ras 2; DOC: sodium deoxycholate.

Molecular function analysis of the proteins using the online bioinformatic platform STRING highlighted terms related to molecular binding, consistent with the molecular function of CNKSR2 as a scaffolding protein. Figure 1B shows the top 10 Gene Ontology – molecular function terms with the smallest adjusted P values.

We then used the online bioinformatic tool Metascape for the annotation and functional analysis of the identified CNKSR2 interactors. Pathway and process enrichment analysis showed that CNKSR2 interactors were closely associated with microtubule cytoskeleton organization and related cellular functions such as projection morphogenesis and cellular transport and trafficking (Figure 1C and D).

Organelle enrichment analysis was performed to better understand how CNKSR2 is localized within cells. The CNKSR2 interactors showed significant enrichment in the centrosome proteome in both the DOC and Triton groups. In the DOC group, the CNKSR2 interactors were also significantly enriched in the PSD proteome (Figure 2A and B).

Figure 2.

Figure 2

Open in a new tab

Association of the CNKSR2 interactome with the centrosome.

(A, B) Organelle enrichment analysis of the CNKSR2 interactors identified in DOC (A) and Triton (B) lysates. (C) IP-WB assays to verify the interactions of CNKSR2 with CEP290 and DYNC1H1 in the DOC lysates of adult mice prefrontal cortex. (D) Coimmunostaining of CNKSR2 (green, CoraLite647) and CEP63 (red, Alexa Fluor 546) in N2A cells. DAPI was used to stain the nucleus (blue). Arrows indicate the colocalization of CNKSR2 and CEP63. Scale bars: 10 µm. CEP290: Centrosomal protein of 290 kDa; CEP63: centrosomal protein of 63 kDa; CNKSR2: connector enhancer of kinase suppressor of Ras 2; DAPI: 4′,6-diamidino-2-phenylindole; DOC: sodium deoxycholate; DYNC1H1: dynein cytoplasmic 1 heavy chain 1; IF: immunofluorescence; IP: immunoprecipitation; N2A: Neuro 2A; WB: western blot.

We used reciprocal IP-WB assays to verify the association between CNKSR2 and the microtubule and centrosome. We identified the microtubule protein dynein cytoplasmic 1 heavy chain 1 (DYNC1H1) and the centrosome marker CEP290 as CNKSR2 interactors in the DOC lysates. We precipitated the complexes of these two proteins and found CNKSR2 in both coprecipitated samples, confirming the interactions between CNKSR2 and each of these two proteins and further supporting the link of CNKSR2 with the microtubule and centrosome structures (Figure 2C).

Using CEP63 as a centrosome marker, we performed coimmunostaining of CNKSR2 and CEP63. The confocal images showed colocalization of these two proteins, confirming the centrosomal localization of CNKSR2 (Figure 2D).

CNKSR2 interactome is associated with the proximal region of the centrosome

The centrosome is composed of several specific regions with distinct functions. A recent study of the spatial centrosome proteome used an affinity purification strategy to target 10 “bait” proteins localized at different centrosomal regions and profiled their interactomes (O’Neill et al., 2022). These 10 proteins, which are essential for centrosome function, included the distal tip marker centriolar coiled-coil protein 110 (CP110), the distal lumen marker centrosomal protein of centriole 5 (POC5), the distal appendages marker outer dense fiber of sperm tails 2 (ODF2, also called Cenexin), the subdistal appendages markers ODF2 and CEP170, the proximal markers CEP63 and CEP152, the cartwheel assembly marker CEP135, the pericentriolar material (PCM) markers CDK5 regulatory subunit associated protein 2 (CDK5RAP2), CEP192 and CEP152, and the PCM core marker Centrobin (CNTROB). Of these, CDK5RAP2 and CEP135 were identified as CNKSR2 interactors in our study (Additional Table 3 (268.8KB, pdf) ).

We overlaid our identified proteins with these datasets to map the sub-centrosomal distribution of the CNKSR2 interactors. The most overlap was found between the CNKSR2 interactome and the interactome of the proximal region marker CEP63 (Figure 3), indicating a close relationship between CNKSR2 and the proximal region. The proximal region is the area of the centrosome where the two cylindrical centrioles are located, and is responsible for linking the two centrioles together and maintaining their orientation. The proximal region of the mother centriole locates the specialized structure cartwheel, which acts as the scaffold for assembling new daughter centrioles. Several CNKSR2 interactors also had a cartwheel assembly-related location (Figure 3), which is consistent with the adjacent position of the proximal region and the cartwheel structure.

Figure 3.

Figure 3

Open in a new tab

Analysis of the sub-centrosome distribution of the CNKSR2 interactors.

(A, B) The chord diagrams illustrated the presence of CNKSR2 interactors identified in DOC (A) and Triton (B) lysates in the sub-centrosomal marker interactomes. The identified CNKSR2 interactors were overlaid on published sub-centrosomal marker interactomes (O’Neill et al., 2022), and chords were drawn between the protein and the corresponding sub-centrosomal marker interactomes. The color coding is the same for A and B. CDK5RAP2: CDK5 regulatory subunit associated protein 2; CEP135: centrosomal protein of 135 kDa; CEP152: centrosomal protein of 152 kDa; CEP170: centrosomal protein of 170 kDa; CEP192: centrosomal protein of 192 kDa; CEP63: centrosomal protein of 63 kDa; CNKSR2: Connector Enhancer of Kinase Suppressor of Ras 2; CNTROB: Centrobin; CP110: centriolar coiled-coil protein 110; DOC: sodium deoxycholate; ODF2: outer dense fiber of sperm tails 2; POC5: protein of centriole 5.

CNKSR2 knockdown disturbs centrosome-related functions

The centrosome plays crucial roles in a variety of cellular functions associated with the microtubule cytoskeleton, affecting cell size and shape, cell cycle, cell migration, and cilia formation (Nigg and Raff, 2009; Conduit et al., 2015; O’Neill et al., 2022). Thus, we down-regulated CNKSR2 expression in N2A cells (Figure 4A) and examined a range of cellular processes related to the microtubule cytoskeleton and centrosome.

Figure 4.

Figure 4

Open in a new tab

CNKSR2 knockdown disturbs centrosome-related functions.

