Staphylococcus aureus nt5 gene mutation through CRISPR RNA-guided base editing weakens bacterial virulence and immune evasion

ABSTRACT

The resistance of commonly used clinical antibiotics, such as daptomycin (DAP), has become increasingly serious in the fight against Staphylococcus aureus (S. aureus) infection. It is essential to explore key pathogenicity-driven genes/proteins in bacterial infection and antibiotics resistance, which contributes to develop novel therapeutic strategies against S. aureus infections. The nt5 gene of S. aureus, encoding 5’-nucleotidase (NT5), is nearly unknown for its function in drug resistance and bacterial infection. Herein, to reveal nt5 gene role in drug resistance and infection ability of S. aureus, we performed nt5^C166T gene mutation using a clustered regulatory interspaced short palindromic repeat ribonucleic acid (RNA)-guided base editing system to investigate the lose-of-function of NT5 protein. Subsequent transcriptome sequencing of the mutant strain revealed that nt5 inactivation caused changes in cell membrane integrity and inhibited nucleotide metabolism, suggesting the nt5 gene may be involved in bacterial drug resistance and virulence. The mutant strain exhibited enhanced tolerance to DAP treatment by attenuating cell membrane potential dissipation and slowing deoxyribonucleic acid release. Moreover, the nt5 mutation alleviated abscess degree of mouse kidneys caused by S. aureus infection byreducing the expression of IL-1β, IL-6, and IL-18. The nt5 mutant strain was easily swallowed by host immune cells, resulting in weak bacterial toxicity of the S. aureus mutant in the bacterial infection process. In summary, nt5 gene mutation confers tolerance to DAP and a lower bacterial capacity to form kidney abscesses through phagocytosis of host immune cells, which indicates the targeted inhibition of NT5 protein would offer a potential new therapeutic strategy against S. aureus infection.

Introduction

Staphylococcus aureus (S. aureus) is a common conditional pathogen causing severe infections, including sepsis, endocarditis, skin and wound infections, and osteomyelitis in almost every organ of the human body [1]. The treatment of S. aureus-induced infections has become increasingly challenging due to the emergence of drug-resistant bacteria [2]. This phenomenon significantly reduces the efficacy of antibacterial drugs, resulting in frequent cases of antibiotic treatment failure. Methicillin-resistant S. aureus (MRSA) infection is associated with high morbidity and mortality rates. In recent years, MRSA has become one of the fastest-growing causes of death related to drug-resistant bacteria, posing a major challenge to the prevention and treatment of infectious diseases worldwide [3].

Drug resistance of many clinically used antibiotics has become increasingly serious. Several powerful antibacterial antibiotics, such as vancomycin, daptomycin (DAP), and linezolid, have faced rising resistance [4]. Drug resistance has accelerated the development of new antibiotics, and the emergence of DAP-resistant strains has become prevalent in recent years [5,6]. Therefore, it is essential to explore the roles of key pathogenicity-driven proteins in bacterial infection and antibiotic resistance mechanisms, which would contribute to the development of novel therapeutic strategies against S. aureus infections.

The clustered regulatory interspaced short palindromic repeats (CRISPR)/Cas9 system is widely applied for gene and genome editing in multiple species, including bacteria, Streptomyces [7,8], yeast, plants, and mammalian cells [9]. However, it is challenging to edit S. aureus genes using CRISPR/Cas9 due to the weak ability of homologous recombination and repair in S. aureus. This limitation hinders insights into the phenotypes and mechanisms of new pathogenic factors from S. aureus [10–12]. Base editing allows for direct mutagenesis of bases in the genome, providing a new approach for genome editing in biology. Deaminase is targeted to the genome by the nCas9/sgRNA complex, catalyzing the conversion of cytosine to thymine during the deoxyribonucleic acid (DNA) repair process. Compared to CRISPR/Cas9, the single-base editor achieves gene editing without causing DNA double-strand breaks, significantly improving the survival rate of S. aureus [13].

DAP is a novel cyclic lipopeptide antibiotic that interacts with bacterial cell membranes to efficiently kill most clinically relevant Gram-positive bacteria [14]. The mechanisms of DAP resistance in S. aureus are generally thought to be associated with an overall change in the net charge of the bacterial membrane, resulting in the repulsion of the DAP antibiotic molecule from the cell surface [15]. The multiple peptide resistance factor protein is consistently associated with the development of DAP resistance in S. aureus, both in vitro and in vivo [16]. Our previous research has identified several key DAP-targeting bacterial proteins through quantitative drug proteomic analysis of the conditional pathogenic bacterium S. aureus. Treatment of S. aureus with DAP results in the down-regulation of 5’-nucleotidase (NT5, protein ID: ABD29455.1), alongside a decrease in bacterial membrane potential and disruption of the cell membrane, which contributes to the rapid release of bacterial DNA and finally causes bacterial death [17]. This evidence indicates the bacterial protein NT5 is closely related to the DAP antibacterial effect.

The NT5 protein is ubiquitous among bacteria species, including Escherichia coli and Streptococcus suis, and it hydrolyzes the phosphate group of 5’-nucleotides [18]. Streptococcus suis NT5 is an important virulence factor that inhibits neutrophil functions in vitro by converting AMP/dAMP to adenosine (Ado)/deoxyadenosine (dAdo) [18]. So far, bacterial NT5 would be an important therapeutic target due to NT5-catalyzed high sequence conservation of AMP/dAMP to Ado/dAdo, and its widespread expression in various clinical isolates. The development of a vaccine targeting the NT5 protein or related small molecule drugs will provide valuable strategies for treating infections caused by bacteria [18]. Notably, bacterial NT5 activity is associated with immune evasion properties. However, it remains unclear how S. aureus NT5 functions in S. aureus-induced infections by now, and its toxicological mechanism as a virulence factor has not yet been completely elucidated. Currently, the most widely accepted view is that the NT5 protein is toxic to human immune cells. The NT5 protein can inhibit the immune response by triggering apoptosis in phagocytes and macrophages, thereby allowing bacteria to escape clearance by immune cells and ultimately leading to organ abscesses and inflammation in vivo [19–21]. However, it is unclear whether the staphylococcal NT5 protein is involved in bacterial virulence through this pathway.