(A) Western blot analysis of CNKSR2 expression in N2A cells infected with CNKSR2 KD and NC lentivirus (n = 3). (B) Typical IF images of N2A cells showed that cells in the CNKSR2 KD group were smaller and rounder than those in the NC group. DAPI was used to stain nuclei (blue). EGFP proteins (green) were expressed by the lentivirus-infected cells. Immunostaining of α-tubulin (red, Alexa Fluor 546) in N2A cells. Scale bars: 10 µm. (C, D) Statistical analysis of the average cell spreading area (C) and cell aspect ratio (D) of N2A cells infected with the lentiviruses (n = 11 images from three biological replicates; the total number of cells quantified was 268 in the CNKSR2 KD group and 151 in the NC group). (E) CCK8 analysis of N2A cells infected with the lentiviruses (n = 3). (F) RT-PCR analysis of MKI67 gene expression in N2A cells infected with the lentiviruses (n = 6). (G) Typical images of the Transwell assays showed that N2A cells in the CNKSR2 KD group had higher motility than those in the NC group (n = 10). Scale bars: 100 µm. Data are presented as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001 (unpaired two-tailed Student’s t-test). CCK8: cell counting kit-8; CNKSR2: connector enhancer of kinase suppressor of Ras 2; DAPI: 4′,6-diamidino-2-phenylindole; EGFP: enhanced green fluorescent protein; GAPDH: glyceraldehyde-3-phosphate dehydrogenase IF: immunofluorescence; KD: knock down; MKI67: proliferation marker protein Ki-67; N2A: Neuro 2A; NC: negative control; ns: no significance; RT-PCR: real-time polymerase chain reaction.

The centrosome regulates the distribution and arrangement of microtubules, which are composed of alternating α-tubulin and β-tubulin subunits (Murphy and Stearns, 1996; Conduit et al., 2015; Petry and Vale, 2015; Akhmanova and Kapitein, 2022) Through fluorescent immunoimaging of α-tubulin, we examined the morphology of N2A cells in the CNKSR2 KD and NC groups (Figure 4B). Statistical analysis showed that the cells in the KD group were smaller than those in the NC group, and had a more rounded morphology with a lower length/width ratio of the cell body than that of the NC group (Figure 4C and D).

Differentiation culture conditions promote neurite outgrowth in N2A cells (Mao et al., 2000; Zeng and Zhou, 2008) visible with α-tubulin immunoimaging. After being seeded and cultured in the differentiation medium for 48 hours, approximately 20%–60% of the cells in each group had neurite outgrowth. There were no statistically significant differences in the percentages of neurite-growing cells, the average neurite number per cell, and mean neurite length (Additional Figure 1 (15MB, tif) ), indicating that CNKSR2 did not have a notable impact on the formation of cell projections.

The centrosome also plays a role in cell proliferation. Thus, we used CCK8 assay to examine the effect of CNKSR2 downregulation on cell proliferation. OD450 values of the CNKSR2 KD group were markedly lower than those of the NC group, suggesting that CNKSR2 plays a role in cell proliferation (Figure 4E). Consistent with this, real-time polymerase chain reaction showed that CNKSR2 knockdown led to the reduced gene expression of the proliferation marker MKI67 (Figure 4F).

Centrosomes influence cell migration by orienting the microtubule cytoskeleton and regulating microtubule dynamics, providing directionality and stability during cell movement (Conduit et al., 2015; Petry and Vale, 2015). We performed Transwell experiments to assess the effect of CNKSR2 knockdown on cell motility. Down-regulating CNKSR2 expression enhanced the motility of N2A cells. Compared with that in the NC group, more cells passed through the pores to the other side of the membrane in the CNKSR2 KD group (Figure 4G), indicating that CNKSR2 was involved in regulating cell migration.

CNKSR2 knockdown affects expression of centrosome and microtubule genes

Given the extensive effects of CNKSR2 knockdown on centrosome-related functions in N2A cells, we examined the expression level of several microtubule and centrosome-related proteins after downregulating CNKSR2 (Figure 5). CNKSR2 KD had no effect on the expression of α-tubulin. The gene expression of many CNKSR2 interactors decreased with the downregulation of CNKSR2. These microtubule and centrosome-related CNKSR2 interactors included the heavy chains of the motor protein cytoplasmic dynein (DYNC1H1 and DYNC2H1), the scaffolding protein A-kinase anchor protein 9 (AKAP9), and centromere-associated protein E (CENPE), CEP290, CEP350, and Pericentrin (PCNT). For the sub-centrosomal markers, CNKSR2 knockdown lowered the expression of CDK5RAP2, CEP63, CEP135, CEP152, CEP170, CEP192 and CP110. CNKSR2 had no significant effects on gene expression of the PCM core marker CNTROB, the distal appendages marker ODF2, and the distal lumen marker POC5.

Figure 5.

Figure 5

Open in a new tab

CNKSR2 knockdown affects centrosome/microtubule gene expression.

RT-PCR analysis of the expression of the centrosomal and microtubule-related genes of N2A cells infected with the CNKSR2 KD and NC lentiviruses. Data are presented as mean ± SD (n = 6). *P < 0.05, **P < 0.01, ***P < 0.001 (unpaired two-tailed Student’s t-test). AKAP9: A-kinase anchor protein 9; CDK5RAP2: CDK5 regulatory subunit associated protein 2; CENPE: centromere-associated protein E; CEP135: centrosomal protein of 135 kDa; CEP152: centrosomal protein of 152 kDa; CEP170: centrosomal protein of 170 kDa; CEP192: centrosomal protein of 192 kDa; CEP290: centrosomal protein of 290 kDa; CEP350: centrosomal protein of 350 kDa; CEP63: centrosomal protein of 63 kDa; CNKSR2: Connector Enhancer of Kinase Suppressor of Ras 2; CNTROB: Centrobin; CP110: centriolar coiled-coil protein 110; DYNC1H1: dynein cytoplasmic 1 heavy chain 1; DYNC2H1: dynein cytoplasmic 2 heavy chain 1; KD: knock down; N2A: Neuro 2A; NC: negative control; ns: no significance; ODF2: outer dense fiber of sperm tails 2; PCNT: Pericentrin; POC5: protein of centriole 5; RT-PCR: real-time polymerase chain reaction.