To further investigate the function of the nt5 gene, we focused on the role of the S. aureus nt5 gene in drug resistance and bacterial virulence through gene loss of function experiments using the CRISPR RNA-guided base editing system and transcriptome sequencing validation. Our results show that NT5 protein inactivation can enhance bacterial tolerance to the antibiotic DAP in S. aureus. We also reveal the S. aureus NT5 protein is required for S. aureus virulence and kidney abscess formation, and loss of NT5 function promotes the killing of S. aureus by host immune cells. Our findings indicate that the NT5 protein is an important factor in DAP resistance and bacterial virulence, and targeting the disruption of NT5 activity provides a potentially novel therapeutic strategy against S. aureus pathogens.

Materials and methods

Ethic statements

The animal experiments were performed in accordance with the guidelines of Sichuan University and approved by the Animal Care Committee of Sichuan University. (No. 20230307034).

Reagents and chemicals

DAP (99% purity) was purchased from the Dalian Meilun Biotechnology Company, China. Kanamycin and chloramphenicol were purchased from Sigma-Aldrich for plasmid screening in E. coli and plasmid curing in S. aureus RN4220 and S. aureus ATCC 25923. BsaI-HF and T4 DNA ligases were purchased from New England Biolabs for Golden Gate Assembly. The iScript cDNA Synthesis Kit and SsoAdvanced SYBR Green Supermix were purchased from Bio-Rad.

Strains and gene mutation plasmids

The bacterial strains, S. aureus ATCC 25923 and S. aureus RN4220, were stored in 20% glycerol. S. aureus was streaked from the glycerol stocks to culture in tryptic soy broth (TSB) and then inoculated into 5 mL TSB to grow overnight at 37°C with constant shaking. E. coli was grown in Luria Bertani broth.

The base editing plasmid pnCasSA-BEC was provided by Professor Ji of Shanghai Tech University. The pnCasSA-BEC system mainly includes the fusion protein APOBEC1-nCas9, which consists of the deaminase APOBEC1 and the Cas9 nickase Cas9D10A, as well as cap1A and rpsL promoters, and a replication origin ColE1. For the construction of the nt5 mutant plasmid pnCasSA-BEC-NT5sp, we designed a 20-bp spacer oligo using primers including nt5 spacer For and nt5 spacer Rev (Table 1) to insert into the BsaI site of the pnCasSA-BEC plasmid using the Golden Gate assembly method. The plasmid from the Golden Gate assembly reaction was transformed into 100 μL E. coli DH5α competent cells and incubated at 37°C overnight. The recombinant plasmid pnCasSA-BEC-NT5sp was then sequenced to verify the correctness of plasmid construction. The electrocompetent cells of S. aureus strains were prepared according to the reported approach [10].

Table 1.

Primers used in this study.

Primer	Sequence (5’-3’)
nt5 spacer For	GAAATAATCAAAATATTATGGCAG
nt5 spacer Rev	AAACCTGCCATAATATTTTGATTA
qpcr-nt5-For	ACAGTGCAAAGACTCAGTTAGA
qpcr-nt5-Rev	TGCATAGCCTTGATATGGAGAA
qpcr-pyk For	GCTGTATGTGCAACCGAAATAC
qpcr-pyk Rev	TGAAGCAGCCCAAGATTACA
qpcr-adk For	TGTTCTTGGGAAGCCATCTAAT
qpcr-adk Rev	GTTCCTGATGAAGTGACTGTAGG
qpcr-tpi For	AGCTAACGATGTTGTAGGTGAG
qpcr-tpi Rev nt5 For	GATTGCCCAGATTGGTTCATAAG TCGACTGTAATTTCCTTCCTAAAACTAG
nt5 Rev	ACCAGCCATTATTTAATTTCGCCTGTTT
pSR-For	ATTAAATAATGGCTGGTTGGCGTACTG
pSR-Rev	AGGAAATTACAGTCGACAACGCAGGAAAG

To eliminate the off-target effects of the CRISPR/Cas9 RNA-guided base editing technology, we constructed a complementation plasmid, pSaR-nt5, to complement nt5 expression following the inactivation of the endogenous nt5 gene. The gene nt5 and its native promoter were amplified from genomic DNA of S. aureus ATCC 25923 with primers nt5-For and nt5-Rev (Table 1) using a one-step cloning kit (Vazyme, C112–01). Besides the nt5 gene, the pSaR-nt5 plasmid included the E. coli replicon ColE1, the S. aureus replicon repF, the kanamycin selection marker, and the chloramphenicol resistance marker, and all these constituent elements were amplified from pnCasSA-BEC using primers pSaR-For and pSaR-Rev (Table 1). Additionally, the plasmid pSaR-nt5 contained a kanamycin selection marker for plasmid amplification in E. coli and a chloramphenicol resistance marker for plasmid selection in S. aureus.

Modified plasmid transformation by electroporation

The plasmids pnCasSA-BEC-NT5sp and pSaR-nt5 were transformed into the competent cells of the laboratory strain S. aureus RN4220 by electroporation to obtain the modified plasmid. Before electroporation, 100 μL competent cells and each type of plasmids were thawed on ice for 5 min. The competent cells were mixed with 1 μg of the recombinant plasmids and transferred into an electroporation cuvette with 1 mm-thickness at room temperature. After pulsing at 2.1 kV, 100 Ω, and 25 mF, the cells were immediately supplied with 900 μL TSB and recovered at 30°C for 1.5 h. Finally, 500 μL cells were plated onto a TSB plate containing 5 mg/L chloramphenicol and incubated at 30°C for 24 h [13].

Base editing in S. aureus ATCC 25923

S. aureus RN4220 containing pnCasSA-BEC-NT5sp was cultured at 30°C for 18 h to extract the plasmid pnCasSA-BEC-NT5sp, then the plasmid was transformed into S. aureus ATCC 25923 by electroporation. 1 mL culture of S. aureus ATCC 25923 were plated onto a TSB plate containing 5 mg/L chloramphenicol and incubated at 30°C for 24 h. The target enzyme acted on the spacer sequence under the guidance of sgRNA, which led to the conversion of the base cytidine (C) to uridine (U). Following this, the conversion of the base U to thymine (T) was completed during the DNA replication process. The target colonies were amplified for sequencing to confirm nt5^C166T in the mutant (S. aureus MT).

The method of plasmid pnCasSA-BEC-NT5sp curing

The S. aureus with correct sequencing was cultured in TSB medium at 42°C for 18 h, then plated on TSB and incubated at 37°C for 18 h. A single clone was plated on both TSB and TSB+Cm. Clone that grew exclusively on the TSB plate indicated successful elimination of plasmid pnCasSA-BEC-NT5sp [13].