Autism-related risk genes are enriched in the CNKSR2 interactome

Research over the past decades has resulted in the prevailing view that CNKSR2 is a risk gene for neurodevelopmental diseases; however, the etiology has been largely unknown. We used the CNKSR2 interactome datasets to investigate etiological relevance in neurodevelopmental disorders. We compared our identified CNKSR2 interactors with genes harboring rare de novo variants (DNVs) reported previously in patients with different neurodevelopmental diseases, including ASD (Lim et al., 2017), epileptic encephalopathies (EE) (Epi4K Consortium et al., 2013), ID (de Ligt et al., 2012; Rauch et al., 2012; Hamdan et al., 2014), periventricular heterotopia (Heinzen et al., 2018), and polymicrogyria (Epilepsy Phenome/Genome Project and Epi4K Consortium, 2021). Comparing the CNKSR2 interactome with the neurodevelopmental disease cohorts identified extensive overlap between CNKSR2 interactors and ASD-related genes (Figure 6). In the CNKSR2 interactome, 97 proteins had reported DNVs in ASD, with a fold enrichment of 2.09 and an adjusted P value of 1.88 × 10–12. Additionally, 15 proteins in the CNKSR2 interactome had reported DNVs in the EE patient cohort, showing a certain degree of enrichment (adjusted P value 0.0048), consistent with the reports that mutations in the CNKSR2 gene were associated with some brain disorders with epileptic symptoms (Bonardi et al., 2020; Higa et al., 2021).

Figure 6.

Figure 6

Open in a new tab

Enrichment analysis of the CNKSR2 interactome in the genes harboring neurodevelopmental disease-related de novo variants.

CNKSR2 interactors identified in the study were compared with the genes harboring rare de novo variants reported in patients with different neurodevelopmental diseases, and enrichment analysis was performed to determine the association of CNKSR2 interactome with these diseases. ASD: Autism spectrum disorder; CNKSR2: connector enhancer of kinase suppressor of Ras 2; EE: epileptic encephalopathies; ID: intellectual disability; PH: periventricular heterotopia; PMG: polymicrogyria.

To determine whether the etiology of neurodevelopmental diseases relates to the dysfunction of a particular organelle, we overlaid the major organelle proteomes with the neurodevelopmental disease-associated DNVs and performed enrichment analyses. In the DNV sets associated with different neurodevelopmental diseases, distinct enrichment profiles of each organelle proteome were observed (Additional Figure 2 (18.6MB, tif) ). Most organelles, such as mitochondrion, endoplasmic reticulum, and Golgi apparatus, did not show enrichment in any of these disease-related DNVs. In contrast, postsynaptic proteins were significantly enriched in the ASD, ID, and EE cohorts. Centrosomal proteins were also significantly enriched in the ASD cohort, suggesting a possible centrosome-related etiology of patients harboring a CNKSR2 mutation.

Discussion

A previous study initially suggested that the loss-of-function CNKSR2 mutation may be a cause of nonsyndromic X-linked ID (Houge et al., 2012). Since then, increasing studies have supported the association of CNKSR2 and neurodevelopmental disorders, especially the involvement of CNKSR2 variants in ID (Houge et al., 2012; Vaags et al., 2014; Aypar et al., 2015; Hu et al., 2016; Damiano et al., 2017; Sun et al., 2018; Polla et al., 2019). By comparing the identified CNKSR2 interaction group with disease-related gene datasets, we found that CNKSR2 interactors were markedly enriched in the ASD-related gene set in addition to the ID-related gene set. This finding is consistent with the recent reports that CNKSR2 mutations were found in ASD patients (Mathieu et al., 2018; Sun et al., 2018; Higa et al., 2021; Toraman et al., 2021), indicating that CNKSR2 may play an essential role in the underlying mechanism of ASD.

Although ID and ASD have similarities (they both have early onset, are developmental disorders, and may be accompanied by multiple conditions), they are distinct disorders (Wilfert et al., 2017; Griff et al., 2023; Wang et al., 2024). The main feature of ID is intelligence deficiency, whereas the primary manifestation of ASD is abnormal socialization, communication, and behavior. In contrast, to the typical intelligence deficits in people with ID, there are remarkable differences in intelligence levels in people with ASD, and some ASD patients may have average or even higher-than-average intelligence. The causes of ID are diverse, including genetic mutations, chromosomal abnormalities, gestational diseases, or hypoxia, whereas the cause of ASD is not fully understood and may be related to genetic, environmental, and neurodevelopmental factors. Regarding their molecular mechanisms, existing studies have shown that ID and ASD are heterogeneous diseases (Wilfert et al., 2017). According to published studies and our analysis of the CNKSR2 interactome, CNKSR2 shows a relevant link with both ID and ASD, suggesting that CNKSR2 may play a vital role in certain pancellular functions, and its mutations may lead to impaired cellular physiological activities and processes, which in turn lead to symptoms common to ID and ASD.

Our study showed that CNKSR2 was closely associated with the centrosome/microtubule system, and CNKSR2 knockdown affected the expression of multiple centrosome/microtubule-related genes, influencing cell size, morphology, and the ability to proliferate and migrate. The centrosome is an essential organelle of animal cells, playing a vital role in microtubule organization, spindle production, cell polarity maintenance, and cellular component transport. Damage to centrosome structure and function causes extensive cell dysfunction, studies have shown that neurons are susceptible to microtubule defects (Sferra et al., 2020), and the centrosome participates in neuronal differentiation, polarity, cell division, and neuronal development (Meka et al., 2020). Our organelle-disease enrichment analysis showed that in addition to PSD proteins, centrosomal proteins were enriched in the ASD-related gene cohort, consistent with the previous study of the centrosome proteome of human neural cells (O’Neill et al., 2022).

Thus, the widespread effect of CNKSR2 variants on cells may be partly caused by affecting the structural and functional integrity of the centrosome. CNKSR2 is a scaffolding protein with multiple protein domains, allowing it to interact with many proteins. CNKSR2 knockdown reduced the expression of several centrosomal proteins. Considering that CNKSR2 serves as a vital scaffold to organize multiprotein complexes in the centrosome, these findings suggest that when CNKSR2 decreases, the CNKSR2 complex recruits less of its interactors, causing more of these proteins to be released in the cytoplasm, which then triggers feedback suppression mechanisms, leading to the decreased expression of these proteins, and ultimately compromising the integrity and functionality of the centrosome. The direct interactors of CNKSR2 and the roles they play in the centrosome are important questions worth further investigation.

The primary cilium is a hair-like structure that protrudes from the surface of most mammalian cells. It comprises microtubules and is anchored in the cell by the basal body, derived from the centrosome’s mother centriole (Joukov and De Nicolo, 2019). The primary cilium is a sensory organelle playing an important role in cell signaling and communication with the external environment, and a recent study has proposed an association of its dysfunction with neurodevelopmental disorders (Lee et al., 2020). In the present study, we found a few primary cilium-related proteins in the identified CNKSR2 interactors, including CEP290, C2 domain containing 3 centriole elongation regulator (C2CD3), HYDIN axonemal central pair apparatus protein (HYDIN), ELMO domain containing 3 (ELMOD3), FAM161 centrosomal protein a (FAM161a) and kinesin family member 7 (KIF7), which are involved in the formation and motility of the primary cilia, and their mutations are associated with ciliopathy disorders (Hoover et al., 2008; Lechtreck et al., 2008; Di Gioia et al., 2012; Olbrich et al., 2012; Thauvin-Robinet et al., 2014; Kilander et al., 2018; Wu et al., 2020; Turn et al., 2022; Shapiro et al., 2023). Such relationships suggest that the pathogenic mechanism of CNKSR2 mutations in neurodevelopmental diseases might also stem from compromised ciliary structure and function.

This study had several limitations. We were unable to identify the direct interacting proteins of CNKSR2 at the centrosome and thus were unable to clarify the specific role and molecular mechanism of CNKSR2 in centrosome organization and function. Regarding the experimental techniques, we noticed that in the IP-WB experiment, the target bands of the IP samples were somewhat higher than the corresponding bands of the Input samples. This phenomenon might be caused by the high concentration of salts, glycerol, and SDS in the IP samples because we used 40 μL 2× sample loading buffer to eluate the binding proteins from the beads, and the resulting eluates were further concentrated to reduce the sample loading volume. The high concentrations of salts, glycerol, and SDS in the IP samples may influence the electrophoresis process, resulting in smeared bands and slower migration of proteins (See et al., 1985; Shirai et al., 2008). This technical issue should be addressed in future research.

In summary, by identifying and analyzing the CNKSR2 interactors, we found that CNKSR2 was located in the centrosome and associated with many centrosome/microtubule proteins. Downregulating CNKSR2 affected the expression of many centrosomal proteins and affected the spreading area, morphology, proliferation, and motility of N2A cells. Given that the CNKSR2 variants are implicated in a variety of neurodevelopmental diseases, our findings provide a foundation for exploring the pathogenic mechanisms related to this protein of interest.

Additional files:

Additional Figure 1 (15MB, tif) : Knocking down CNKSR2 does not have a significant effect on N2a cell neurites.

Additional Figure 1

Knocking down CNKSR2 does not have a significant effect on N2a cell neurites.

(A) The typical IF images of the N2A cells showed no significant differences regarding the percentages of neurite-growing cells, the average neurite numbers per cell, and mean neurite lengths between the CNKSR2 KD and NC groups. DAPI stained the nucleus (blue). EGFP proteins (green) were expressed by the lentivirus-infected cells. The α-tubulin proteins (red, Alexa Fluor 546) in the N2A cells were immunostained. Arrows indicate neurites. Scale bars: 10 μm. (B-D) Statistical analysis of the percentages of neurite-growing cells (B), and the average neurite numbers (C) and neurite lengths (D) of these cells in the CNKSR2 KD and NC groups. N = 11 microscopic photos from three biological replicates; the total number of cells quantified was 109 in the CNKSR2 KD group and 57 in the NC group, respectively. Data are presented as mean ± SD, and were analyzed by unpaired two-tailed Student’s t-test. CNKSR2: Connector enhancer of kinase suppressor of Ras 2; DAPI: 4’,6-diamidino-2-phenylindole; EGFP: enhanced green fluorescent protein; IF: immunofluorescence; KD: knock down; N2A: Neuro 2A; NC: negative control; ns: no significance.

Additional Figure 2 (18.6MB, tif) : Enrichment analysis of the organelle proteomes in the genes harboring neurodevelopmental disease-related DNVs.

Additional Figure 2

Enrichment analysis of the organelle proteomes in the genes harboring neurodevelopmental disease-related de novo variants.

Organelle proteomes were overlaid with the genes harboring rare de novo variants reported in patients with different neurodevelopmental diseases, and enrichment analysis was performed to study the association of the organelles with these diseases. ASD: Autism spectrum disorder, EE: epileptic encephalopathies, ID: intellectual disability, PH: periventricular heterotopia, PMG: polymicrogyria.

NRR-20-2420_Suppl2.tif (18.6MB, tif)

Additional Table 1: List of the antibodies used in this study.

Additional Table 2: List of the primers used in this study.

Additional Table 3 (268.8KB, pdf) : List of the CNKSR2 interactors identified in this study.

Additional Table 3

List of the CNKSR2 interactors identified in this study

NRR-20-2420_Suppl1.pdf (268.8KB, pdf)

Acknowledgments:

We thank Dr. Marcelo Coba from the Zilkha Neurogenetic Institute, University of Southern California, for his insightful discussions and valuable suggestions in our research work. We thank Lulu Song and Guangdong Mei at the Animal Facility of the Biomedical Center of Qingdao University for their assistance and support during this study. We also thank Zhishang Chang, Qian Wen, and Xuxia Song from the Laboratory of Biomedical Center, Qingdao University, for their technical help in confocal microscopy.

Funding Statement

Funding: This work was supported by the National Nature Science Foundation of China, No. 32101020 (to JL); the Natural Science Foundation of Shandong Province, Nos. ZR2020MC071 (to JL), ZR2023MH327 (to HZ); the Integrated Project of Major Research Plan of National Natural Science Foundation of China, No. 92249303 (to PL); and the Natural Science Foundation of Qingdao, No. 23-2-1-193-zyyd-jch (to HZ).

Footnotes

Conflicts of interest: All authors declare that they have no conflicts of interest.

C-Editor: Zhao M; S-Editors: Yu J, Li CH; L-Editors: McCollum L, Yu J, Song LP; T-Editor: Jia Y

Data availability statement:

Data supporting the findings of this study are available within the article and its supplementary material; additional supporting data are available from the corresponding author upon reasonable request.