Library construction and sequencing

Total RNA extraction was carried out according to the manufacturer’s instructions. Only high-quality RNA samples meeting the standards were used to construct the sequencing library. The RNA-seq transcriptome library was prepared using the TruSeq^TM RNA sample preparation Kit from Illumina (San Diego, CA, USA) using 2 μg of total RNA following the user’s protocols.

Bioinformatics analysis

The data generated from the Illumina platform were used for the bioinformatics analysis of RNA expression and differentially expressed genes (DEGs). All analyses were performed using the free online Majorbio Cloud Platform (www.majorbio.com) from Shanghai Majorbio Bio-pharm Technology Co., Ltd. For each data-set, we identified d DEGs using the edgeR, DESeq2, or DESeq packages online as follow.

edgeR (http://www.bioconductor.org/packages/2.12/bioc/html/edgeR.html),

DESeq2 (http://bioconductor.org/packages/release/bioc/html/DESeq2.html) and DESeq (http://www.bioconductor.org/packages/release/bioc/html/DESeq.html)

Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of DEGs

DEGs were further assayed through GO enrichment analysis using Goatools (https://github.com/tanghaibao/GOatools). After multiple testing corrections, GO terms with adjusted P-value ≤0.05 were significantly enriched in DEGs.

The KEGG enrichment analysis was used to identify the most important biological metabolic pathways and signal transduction pathways that DEGs were involved in, and the Z scores were introduced to quantitatively evaluate the nt5-regulated pathways [22]. KOBAS 2.0 (http://kobas.cbi.pku.edu.cn) was used to identify statistically significantly enriched pathways using the Fisher’s exact test. After multiple testing corrections, pathways with p-value < 0.05 were incorporated into the significantly enriched DEGs.

Minimal inhibitory concentration (MIC) of DAP

The MIC of DAP against S. aureus WT, S. aureus MT, and S. aureus CT was determined using broth microdilution, following the Clinical Laboratory Standards Institute guidelines. DAP was serially diluted to final concentrations ranging from 0.0625 to 4 µg/mL. The MIC was measured in three replicate experiments.

Primer design for qRT-PCR

Oligonucleotides were designed as qRT-PCR primers (Table 1). Total RNA was isolated using a bacterial RNA extraction kit according to the manufacturer’s protocol (FOREGENE, RE-03111, China). The expression levels of nt5, pyk, and adk were normalized to those of the reference tpi gene. Gene expression was quantified using qPCR three times (n = 3).

Fluorimeter assay for bacterial membrane potential

The membrane potentials of S. aureus WT, S. aureus MT, and S. aureus CT were measured using a fluorescent assay [17]. S. aureus cells were cultured in Mueller–Hinton broth (MHB) containing 50 µg/mL calcium ion, from which 1.5 mL of bacterial cell sample was transferred into a 2-mL centrifuge tube, and 50 μM DiSC3 (3, 3’-dipropylthiadicarbocyanine iodide; Life Technology) was added to the centrifuge tube and incubated for an additional 5 min at 37°C. After centrifugation at 10,000×g for 3 min, the supernatant was transferred to a cuvette, and the fluorescence intensity was detected using a spectrophotometer (Thermo Fisher Scientific, USA), with an excitation wavelength of 622 nm and fluorescence emission at 670 nm.

Bacterial DNA quantification

S. aureus WT, S. aureus MT, and S. aureus CT were cultured in MHB with DAP exposure for 0.5, 1, 2, 3, 5, 10, and 18 h, respectively, to detect DNA released into the medium from dead bacteria, which was quantified using a Portelite™ fluorimetric high sensitivity DNA quantitation kit (QIYI Biological Technology Co., LTD).

The DNA released into the supernatant was obtained by centrifugation at 10, 000×g for 3 min, and 10 μL of the diluted bacterial DNA sample (tenfold dilution with DNA assay buffer) was mixed with 190 μL of Helixyte™ Green (1:200 diluted solution), and the mixture was added to each well of a 96-well plate and incubated at room temperature for 2 min. The fluorescence intensity at 480 nm excitation and 520 nm emission was detected to calculate DNA content with a Varioskan Flash spectral scan multimode plate reader (Thermo Fisher Scientific, USA).

Mouse sepsis model

The C57BL/6JGpt mice used for subsequent experiments were ordered from GemPharmatech (Suzhou, China). This strain of mice is genetically stable with a clear genetic background, and is facile to breed and handle. The virulence of S. aureus WT, S. aureus MT, and S. aureus CT was assayed using a mouse sepsis model. Overnight cultures of each S. aureus, were diluted 1:100 into fresh TSB and grown for 3 h at 37°C. Each staphylococci culture was centrifuged, washed twice, and diluted in phosphate buffered saline (PBS) to yield an OD₆₀₀ up to 0.5 with 10⁸ colony-forming units (CFU)/mL. Bacterial culture (10⁶ CFU) was administered intravenously via the tail into 6-week-old male C57BL/6JGpt mice. Based on their body weights, the mice were randomly allocated to groups, with six mice in each group, to ensure an approximately equal average body weight across all groups. The living conditions for the mice in each group were consistent, and the experimenter responsible for measuring the various indices of the mice was blinded to the specific group assignments. A total of two independent experimental trials were performed.

On the 7^th day of bacterial inoculation, the mice were sacrificed to observe abscess formation and staphylococcal survival. Tissues were incubated at room temperature in 10% formalin for 24 h, embedded in paraffin, sectioned, and stained with hematoxylin and eosin for microscopic examination. Data were obtained from each representative group sample with cohorts of six mice.

Cell culture

The murine macrophage RAW 264.7 cells (ATCC TIB-71, USA) and human myeloid leukemia mononuclear THP-1 cells (ATCC TIB-202™, USA) were respectively cultured in Dulbecco’s Modified Eagle Medium (DMEM, SH30022.01, Hyclone, USA) and Roswell Park Memorial Institute (RPMI 1640, SH30809.01B, Hyclone, USA) media supplemented with 10% fetal bovine serum (FBS, SH30396.03, Hyclone, USA) at 37°C and 5% CO₂. The cells were cultured for 48 h, and collected to adjust the cell density to 10⁷ cells/mL for the assay.

Phagocytosis of mutant strain in vitro

S. aureus WT, S. aureus MT, and S. aureus CT strains were cultured overnight, from which 1 mL bacteria was cultured in 100 mL TSB medium for additional 3 h at 37°C to detect their phagocytosis by monocytes. Each staphylococci culture was centrifuged, washed twice, and diluted in PBS to yield an OD₆₀₀ up to 0.5 with 10⁸ CFU/mL. 10⁶ CFU bacterial suspension was mixed with 5 × 10⁵ RAW 264.7 or THP-1, and cultured at 37°C for 15 to 90 min, respectively, before beingplated on tryptic soy agar (TSA), and counted on the next day.