References

  1. Akhmanova A, Kapitein LC. Mechanisms of microtubule organization in differentiated animal cells. Nat Rev Mol Cell Biol. 2022;23:541–558. doi: 10.1038/s41580-022-00473-y. [DOI] [PubMed] [Google Scholar]
  2. Alves-Cruzeiro JM, Nogales-Cadenas R, Pascual-Montano AD. CentrosomeDB: a new generation of the centrosomal proteins database for human and Drosophila melanogaster. Nucleic Acids Res. 2014;42:D430–436. doi: 10.1093/nar/gkt1126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aypar U, Wirrell EC, Hoppman NL. CNKSR2 deletions: a novel cause of X-linked intellectual disability and seizures. Am J Med Genet A. 2015;167:1668–1670. doi: 10.1002/ajmg.a.36902. [DOI] [PubMed] [Google Scholar]
  4. Bonardi CM, Mignot C, Serratosa JM, Giraldez BG, Moretti R, Rudolf G, Reale C, Gellert PM, Johannesen KM, Lesca G, Tassinari CA, Gardella E, Møller RS, Rubboli G. Expanding the clinical and EEG spectrum of CNKSR2-related encephalopathy with status epilepticus during slow sleep (ESES) Clin Neurophysiol. 2020;131:1030–1039. doi: 10.1016/j.clinph.2020.01.020. [DOI] [PubMed] [Google Scholar]
  5. Coba MP, Pocklington AJ, Collins MO, Kopanitsa MV, Uren RT, Swamy S, Croning MD, Choudhary JS, Grant SG. Neurotransmitters drive combinatorial multistate postsynaptic density networks. Sci Signal. 2009;2:ra19. doi: 10.1126/scisignal.2000102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Conduit PT, Wainman A, Raff JW. Centrosome function and assembly in animal cells. Nat Rev Mol Cell Biol. 2015;16:611–624. doi: 10.1038/nrm4062. [DOI] [PubMed] [Google Scholar]
  7. Damiano JA, Burgess R, Kivity S, Lerman-Sagie T, Afawi Z, Scheffer IE, Berkovic SF, Hildebrand MS. Frequency of CNKSR2 mutation in the X-linked epilepsy-aphasia spectrum. Epilepsia. 2017;58:e40–e43. doi: 10.1111/epi.13666. [DOI] [PubMed] [Google Scholar]
  8. de Ligt J, Willemsen MH, van Bon BW, Kleefstra T, Yntema HG, Kroes T, Vulto-van Silfhout AT, Koolen DA, de Vries P, Gilissen C, del Rosario M, Hoischen A, Scheffer H, de Vries BB, Brunner HG, Veltman JA, Vissers LE. Diagnostic exome sequencing in persons with severe intellectual disability. N Engl J Med. 2012;367:1921–1929. doi: 10.1056/NEJMoa1206524. [DOI] [PubMed] [Google Scholar]
  9. Di Gioia SA, Letteboer SJ, Kostic C, Bandah-Rozenfeld D, Hetterschijt L, Sharon D, Arsenijevic Y, Roepman R, Rivolta C. FAM161A, associated with retinitis pigmentosa, is a component of the cilia-basal body complex and interacts with proteins involved in ciliopathies. Hum Mol Genet. 2012;21:5174–5184. doi: 10.1093/hmg/dds368. [DOI] [PubMed] [Google Scholar]
  10. Epi4K Consortium , et al. De novo mutations in epileptic encephalopathies. Nature. 2013;501:217–221. doi: 10.1038/nature12439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Epilepsy Phenome/Genome Project, Epi4K Consortium Diverse genetic causes of polymicrogyria with epilepsy. Epilepsia. 2021;62:973–983. doi: 10.1111/epi.16854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fromer M, et al. De novo mutations in schizophrenia implicate synaptic networks. Nature. 2014;506:179–184. doi: 10.1038/nature12929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fu CA, Shen M, Huang BC, Lasaga J, Payan DG, Luo Y. TNIK, a novel member of the germinal center kinase family that activates the c-Jun N-terminal kinase pathway and regulates the cytoskeleton. J Biol Chem. 1999;274:30729–30737. doi: 10.1074/jbc.274.43.30729. [DOI] [PubMed] [Google Scholar]
  14. Griff JR, Langlie J, Bencie NB, Cromar ZJ, Mittal J, Memis I, Wallace S, Marcillo AE, Mittal R, Eshraghi AA. Recent advancements in noninvasive brain modulation for individuals with autism spectrum disorder. Neural Regen Res. 2023;18:1191–1195. doi: 10.4103/1673-5374.360163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hamdan FF, Srour M, Capo-Chichi JM, Daoud H, Nassif C, Patry L, Massicotte C, Ambalavanan A, Spiegelman D, Diallo O, Henrion E, Dionne-Laporte A, Fougerat A, Pshezhetsky AV, Venkateswaran S, Rouleau GA, Michaud JL. De novo mutations in moderate or severe intellectual disability. PLoS Genet. 2014;10:e1004772. doi: 10.1371/journal.pgen.1004772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Heinzen EL, O’Neill AC, Zhu X, Allen AS, Bahlo M, Chelly J, Chen MH, Dobyns WB, Freytag S, Guerrini R, Leventer RJ, Poduri A, Robertson SP, Walsh CA, Zhang M. De novo and inherited private variants in MAP1B in periventricular nodular heterotopia. PLoS Genet. 2018;14:e1007281. doi: 10.1371/journal.pgen.1007281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Higa LA, Wardley J, Wardley C, Singh S, Foster T, Shen JJ. CNKSR2-related neurodevelopmental and epilepsy disorder: a cohort of 13 new families and literature review indicating a predominance of loss of function pathogenic variants. BMC Med Genomics. 2021;14:186. doi: 10.1186/s12920-021-01033-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hoover AN, Wynkoop A, Zeng H, Jia J, Niswander LA, Liu A. C2cd3 is required for cilia formation and Hedgehog signaling in mouse. Development. 2008;135:4049–4058. doi: 10.1242/dev.029835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Houge G, Rasmussen IH, Hovland R. Loss-of-function CNKSR2 mutation is a likely cause of non-syndromic X-linked intellectual disability. Mol Syndromol. 2012;2:60–63. doi: 10.1159/000335159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hu H, et al. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes. Mol Psychiatry. 2016;21:133–148. doi: 10.1038/mp.2014.193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ito H, Morishita R, Noda M, Ishiguro T, Nishikawa M, Nagata KI. The synaptic scaffolding protein CNKSR2 interacts with CYTH2 to mediate hippocampal granule cell development. J Biol Chem. 2021;297:101427. doi: 10.1016/j.jbc.2021.101427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Joukov V, De Nicolo A. The centrosome and the primary cilium: the Yin and Yang of a hybrid organelle. Cells. 2019;8:701. doi: 10.3390/cells8070701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kang Q, Yang L, Liao H, Wu L, Chen B, Yang S, Kuang X, Yang H, Liao C. CNKSR2 gene mutation leads to Houge type of X-linked syndromic mental retardation: a case report and review of literature. Medicine (Baltimore) 2021;100:e26093. doi: 10.1097/MD.0000000000026093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kilander MBC, Wang CH, Chang CH, Nestor JE, Herold K, Tsai JW, Nestor MW, Lin YC. A rare human CEP290 variant disrupts the molecular integrity of the primary cilium and impairs Sonic Hedgehog machinery. Sci Rep. 2018;8:17335. doi: 10.1038/s41598-018-35614-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Knight HM, Demirbugen Öz M, PerezGrovas-Saltijeral A. Dysregulation of RNA modification systems in clinical populations with neurocognitive disorders. Neural Regen Res. 2024;19:1256–1261. doi: 10.4103/1673-5374.385858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lanigan TM, Liu A, Huang YZ, Mei L, Margolis B, Guan KL. Human homologue of Drosophila CNK interacts with Ras effector proteins Raf and Rlf. FASEB J. 2003;17:2048–2060. doi: 10.1096/fj.02-1096com. [DOI] [PubMed] [Google Scholar]
  27. Lechtreck KF, Delmotte P, Robinson ML, Sanderson MJ, Witman GB. Mutations in Hydin impair ciliary motility in mice. J Cell Biol. 2008;180:633–643. doi: 10.1083/jcb.200710162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lee B, Panda S, Lee HY. Primary ciliary deficits in the dentate gyrus of fragile X syndrome. Stem Cell Reports. 2020;15:454–466. doi: 10.1016/j.stemcr.2020.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lee SH, Jung EM. Adverse effects of early-life stress: focus on the rodent neuroendocrine system. Neural Regen Res. 2024;19:336–341. doi: 10.4103/1673-5374.377587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Li J, Wilkinson B, Clementel VA, Hou J, O’Dell TJ, Coba MP. Long-term potentiation modulates synaptic phosphorylation networks and reshapes the structure of the postsynaptic interactome. Sci Signal. 2016;9:rs8. doi: 10.1126/scisignal.aaf6716. [DOI] [PubMed] [Google Scholar]
  31. Li J, Zhang W, Yang H, Howrigan DP, Wilkinson B, Souaiaia T, Evgrafov OV, Genovese G, Clementel VA, Tudor JC, Abel T, Knowles JA, Neale BM, Wang K, Sun F, Coba MP. Spatiotemporal profile of postsynaptic interactomes integrates components of complex brain disorders. Nat Neurosci. 2017;20:1150–1161. doi: 10.1038/nn.4594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Li K, Savitska D, Garaschuk O. K+ channel-mediated retarded maturation of interneurons and its role in neurodevelopmental disorders. Neural Regen Res. 2024;19:1403–1404. doi: 10.4103/1673-5374.386409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lim ET, et al. Rates, distribution and implications of postzygotic mosaic mutations in autism spectrum disorder. Nat Neurosci. 2017;20:1217–1224. doi: 10.1038/nn.4598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lim J, Ritt DA, Zhou M, Morrison DK. The CNK2 scaffold interacts with vilse and modulates Rac cycling during spine morphogenesis in hippocampal neurons. Curr Biol. 2014;24:786–792. doi: 10.1016/j.cub.2014.02.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Löffler H, Fechter A, Matuszewska M, Saffrich R, Mistrik M, Marhold J, Hornung C, Westermann F, Bartek J, Krämer A. Cep63 recruits Cdk1 to the centrosome: implications for regulation of mitotic entry, centrosome amplification, and genome maintenance. Cancer Res. 2011;71:2129–2139. doi: 10.1158/0008-5472.CAN-10-2684. [DOI] [PubMed] [Google Scholar]
  36. Mao AJ, Bechberger J, Lidington D, Galipeau J, Laird DW, Naus CC. Neuronal differentiation and growth control of neuro-2a cells after retroviral gene delivery of connexin43. J Biol Chem. 2000;275:34407–34414. doi: 10.1074/jbc.M003917200. [DOI] [PubMed] [Google Scholar]
  37. Maruo T, Mizutani K, Miyata M, Kuriu T, Sakakibara S, Takahashi H, Kida D, Maesaka K, Sugaya T, Sakane A, Sasaki T, Takai Y, Mandai K. s-Afadin binds to MAGUIN/Cnksr2 and regulates the localization of the AMPA receptor and glutamatergic synaptic response in hippocampal neurons. J Biol Chem. 2023;299:103040. doi: 10.1016/j.jbc.2023.103040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Mathieu ML, de Bellescize J, Till M, Flurin V, Labalme A, Chatron N, Sanlaville D, Chemaly N, des Portes V, Ostrowsky K, Arzimanoglou A, Lesca G. Electrical status epilepticus in sleep, a constitutive feature of Christianson syndrome? Eur J Paediatr Neurol. 2018;22:1124–1132. doi: 10.1016/j.ejpn.2018.07.004. [DOI] [PubMed] [Google Scholar]
  39. Meka DP, Scharrenberg R, Calderon de Anda F. Emerging roles of the centrosome in neuronal development. Cytoskeleton (Hoboken) 2020;77:84–96. doi: 10.1002/cm.21593. [DOI] [PubMed] [Google Scholar]
  40. Morris-Rosendahl DJ, Crocq MA. Neurodevelopmental disorders-the history and future of a diagnostic concept
Dialogues. Clin Neurosci. 2020;22:65–72. doi: 10.31887/DCNS.2020.22.1/macrocq. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Murphy SM, Stearns T. Cytoskeleton: microtubule nucleation takes shape. Curr Biol. 1996;6:642–644. doi: 10.1016/s0960-9822(09)00437-0. [DOI] [PubMed] [Google Scholar]
  42. Nigg EA, Raff JW. Centrioles, centrosomes, and cilia in health and disease. Cell. 2009;139:663–678. doi: 10.1016/j.cell.2009.10.036. [DOI] [PubMed] [Google Scholar]
  43. O’Neill AC, et al. Spatial centrosome proteome of human neural cells uncovers disease-relevant heterogeneity. Science. 2022;376:eabf9088. doi: 10.1126/science.abf9088. [DOI] [PubMed] [Google Scholar]
  44. Ohtakara K, Nishizawa M, Izawa I, Hata Y, Matsushima S, Taki W, Inada H, Takai Y, Inagaki M. Densin-180, a synaptic protein, links to PSD-95 through its direct interaction with MAGUIN-1. Genes Cells. 2002;7:1149–1160. doi: 10.1046/j.1365-2443.2002.00589.x. [DOI] [PubMed] [Google Scholar]
  45. Olbrich H, et al. Recessive HYDIN mutations cause primary ciliary dyskinesia without randomization of left-right body asymmetry. Am J Hum Genet. 2012;91:672–684. doi: 10.1016/j.ajhg.2012.08.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Parenti I, Rabaneda LG, Schoen H, Novarino G. Neurodevelopmental disorders: from genetics to functional pathways. Trends Neurosci. 2020;43:608–621. doi: 10.1016/j.tins.2020.05.004. [DOI] [PubMed] [Google Scholar]
  47. Pavlowsky A, Chelly J, Billuart P. Emerging major synaptic signaling pathways involved in intellectual disability. Mol Psychiatry. 2012;17:682–693. doi: 10.1038/mp.2011.139. [DOI] [PubMed] [Google Scholar]
  48. Petry S, Vale RD. Microtubule nucleation at the centrosome and beyond. Nat Cell Biol. 2015;17:1089–1093. doi: 10.1038/ncb3220. [DOI] [PubMed] [Google Scholar]
  49. Pinto D, et al. Convergence of genes and cellular pathways dysregulated in autism spectrum disorders. Am J Hum Genet. 2014;94:677–694. doi: 10.1016/j.ajhg.2014.03.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Polla DL, Saunders HR, de Vries BBA, van Bokhoven H, de Brouwer APM. A de novo variant in the X-linked gene CNKSR2 is associated with seizures and mild intellectual disability in a female patient. Mol Genet Genomic Med. 2019;7:e00861. doi: 10.1002/mgg3.861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Rauch A, et al. Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study. Lancet. 2012;380:1674–1682. doi: 10.1016/S0140-6736(12)61480-9. [DOI] [PubMed] [Google Scholar]
  52. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9:676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Schizophrenia Working Group of the Psychiatric Genomics Consortium Biological insights from 108 schizophrenia-associated genetic loci. Nature. 2014;511:421–427. doi: 10.1038/nature13595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. See YP, Olley PM, Jackowski G. The effects of high salt concentrations in the samples on molecular weight determination in sodium dodecyl sulfate polyacrylamide gel electrophoresis. Electrophoresis. 1985;6:382–387. [Google Scholar]