Immune evasion ability of nt5 gene mutant detected on mouse

When S. aureus infects the host, including mouse and human being, host macrophages as the first barrier of the innate immune system devour the invading S. aureus. On the other hand, the S. aureus can also evade phagocytosis and clearance by the host immune system through bacterial own genetic mutations. The more bacteria present in the blood, the greater the staphylococcal ability to evade the host cell immune system.

In order to detect the immune evasion ability of S. aureus WT, S. aureus MT, and S. aureus CT in vivo, we injected 10⁶ CFU of S. aureus from the tail vein into five C57BL/6JGpt mice and collected 100 µL blood from mouse orbit after infection for 7 days. Aliquots were incubated with 0.5% saponin/PBS on ice for 30 min to lyse host eukaryotic cells. The dilutions were plated on TSA plates to enumerate the surviving CFUs.

Hemolysis assay in vitro

Hemolysin secreted by S. aureus caused the breakdown of host red blood cells that were incubated with S. aureus in the agar plate, and subsequently hemolytic rings were shown on the blood agar plates. S. aureus WT, S. aureus MT, and S. aureus CT were cultured in TSB at 37°C overnight and diluted in TSB to achieve an OD₆₀₀ of 0.5, corresponding to approximately 10⁸ cells/mL. Then, 1 μL of culture from each strain, including S. aureus WT, S. aureus MT, and S. aureus CT, was loaded onto a sheep blood plate and incubated at 37°C for 24 h to observe the size of the hemolytic circles.

Interleukin level determination by ELISA

Mouse blood samples were collected and centrifuged to isolate mouse serum. After a 20-fold dilution of mouse serum, the levels of interleukin-1β (IL-1β), IL-18, and IL-6 in mouse serum were detected using an ELISA kit (Animalunion Biotechnology Co., Ltd.) following user’s instructions.

Statistical analysis

Data analysis was performed using two-tailed student’s t-test with GraphPad Prism (GraphPad Software Inc., San Diego, CA, USA), which was displayed as mean ± standard deviation (SD). The differences between groups were evaluated using student’s t tests with a p value less than 0.05, indicating statistical significance.

Results

Construction of nt5^C166T mutant strain by a CRISPR RNA-guided editing system

We constructed a mutant strain of the nt5 gene using the base editing CRISPR RNA-guided cytidine deaminase system pnCasSA-BEC, which included APOBEC1-nCas9, cap1A, and an rpsL promoter, to investigate the loss-of-function of the nt5 gene. In the pnCasSA-BEC system [13], the deaminase was directed to any genomic locus by the Cas9/sgRNA complex and catalyzed the conversion of C to U through a deamination reaction. This base editor had an editable window from positions 4 to 8 in the spacer sequence and could achieve C/T conversion without homologous recombination (Figure 1a). Herein, it was applied for gene inactivation in S. aureus.

Figure 1.

Construction of the nt5^C166T gene mutation of S. aureus by a CRISPR RNA editing system. (a) Composition of the base editor pnCasSA-bec system. It mainly includes APOBEC1-dCas9, cap1A and rpsL promoters in the pnCasSA-bec system, which is directed to any genomic locus by the Cas9/sgRNA complex to achieve C/T conversion in positions 4 to 8 of the spacer sequence without homologous recombination. PAM: protospacer adjacent motif. (b) The C166 of the nt5 gene was mutated to T in the edited nucleotide strand in the S. aureus RN4220; thus, the stop codon TAA (in red box) was formed at the 166th base, which led to the end of NT5 protein translation. (c–d) The 166th base of the nt5 gene in S. aureus ATCC 25923 was mutated from C to T, resulting in a stop codon TAA (in red box) that disrupted the function of the NT5 protein. (e) The pnCasSA-BEC-NT5sp plasmid was easily cured from the mutant after base editing. The individual colonies obtained after the curing steps were streaked onto the TSB agar plates in the presence (e, right) or absence (e, left) of Cm to test the effectiveness of curing. S. aureus can grow only on TSB plates, indicating that all bacterial plasmids have been successfully eliminated. (f) The results confirmed by PCR showed the plasmid in the S. aureus mutant had been successfully eliminated. WT: S. aureus ATCC 25923. MT: S. aureus ATCC 25923 with the nt5 ^C166T mutation. Cm: chloramphenicol. TSB: tryptic soy broth.

We constructed the pnCasSA-BEC-NT5sp plasmid using Golden Gate Assembly, and 200 ng/μL plasmids were transformed into the laboratory strain S. aureus RN4220 with 100% efficiency by electroporation. The base C166 of the nt5 gene in S. aureus RN4220 was mutated to T (nt5^C166T), which led to the production of a premature ochre stop codon with TAA (Figure 1b) and formed a truncated NT5 containing 55 amino acids compared to the full-length NT5 of 296 amino acids.

S. aureus RN4220 retains the methylation function of the Sau I system, which appropriately methylates DNA for subsequent uptake by other target S. aureus strains containing restriction-modification systems. First, we transferred the recombinant plasmid pnCasSA-BEC-NT5sp modified by S. aureus RN4220 to our target S. aureus WT, in which the pnCasSA-BEC-NT5sp system enabled highly efficient C/T conversion for target base editing. The C at position 7 of the spacer in nt5 gene was mutated to T with 100% efficiency (Fig1Figure 1c,d), indicating that C166 of the nt5 gene of the S. aureus WT strain was mutated to T, resulting in the interruption of the Q56 amino acid of the wild-type NT5 protein and termination at the translational level due to the emergence of the mutant premature stop codon TAA.

Although nt5 was not deleted, the endogenous wild-type protein NT5 was interrupted, resulting in the loss of its normal functions. After plasmid curing, four randomly picked colonies grew normally in the absence of chloramphenicol, whereas none grew normally in the presence of the antibiotic after two passages (Figure 1e). Meanwhile, no assembled plasmid was detected in the S. aureus MT (Figure 1f), confirming the stable removal of the pnCasSA-BEC-NT5sp plasmid from the S. aureus WT. All base mutations were verified using DNA sequencing.

The nt5 mutation-induced differential expression genes regulate drug resistance and bacterial nucleotide metabolism

We compared gene transcription changes under the nt5 mutation using transcriptome sequencing with three biological replicates to investigate nt5-regulated bacterial genes. The S. aureus WT and the S. aureus MT showed no significant difference in growth rate at 37°C, ensuring that the DEGs were indeed induced by the nt5 mutation rather than by difference in strain growth (Figure 2a).