  55. Shapiro AJ, Sillon G, D’Agostino D, Baret L, López-Giráldez F, Mane S, Leigh MW, Davis SD, Knowles MR, Zariwala MA. HYDIN variants are a common cause of primary ciliary dyskinesia in French Canadians. Ann Am Thorac Soc. 2023;20:140–144. doi: 10.1513/AnnalsATS.202203-253RL. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Shirai A, Matsuyama A, Yashiroda Y, Hashimoto A, Kawamura Y, Arai R, Komatsu Y, Horinouchi S, Yoshida M. Global analysis of gel mobility of proteins and its use in target identification. J Biol Chem. 2008;283:10745–10752. doi: 10.1074/jbc.M709211200. [DOI] [PubMed] [Google Scholar]
  57. Sjöstedt E, et al. An atlas of the protein-coding genes in the human, pig, and mouse brain. Science. 2020;367:eaay5947. doi: 10.1126/science.aay5947. [DOI] [PubMed] [Google Scholar]
  58. Song X, Yu Y, Leng Y, Ma L, Mu J, Wang Z, Xu Y, Zhu H, Qiu X, Li P, Li J, Wang D. Expanding tubular microvessels on stiff substrates with endothelial cells and pericytes from the same adult tissue. J Tissue Eng. 2022;13:20417314221125310. doi: 10.1177/20417314221125310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Spijker S. Dissection of Rodent Brain Regions. In: Li KW, editor. Neuroproteomics. Totowa, NJ: Humana Press; 2011. pp. 13–26. [Google Scholar]
  60. State MW, Levitt P. The conundrums of understanding genetic risks for autism spectrum disorders. Nat Neurosci. 2011;14:1499–1506. doi: 10.1038/nn.2924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Sun Y, Liu YD, Xu ZF, Kong QX, Wang YL. CNKSR2 mutation causes the X-linked epilepsy-aphasia syndrome: A case report and review of literature. World J Clin Cases. 2018;6:570–576. doi: 10.12998/wjcc.v6.i12.570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Szklarczyk D, Gable AL, Nastou KC, Lyon D, Kirsch R, Pyysalo S, Doncheva NT, Legeay M, Fang T, Bork P, Jensen LJ, von Mering C. The STRING database in 2021: customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021;49:D605–D612. doi: 10.1093/nar/gkaa1074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Thauvin-Robinet C, et al. The oral-facial-digital syndrome gene C2CD3 encodes a positive regulator of centriole elongation. Nat Genet. 2014;46:905–911. doi: 10.1038/ng.3031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Toraman B, Bilginer S, Hesapçıoğlu ST, Göker Z, Soykam HO, Ergüner B, Dinçer T, Yıldız G, Ünsal S, Kasap BK, Kandil S, Kalay E. Finding underlying genetic mechanisms of two patients with autism spectrum disorder carrying familial apparently balanced chromosomal translocations. J Gene Med. 2021;23:e3322. doi: 10.1002/jgm.3322. [DOI] [PubMed] [Google Scholar]
  65. Tremblay RG, Sikorska M, Sandhu JK, Lanthier P, Ribecco-Lutkiewicz M, Bani-Yaghoub M. Differentiation of mouse Neuro 2A cells into dopamine neurons. J Neurosci Methods. 2010;186:60–67. doi: 10.1016/j.jneumeth.2009.11.004. [DOI] [PubMed] [Google Scholar]
  66. Turn RE, Hu Y, Dewees SI, Devi N, East MP, Hardin KR, Khatib T, Linnert J, Wolfrum U, Lim MJ, Casanova JE, Caspary T, Kahn RA. The ARF GAPs ELMOD1 and ELMOD3 act at the Golgi and cilia to regulate ciliogenesis and ciliary protein traffic. Mol Biol Cell. 2022;33:cor1. doi: 10.1091/mbc.E21-09-0443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. UniProt Consortium UniProt: the Universal Protein Knowledgebase in 2023. Nucleic Acids Res. 2023;51:D523–d531. doi: 10.1093/nar/gkac1052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Vaags AK, Bowdin S, Smith ML, Gilbert-Dussardier B, Brocke-Holmefjord KS, Sinopoli K, Gilles C, Haaland TB, Vincent-Delorme C, Lagrue E, Harbuz R, Walker S, Marshall CR, Houge G, Kalscheuer VM, Scherer SW, Minassian BA. Absent CNKSR2 causes seizures and intellectual, attention, and language deficits. Ann Neurol. 2014;76:758–764. doi: 10.1002/ana.24274. [DOI] [PubMed] [Google Scholar]
  69. van Dam TJ, Wheway G, Slaats GG, Huynen MA, Giles RH. The SYSCILIA gold standard (SCGSv1) of known ciliary components and its applications within a systems biology consortium. Cilia. 2013;2:7. doi: 10.1186/2046-2530-2-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Wang L, Xu M, Wang Y, Wang F, Deng J, Wang X, Zhao Y, Liao A, Yang F, Wang S, Li Y. Melatonin improves synapse development by PI3K/Akt signaling in a mouse model of autism spectrum disorder. Neural Regen Res. 2024;19:1618–1624. doi: 10.4103/1673-5374.387973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wilfert AB, Sulovari A, Turner TN, Coe BP, Eichler EE. Recurrent de novo mutations in neurodevelopmental disorders: properties and clinical implications. Genome Med. 2017;9:101. doi: 10.1186/s13073-017-0498-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Wu Z, Pang N, Zhang Y, Chen H, Peng Y, Fu J, Wei Q. CEP290 is essential for the initiation of ciliary transition zone assembly. PLoS Biol. 2020;18:e3001034. doi: 10.1371/journal.pbio.3001034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Xu Y, Mu J, Zhou Z, Leng Y, Yu Y, Song X, Liu A, Zhu H, Li J, Wang D. Expansion of mouse castration-resistant intermediate prostate stem cells in vitro. Stem Cell Res Ther. 2022;13:299. doi: 10.1186/s13287-022-02978-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Yao I, Ohtsuka T, Kawabe H, Matsuura Y, Takai Y, Hata Y. Association of membrane-associated guanylate kinase-interacting protein-1 with Raf-1. Biochem Biophys Res Commun. 2000;270:538–542. doi: 10.1006/bbrc.2000.2475. [DOI] [PubMed] [Google Scholar]
  75. Yao I, Hata Y, Ide N, Hirao K, Deguchi M, Nishioka H, Mizoguchi A, Takai Y. MAGUIN, a novel neuronal membrane-associated guanylate kinase-interacting protein. J Biol Chem. 1999;274:11889–11896. doi: 10.1074/jbc.274.17.11889. [DOI] [PubMed] [Google Scholar]
  76. Yu BT, Li WT, Song BQ, Wu YL. Comparative study of the Triton X-100-sodium deoxycholate method and detergent-enzymatic digestion method for decellularization of porcine aortic valves. Eur Rev Med Pharmacol Sci. 2013;17:2179–2184. [PubMed] [Google Scholar]
  77. Zeng M, Zhou JN. Roles of autophagy and mTOR signaling in neuronal differentiation of mouse neuroblastoma cells. Cell Signal. 2008;20:659–665. doi: 10.1016/j.cellsig.2007.11.015. [DOI] [PubMed] [Google Scholar]
  78. Zhao B, Zhang H, Liu Y, Zu G, Zhang Y, Hu J, Liu S, You L. Forebrain excitatory neuron-specific loss of Brpf1 attenuates excitatory synaptic transmission and impairs spatial and fear memory. Neural Regen Res. 2024;19:1133–1141. doi: 10.4103/1673-5374.385307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Zhou Y, Zhou B, Pache L, Chang M, Khodabakhshi AH, Tanaseichuk O, Benner C, Chanda SK. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun. 2019;10:1523. doi: 10.1038/s41467-019-09234-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Zieger HL, Kunde SA, Rademacher N, Schmerl B, Shoichet SA. Disease-associated synaptic scaffold protein CNK2 modulates PSD size and influences localisation of the regulatory kinase TNIK. Sci Rep. 2020;10:5709. doi: 10.1038/s41598-020-62207-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional Figure 1