Figure 2.

The nt5 mutation induced bacterial DEGs in S. aureus. (a) The growth curve of S. aureus WT and S. aureus MT showed that the inactivation of the nt5 gene had no influence on bacterial growth. Each point represented the OD of the bacterial suspension measured by three different experimental repeats. (b) The volcano plot of gene expression levels was generated from pairwise comparisons between S. aureus WT and S. aureus MT. Dashed lines represented the applied thresholds (analysis of variance p-value of <0.05 and fold difference of >+ 2.0 or <−2.0). Among the 2,556 genes identified in both strains, 38 genes in the S. aureus MT group were significantly upregulated, and 60 genes were significantly downregulated. (c) GO analysis for the DEGs due to nt5 mutation. The top four activities for the DEGs were involved in membrane function, binding, and nucleotide biosynthesis. (d) KEGG enrichment for the DEGs due to nt5 mutation. DEGs were primarily concentrated in cell community, nucleotide metabolism, and amino acid metabolism. (e, f) The GO and KEGG enrichment plots for DEGs. On the left side, the gene IDs and their corresponding values of log₂FC were displayed in order from top to bottom. On the top, the values of log₂FC were greater than 2 (red), and a larger log₂FC indicated a greater difference of increased abundance. On the bottom, the values of log₂FC were less than −2 (blue), and a smaller log₂FC meant a greater difference of decreased abundance. Significantly enriched pathways and their Z-scores were shown on right side of the figure. When Z-score was less than zero, this pathwaywas more likely to be inhibited. Conversely, the pathway was more likely to be activated if Z-score value above zero. OD: optical density.

Among the 2,556 genes identified in both strains, 38 genes in the S. aureus MT group were significantly upregulated (with a fold difference of >+2.0, p < 0.05), and 60 genes were significantly downregulated (fold difference of <−2.0, p < 0.05) (Figure 2b). We further performed GO analysis on all DEGs with a fold difference of <−2.0 or >+2.0 (p < 0.05) to investigate nt5-mediated changes in biochemical molecular activities (Figure 2c). The top three activities for the DEGs were involved in membrane function, binding, and nucleotide biosynthesis. As known, DAP targeted the cell membrane of S. aureus, leading to the destruction of bacterial cell membrane integrity and subsequent bacteria death [17], indicating that nt5 was involved in drug resistance. In addition, many virulence factors of bacteria also adhered to the cell membrane, which played an important role in the processes of infection and immune escape [23]. Because the nt5 gene caused changes in membrane integrity, it might influence drug resistance and bacterial virulence.

KEGG pathway analysis of 98 DEGs with statistically altered abundance (with a fold difference of <−2.0 or >+2.0, p < 0.05) was carried out to assess nt5 involvement in metabolic pathways. DEGs were involved in the cellular community, nucleotide metabolism, amino acid metabolism, and membrane transport (Figure 2d). Notably, DEGs, including pyk (pyruvate kinase) and adk (adenylate kinase), were enriched in nucleotide metabolism, which supported that bacterial nucleotide metabolism was closely related to drug resistance and virulence [24].

Moreover, the Z-scores indicated similar conclusions to those drawn from the GO and KEGG analyses. It was found that the nt5 mutation affected the pyrimidine biosynthetic process, significantly inhibiting the synthesis of pyrimidine (Figure 2e). In S. aureus MT, more pathways were activated, including alanine, aspartate, and glutamate metabolism; quorum sensing; carbon fixation pathways, and glycine, serine, and threonine metabolism (Figure 2e,f).

In general, the GO and KEGG analyses of biological processes mediated by the nt5 mutation demonstrated that nt5 and its target DEGs were involved in antibiotic response and bacterial virulence by influencing membrane integrity and bacterial nucleotide metabolism.

Gene nt5 mutation confers bacteria to DAP tolerance by alleviating DAP-induced bacterial membrane damage

In order to eliminate the off-target effects caused by CRISPR RNA-guided base editing, we constructed the nt5 complementation plasmid pSaR‐nt5 to express the nt5 gene in S. aureus MT, allowing us to observe the gain-of-function resulting from nt5 gene complementation. The exogenous nt5 was controlled by the native promoter (Figure 3a), which was designed to express the normal NT5 protein. The successful transformation of plasmid pSaR-nt5 into S. aureus was confirmed by PCR evaluation and sequencing (Figure 3b).

Figure 3.

Construction of the nt5 complementation strain by electroporation. (a) Schematic overview of the pSaR-nt5 plasmid. The nt5 complementation cassette was composed of a native promoter and the nt5 gene. (b) The transformation of nt5 complementation cassette into S. aureus was validated by PCR and sequencing.

We investigated the response of the nt5 mutation to antibiotic DAP treatment. In MHB media inoculated with 5 × 10⁵ CFU/mL of S. aureus, DAP inhibited the growth of three strains, including S. aureus WT, S. aureus MT, and S. aureus CT. Upon treatment with 0.25 and 0.5 µg/mL DAP, the growth of S. aureus WT was inhibited, while S. aureus MT was weakly inhibited, indicating that the silencing of the nt5 gene enhanced the tolerance of bacteria to DAP. The nt5 complementation strain of S. aureus CT hardly grew, indicating that the nt5 gene contributed to bacterial sensitivity to DAP exposure (Figure 4a). In particular, the growth of S. aureus WT was completely inhibited under 0.5 μg/mL DAP incubation, while S. aureus MT still exhibited relatively slow growth. The MIC of DAP against S. aureus MT was 1 µg/mL, which was twice that of the S. aureus WT (Figure 4b). However, the MIC of S. aureus CT was 0.25 µg/mL, further indicating that bacterial expression of the nt5 gene increased sensitivity to DAP (Figure 4b). Therefore, the nt5 gene in bacteria was a potential drug target for DAP, as previously identified by MS/MS analysis [17]. The nt5 mutation contributed to the drug tolerance and resistance of S. aureus to DAP exposure.

Figure 4.

Bacterial physiological response upon DAP exposure between S. aureus WT, S. aureus MT and S. aureus CT. (a) Bacterial growth was inhibited under 0.5 and 1 μg/mL DAP exposure for 12 h. S. aureus MT was more tolerant to DAP exposure than S. aureus WT and S. aureus CT, indicating that the inactivation of the nt5 gene contributed to DAP resistance. Growth at each time point was measured by the optical density of the bacterial suspension at 600 nm with three biological experiment repeats (n = 3). (b) DAP influence on the growth of S. aureus WT, S. aureus MT, and S. aureus CT was detected in a 96-well plate. The MIC of S. aureus MT was higher than that of WT and S. aureus CT. The red box corresponded to 0.5 MIC of DAP. (c) Bacterial membrane potential was measured by fluorimetry assay (n = 3). S. aureus cultures, including S. aureus WT, S. aureus MT, and S. aureus CT were incubated with or without DAP for 5 h to detect membrane potential respectively with 3 times (n = 3). The increase of fluorescence intensity meant reduction of bacterial membrane potential. Under the same DAP concentration, the change in membrane potential of S. aureus MT was smaller than that of S. aureus WT and S. aureus CT, indicating that DAP caused less damage to S. aureus MT. (d) DAP rapidly induced bacterial DNA release. At the same DAP concentration, S. aureus MT released less DNA compared to S. aureus WT and S. aureus CT, indicating that it was less damaged by DAP. 1 × 10⁸ bacterial cells of S. aureus WT, S. aureus MT, and S. aureus CT were respectively treated with DAP treatment for overnights (n = 3). S. aureus WT, S. aureus MT, and S. aureus CT meant S. aureus wild-type, nt5 mutation and nt5 complementation.

One widely accepted mechanism of DAP against S. aureus was that it inserted into the bacterial cell plasma membrane to inhibit the biosynthesis of lipoteichoic acid of S. aureus and disruptthe bacterial cell membrane. Other studies supported that DAP was a membrane-targeted antibiotic that combined with Ca²⁺ to form a micelle structure in solution and oligomerized in the cell membrane in the presence of 1 M equivalent Ca²⁺. This oligomer facilitated the delivery of DAP to cell membrane of S. aureus, which caused the dissipation of cell membrane potential and the outflow of potassium ions, ultimately resulting in cell death. In order to investigate the mechanism of S. aureus MT tolerance to DAP [25], we further investigated cell membrane integrity under DAP treatment after nt5 mutation. The NT5 protein encoded by nt5 was located on the cell membrane, and the loss of NT5 function altered in bacterial membrane potential under DAP treatment. Therefore, we measured membrane potential changes in S. aureus WT, S. aureus MT, and S. aureus CT under 0.5 MIC and 1 MIC of DAP exposure respectively. Once the membrane potential was altered, the bacterial cell membrane was compromised, leading to the release of bacterial DNA. At the same DAP concentration, the cell membrane of S. aureus MT was more intact and exhibited weak damage from DAP, while the cell membranes of S. aureus WT and S. aureus CT experienced more severe damage (Figure 4c), which was consistent with the observed MIC increase for S. aureus MT (Figure 4b).

Correspondingly, the released bacterial DNA was detected in the MHB supernatant. Under 0.5 MIC DAP exposure, the quantity of bacterial DNA released from S. aureus MT was less than that from S. aureus WT and S. aureus CT at the same time point. However, at 1 MIC DAP treatment, 80% of the bacterial DNA was released from the S. aureus WT strain and 65% from the S. aureus CT at 3 h, while 50% of the DNA was detected in S. aureus MT, which indicated that S. aureus MT was more tolerant to DAP (Figure 4d). Most of the bacterial DNA from S. aureus WT and S. aureus CT was released at the 3-h time point under 1 MIC DAP exposure, whereas a similar quantity of DNA from S. aureus MT was detectable for over 5 h, even up to 10 h. In conclusion, the mutant strain demonstrated improved tolerance to DAP exposure by reducing cell membrane potential dissipation and slowing down DNA release.

nt5 mutation impedes S. aureus-infected abscess formation

10⁶ CFU of S. aureus WT, S. aureus MT, and S. aureus CT were inoculated into C57BL/6JGpt mice via intravenous injection to investigate the role of the nt5 gene in abscess formation. First, the three types of bacteria were assessed to determine their influence on the body weight of the infected mice. The initial weight of the mice was approximately 21 g before bacterial injection. All mice infected with bacteria lost weight 2–4 days post-injection compared to the control group, but the weight of mice injected with S. aureus WT and S. aureus CT decreased more significantly, indicating that the bacterial nt5 gene influenced mouse body weight (Figure 5a).

Figure 5.

Silence of nt5 weakened mouse kidney abscess formation. (a) Compared with the normal mouse, the body weight of the mouse was obviously decreased under injection of S. aureus MT, S. aureus WT, and S. aureus CT after injection for 2–4 days. Normal group: normal C57BL/6JGpt mice injected with PBS. (b) The injection of S. aureus MT, S. aureus WT, and S. aureus CT induced mouse kidney abscesses. Yellow arrows indicated abscess lesions and the number of kidneys producing abscess was indicated in brackets. Normal group without kidney abscess: normal C57BL/6JGpt mice injected with PBS. (c) The surviving S. aureus in mouse peripheral blood. We examined the bacterial quantity of surviving in mouse peripheral blood after injection of S. aureus WTand S. aureus MT to C57BL/6JGpt mice for 7 days. (d) The ratio of mouse kidney weight versus mouse body weight under injection of S. aureus MT, S. aureus WT, and S. aureus CT. Normal group: normal C57BL/6JGpt mice injected with PBS. (e) Bacteria burden in kidneys and livers after intravenous challenge of C57BL/6JGpt mice (n = 6) with 10⁶ CFU of S. aureus, S. aureus was enumerated as log₁₀ CFU per gram of tissue 7 days. The data indicated S. aureus WT caused renal abscess more seriously because it was more difficult to be cleared up by the immune system. (f) The comparison of H&E staining of mouse kidney between normal mice and S. aureus-infected mice. The results of H&E staining demonstrated that the complete renal glomerulus and tubule morphology was destroyed after infection, whereas the mutant notably decreased the thickening of the basement membrane of renal tubules and glomerular hypertrophy, thereby alleviating the severity of renal pathological injury induced by sepsis. S. aureus WT, S. aureus MT, and S. aureus CT means S. aureus wild-type, nt5 mutation and nt5 complementation.

Six mice were included in each S. aureus group. After bacterial infection for 7 days, the mice were killed, and 100-µL peripheral blood was collected from the mouse orbit to count the number of surviving bacteria. It was noticed that inoculation with S. aureus WT and S. aureus CT resulted in more abscesses in the mouse kidneys compared to S. aureus MT (Figure 5b). After bacterial infection in mice for 7 days, the number of surviving S. aureus WT and S. aureus CT was greater than that of S. aureus MT, indicating that S. aureus MT was more easily cleared by the immune system (Figure 5c). In addition, the weight of the kidneys from infected mice was higher than that of normal mice without infection. The kidney weight of mice infected with S. aureus MT was lower than that of mice infected with S. aureus WT, indicating that the virulence of S. aureus MT was weakened (Figure 5d).