Knocking down CNKSR2 does not have a significant effect on N2a cell neurites.

(A) The typical IF images of the N2A cells showed no significant differences regarding the percentages of neurite-growing cells, the average neurite numbers per cell, and mean neurite lengths between the CNKSR2 KD and NC groups. DAPI stained the nucleus (blue). EGFP proteins (green) were expressed by the lentivirus-infected cells. The α-tubulin proteins (red, Alexa Fluor 546) in the N2A cells were immunostained. Arrows indicate neurites. Scale bars: 10 μm. (B-D) Statistical analysis of the percentages of neurite-growing cells (B), and the average neurite numbers (C) and neurite lengths (D) of these cells in the CNKSR2 KD and NC groups. N = 11 microscopic photos from three biological replicates; the total number of cells quantified was 109 in the CNKSR2 KD group and 57 in the NC group, respectively. Data are presented as mean ± SD, and were analyzed by unpaired two-tailed Student’s t-test. CNKSR2: Connector enhancer of kinase suppressor of Ras 2; DAPI: 4’,6-diamidino-2-phenylindole; EGFP: enhanced green fluorescent protein; IF: immunofluorescence; KD: knock down; N2A: Neuro 2A; NC: negative control; ns: no significance.

NRR-20-2420_Suppl1.tif (15MB, tif)
Additional Figure 2

Enrichment analysis of the organelle proteomes in the genes harboring neurodevelopmental disease-related de novo variants.

Organelle proteomes were overlaid with the genes harboring rare de novo variants reported in patients with different neurodevelopmental diseases, and enrichment analysis was performed to study the association of the organelles with these diseases. ASD: Autism spectrum disorder, EE: epileptic encephalopathies, ID: intellectual disability, PH: periventricular heterotopia, PMG: polymicrogyria.

NRR-20-2420_Suppl2.tif (18.6MB, tif)
Additional Table 3

List of the CNKSR2 interactors identified in this study

NRR-20-2420_Suppl1.pdf (268.8KB, pdf)

Data Availability Statement

Data supporting the findings of this study are available within the article and its supplementary material; additional supporting data are available from the corresponding author upon reasonable request.

Articles from Neural Regeneration Research are provided here courtesy of Wolters Kluwer -- Medknow Publications

RESOURCES