Moreover, approximately 10⁵ (CFU/g tissue) S. aureus WT tissue was measured in the mouse right kidney. Under the same conditions, approximately 100 (CFU/g tissue) S. aureus MT survived in the mouse apostematic kidney tissue (Figure 5e). The surviving S. aureus MT in the mouse kidney represented about a 1000-fold reduction compared to S. aureus WT infection, indicating that the deficiency of NT5 function greatly attenuates the virulence of S. aureus.

Mouse kidneys were collected to observe abscess profiles through H&E staining. Compared with normal mice without infection, the abscess symptoms caused by S. aureus MT infection were less pronounced. It was noted that S. aureus WT and S. aureus CT formed more abscesses in mouse kidneys compared to S. aureus MT. The abscess lesions were further examined in kidney tissues through H&E staining analysis. Several obvious lesions surrounded by infiltrating neutrophils were observed in the kidneys of mice inoculated with S. aureus WT and S. aureus CT (Figure 5f). H&E staining demonstrated that the complete renal glomerulus and tubule morphology were destroyed after infection, whereas S. aureus MT notably reduced the thickening of the basement membrane of renal tubules and glomerular hypertrophy, thereby alleviating the severity of renal pathological injury induced by sepsis. In general, the nt5 gene contributed to the virulence of S. aureus, and the absence of NT5 function restored the body weight of S. aureus-infected mice to levels similar to those of normal mice without infection.

Loss of NT5 function weakens bacterial virulence by inducing slighter inflammatory response

To investigate the mechanism by which nt5^C166T weakens abscess formation, we co-cultured S. aureus WT, S. aureus MT, and S. aureus CT with the macrophage cell lines RAW 264.7 and THP-1 in vitro to study the role of nt5 in the immune response [26]. As a result, S. aureus MT was more easily phagocytosed by RAW 264.7 and THP-1 compared with S. aureus WT and S. aureus CT cells when co-cultured for 15 to 60 min, as indicated by counting bacterial colonies on TSA at timed intervals. This suggested that the loss of NT5 protein function improved the phagocytosis of S. aureus by macrophages (Figure 6a,b). After being co-cultured for 75–90 min, the S. aureus MT was entirely cleared, which indicated that S. aureus MT exhibited a defect in escaping phagocytic killing compared to S. aureus WT.

Figure 6.

The S. aureus MT alleviated abscess formation by triggering a weaker inflammatory response. (a–b) Phagocytosis of S. aureus by the mouse macrophage cell line RAW 264.7 (a) and human monocyte THP-1 (b). The survival rate of bacteria was calculated by recording the surviving CFU of S. aureus on TSA. (c–e) The level of IL-1β, IL-18, and IL-6 in mouse serum when the S. aureus-infected sepsis model was constructed for 7 days. (f–h) Changes in transcription level of the nucleic acid metabolic pathway mediated by nt5. The mutation of nt5 gene inhibited the transcription of adk and pyk. (i) Nucleic acid metabolic pathway mediated by nt5. The mutant NT5 produced less adenosine due to the loss of function and the inhibition of adk transcription.

Multiple studies have shown that over-activation of inflammasomes is an important characteristic of sepsis. A previous study indicated that NLRP3 inflammasome-related cytokines were upregulated in sepsis, and reduced levels of these cytokines promoted the survival rate in sepsis patient [27]. Therefore, we investigated whether the mutation affected cytokine levels in sepsis. Our results showed that S. aureus MT significantly reduced the release of IL-6, IL-1β, and IL-18 compared to S. aureus WT and S. aureus CT in a mouse sepsis model. This finding suggested that the inactivation of nt5 function led to lower virulence in the bacteria by alleviating the inflammatory response and promoting phagocytosis by immune cells (Figure 6c–e).

Moreover, the genes adk and pyk were essential for nt5-mediated nucleic acid metabolism in S. aureus based on bioinformatics analysis using STRING software (http://string-db.org/cgi/input.pl). To gain a comprehensive understanding of nt5-regulated signaling pathways and biological processes in S. aureus, we verified the gene expression levels associated with the nt5-mediated nucleotide pathway. The expression of two genes (pyk and adk) related to nucleotide metabolism was downregulated by the nt5 mutation (Figure 6f–h), which was consistent with the transcriptome analysis. The loss of NT5 protein function led to the production of less adenosine, which indicated that S. aureus MT caused a slight renal abscess (Figure 6i). In conclusion, we have revealed that nt5 was required for staphylococcal survival in the host as an extracellular pathogen, and the S. aureus nt5 gene played a critical role in staphylococcal escape from the phagocytic killing of the host immune defense system, promoting their survival in host blood and tissues.

nt5 mutation has no influence on hemolysis

We determined whether the mutation of the nt5 gene affected the hemolytic activity of the bacteria. We inoculated 10⁵ CFU of bacteria onto blood agar plates and cultured them at 37°C for 16 h. The mutation of the nt5 gene had no influence on the hemolytic activity of the bacteria (Figure 7a,b). Therefore, the attenuation of bacterial virulence caused by nt5 mutation was primarily reflected in the decreased quantity and degree of kidney abscesses.

Figure 7.

Hemolytic activity of S. aureus MT. (a–b) Size of hemolytic ring formed by S. aureus WT, S. aureus MT and S. aureus CT on the blood agar plate. S. aureus WT, S. aureus MT and S. aureus CT meant S. aureus wild-type, nt5 mutation, and nt5 complementation, respectively.

Discussion

Almost all archaea and bacteria achieve adaptive immunity through a diverse set of CRISPR-Cas systems, which have proven to be extraordinarily simple and efficient in DNA and RNA editing, nucleic acid detection, and disease diagnosis [7,28,29]. The CRISPR/Cas9 system has been engineered for gene editing in various organisms and was originally confirmed as a bacterial immune system. The plasmid pCasSA is a specific CRISPR/Cas9 system designed for S. aureus gene knockout [12]. In this study, we performed gene editing of S. aureus nt5 using pCasSA to investigate the function of nt5. Unfortunately, no bacteria survived due to the weak homologous recombination in S. aureus and the difficulty in repairing bacterial double-stranded DNA breaks (Figure 8).

Figure 8.

Compared to the mock transfection of plasmid pCasSA to S. aureus (A), S. aureus with nt5 gene knocked out by CRISPR/Cas9 could not grow in the Cm-containing TSB agar plate due to the too weak homologous recombination ability in S. aureus to repair bacterial double-stranded DNA breaks (B). Cm: chloramphenicol.

Base editing is an efficient gene mutation strategy that induces single nucleotide changes in the DNA of living cells without causing DNA double strand breaks [13,30]. There are two kinds of base editors: cytidine editors and adenosine editors. Efficient editing by the C/T conversion “base editor” requires the presence of a PAM motif with an NGG nucleotide sequence, which has an editable window from positions 4 to 8 in the spacer sequence. This requirement for PAM limits the number of sites in the bacterial genome. An editable site for the pnCasSA-BEC system is essential for achieving highly efficient base editing. In addition, a disadvantage of the pnCasSA-BEC system is that the mutation site of the target gene cannot be verified by measuring the mRNA level using the CRISPR/Cas9 system [30]. In our study, the mRNA expression level of the nt5 gene was still detectable in the S. aureus MT (Figure 6f), and DNA sequencing was required to confirm a base mutation in the termination codons (Figure 1c,d).

S. aureus usually causes serious infections with an annual incidence of 20–50 cases per 100,000 people. Approximately 10%-30% of these patients die from S. aureus infections, which account for a greater number of deaths than AIDS, tuberculosis, and viral hepatitis combined [31]. Although antibiotics, including vancomycin and DAP, have powerful antibacterial activity against S. aureus, the increase in bacterial drug resistance has led to the gradual failure of these antibiotics.

The application of base editing guided by CRISPR RNA is an innovative method, which is helpful to expand the research on bacterial virulence factors. It accomplishes gene editing without causing double-stranded DNA breakage, and has a good application prospect for pathogenic bacteria with weak homologous recombination and repair ability. In addition, the base editing guided by CRISPR RNA can also be developed as a new therapeutic tool, which can significantly reduce the pathogenicity of key genes of pathogenic bacteria and provide a better way to treat pathogenic bacteria infection [32].

Our findings indicate that the deficiency of NT5 function, due to the early occurrence of stop codons within the nt5 gene, causes a twofold increase in the MIC of S. aureus against DAP. In most cases, the resistance mechanism of S. aureus to DAP is attributed to point mutations in multiple genes, leading to changes in phospholipid abundance in bacterial cell membranes. This results in an increase in the negative charge of the bacterial cell membrane, which in turn repels DAP polymerized by calcium ions, thereby protecting bacteria from DAP damage [33,34]. Our study confirmed that the mutation of the S. aureus nt5 gene caused DAP resistance by reducing bacterial cell membrane damage and slowing down DNA release [15,17,35]. So far, the NT5 protein may be a drug resistance gene of DAP, which has not been reported before. Our research provides a new insight into the relationship between nt5 gene mutation of S. aureus and bacterial antibiotic resistance.

Sepsis is a comprehensive inflammatory response caused by bacterial infection, primarily characterized by shock and organ dysfunction, along with several other complications. Among these, acute renal injury resulting from sepsis is a common complication, and its treatment requires further improvement. When microorganisms infect humans, blood-derived lipopolysaccharides are released in significant quantities. This phenomenon may be recognized by the cell membrane receptors of neutrophils and macrophages, stimulating downstream signaling pathways that produce a large number of inflammatory mediators [2,36]. These mediators promote immune responses to combat inflammation but can also lead to a significant depletion of immune cells in other kidney organs, directly causing damage to these organs. Nod-like receptor 3 (NLRP3) inflammasomes, which contain a pyrin domain, may proliferate during various inflammatory responses related to renal injury, resulting in the upregulation of IL-6, IL-1β, and IL-18. The upregulation of these inflammatory factors exacerbates the formation of renal abscesses by increasing renal tubular injury [27]. Our in vivo analysis in a mouse sepsis model and phagocytosis data support that the S. aureus nt5 gene is required for kidney abscess formation and aids bacterial evasion from the host immune response during infection. Immune evasion is an important process by which microorganisms directly modulate the host immune system in response to pathogens. S. aureus escapes phagocytosis by host immune cells in various ways, most commonly by disrupting immune cell function [37]. Our research confirms that the loss of NT5 function reduces the release of inflammatory factors from host cells and alleviates the inflammatory reaction, which, in turn, leads to the alleviation of abscess symptoms.

Our research demonstrates the inactivation of the NT5 protein significantly reduces the virulence of S. aureus and enhances phagocytosis by host immune cells, which provides a potential opportunity to target nt5 as a treatment strategy against S. aureus infection. Due to its high sequence conservation of nt5, it can also serve as a target for vaccine development [25]. In addition, small molecular inhibitors against S. aureus have been reported to alleviate bacterial drug resistance to some extent [38]. The NT5 protein may be a target for small molecule inhibitors because of its dual functions in drug resistance and bacterial virulence. The inhibition of the NT5 protein by small molecular drugs can significantly impair its immune escape capability, aiding cells in recognizing S. aureus, and reducing challenges associated with treating drug-resistant S. aureus. Small molecule inhibitors targeting the NT5 protein will be an attractive strategy to treat S. aureus infection.

In conclusion, based on a new bacterial base editing pnCasSA-BEC system, we have proven that the nt5 gene of S. aureus is necessary for host infection and abscess formation, and the mutation of the nt5 gene will enhance its tolerance to DAP [15,17]. Our data are valuable for the development of NT5 inhibitors and the novel CRISPR/Cas9 mediated gene silencing technology to target the key genes of S. aureus, and for the treatment of S. aureus.

ARRIVE guidelines statement

The authors confirm we have adhered to ARRIVE guidelines (https://doi.org/10.6084/m9.figshare.27977775).

Funding Statement

This work was supported by the Sichuan Science & Technology Program (2024ZYD0107), Chengdu Science and Technology Bureau Program (2020-GH02-00056-HZ).

Disclosure statement

No potential conflict of interest was reported by the author(s).

Author contributions statement

X.L., L.H., and S.L. designed the study. X.L., L.H., Y.Y., M.T., H.W., and F.H. performed the experiments and performed all statistical analysis. Z.X., P.Z., R.D., and S.D. performed sample collection. S.L. obtained funding. X.L., and Y.Y. wrote the manuscript, and all authors revised and approved the manuscript. X.L., and L.H. contributed equally to this study.

Data availability statement

The raw data presented in this study can be found in the figshare dataset. For information linking please refer to: https://doi.org/10.6084/m9.figshare.27977775.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/21505594.2025.2451163