Simple Summary
Porcine reproductive and respiratory syndrome virus (PRRSV) causes huge economic loss to the global swine industry. In China, PRRSV-2 isolates are predominant, but PRRSV-1 isolates are also circulating in the swine herds. Since the first isolations of wild-type PRRSV-1 strains (BJEU06-1 and NMEU09-1), PRRSV-1 has been detected in the majority of regions in China. During the routine investigation of PRRSV-1 in China, we isolated a novel PRRSV-1 strain (AHEU2024-2671) from the lung of a severely diseased piglet from Fuyang city, Anhui province, in January 2024. The AHEU2024-2671 isolate could only replicate in primary alveolar macrophages (PAMs) and not in Marc-145 cells. Genome sequencing and multiple comparisons showed that AHEU2024-2671 is a novel isolate sharing the highest genome similarity (90.67%) with the SC2020-1 isolate. Noticeably, this study identified novel deletions in AHEU2024-2671-like isolates for the first time. Phylogenetic analysis showed that the AHEU2024-2671-like isolates form a new subgroup within subtype 1. Overall, this study provides new insights into the rapid evolution of PRRSV-1 in China.
Keywords: porcine reproductive and respiratory syndrome virus 1, a novel isolate, complete genome sequencing, deletions, evolution
Abstract
Since the first isolation of the porcine reproductive and respiratory syndrome virus 1 (PRRSV-1) BJEU06-1 strain from a Beijing pig farm in 2006, more and more PRRSV-1 isolates have been identified in China. In this study, we performed the routine detection of PRRSV-1 using 1521 clinical samples collected in 12 provinces/cities from February 2022 to May 2024. Only three lung samples from severely diseased piglets collected in January 2024 were detected as PRRSV-1-positive (0.197%, 3/1521). A PRRSV-1 strain (AHEU2024-2671) was successfully isolated in primary alveolar macrophages (PAMs) but not in Marc-145 cells. Genome sequencing showed that the AHEU2024-2671 isolate shared the highest genome similarity (90.67%) with the SC2020-1 isolate but only 84.01% similarity with the predominant BJEU06-1 strain. Noticeably, the AHEU2024-2671-like isolates not only contained deletions in nsp2 and the GP3-GP4 overlap region, but also contained a unique 6 nt deletion between nsp12 and the ORF2 gene. Furthermore, a genome-based phylogenetic tree supported that the AHEU2024-2671-like isolates form a novel subgroup within subtype 1. Overall, this study not only supported the idea that PRRSV-1 is rapidly evolving in Chinese swine herds, but also pulled the alarm that novel PRRSV-1 isolates with potentially increased pathogenicity might already exist in China, although they are still rarely detected among Chinese pigs.
1. Introduction
Porcine reproductive and respiratory syndrome (PRRS) has jeopardized the global swine industry for three decades, causing reproductive disorders in sows and respiratory syndromes in all ages of pigs [1]. PRRS has been estimated to cause USD 2.7 billion economic losses annually for the global swine industry [2]. The corresponding etiological agent, PRRS virus (PRRSV), is a single-stranded, positive-sense RNA virus belonging to the family of Arteriviridae in the order of Nidovirales [3]. The PRRSV genome is approximately 15 kb in length, containing a 5′ cap structure, 5′ untranslated region (UTR), at least 10 open reading frames (ORFs), 3′ UTR and a 3′ poly (A) tail. ORF1a and ORF1b encode 16 nonstructural proteins (nsp1α, nsp1β, nsp2N, nsp2TF, nsp2–nsp6, nsp7α, nsp7β and nsp8–nsp12), while ORF2–ORF7 encode 8 structural proteins, including minor envelope proteins (GP2a, E, GP3, GP4 and 5a), major envelope proteins (GP5 and M) and a nucleocapsid protein (N) [1]. Due to their high genetic diversity, PRRSV isolates have been divided into two species: Betaarterivirus suid 1 (PRRSV-1) and Betaarterivirus suid 2 (PRRSV-2) [4]. PRRSV-1 isolates can be clustered into four subtypes (1, 2, 3 and 4) [5], while PRRSV-2 isolates have been divided into 11 lineages and 21 sub-lineages [6]. PRRSV-1 strains were first isolated in Europe in 1991 [7], and PRRSV-2 strains were first isolated in North America in 1992 [8]. Even though PRRS eradication programs have been implemented in European and North American countries for years [9,10], both PRRSV-1 and PRRSV-2 isolates are still circulating in European, North American and Asian countries [7,8,11,12,13,14,15,16,17].
PRRSV has been prevalent in China for nearly 30 years [18]. Within this, PRRSV-2 isolates are predominant, including classical PRRSV-2, highly pathogenic PRRSV-2, NADC30-like PRRSV-2 and NADC34-like PRRSV-2 [18,19,20,21]. However, since we first isolated wild-type PRRSV-1 strains (BJEU06-1 and NMEU09-1) in mainland China [22], more and more PRRSV-1 strains have been identified in China [23,24,25,26,27,28,29]. For instance, a PRRSV-1 Amervac vaccine-like strain (GZ11-G1) was also isolated from Guizhou province in 2011 [29]. In 2018, a CReSA3-like EUGDHD2018 isolate (MK639926) was identified in Guangdong province, while a PR40-like 180900-5 (MK303390) strain was isolated in Henan province [30]. In 2020, the SC2020-1 strain was isolated from aborted piglets in Sichuan province [31]. Currently, PRRSV-1 has been prevalent in the majority of regions in China with BJEU06-1-like isolates serving as the predominant viruses in Chinese swine herds [32].
In this study, we performed routine detection of PRRSV-1 between February 2022 and May 2024. A total of 1521 clinical samples collected from 12 provinces/cities in China were studied. PRRSV-1 was detected in lung samples collected from severely diseased piglets from Anhui province in January 2024. The virus was isolated and put through complete genome sequencing. Multiple sequences were compared to determine the specific deletions in the genome. Genome-based phylogenetic analysis and recombination analysis were also executed to evaluate the characteristics of this PRRSV-1 isolate.
2. Materials and Methods
2.1. Clinical Sample Collection and Detection
During the routine detection of PRRSV-1 infection, a total of 1521 clinical samples (including lung, lymph node and serum) were submitted from 12 regions of China (Fuyang city in Anhui province; Zhumadian city in Henan province; Qingdao city in Shandong province; Jinchang city in Gansu province; Neijiang city in Sichuan province; Yangzhou city in Jiangsu province; Shuangyashan city in Heilongjiang province; Hangzhou city in Zhejiang province; Chaozhou city in Guangdong province; Xianyang city in Shanxi province; Beijing city; and Shihezi city in Xinjiang Uygur Autonomous Region) to the Animal Hospital at Yangzhou University from 22 February in 2022 to 20 May in 2024 (Table 1). A PRRSV-1-specific real-time RT-PCR assay was used for clinical detection [33]. For the PRRSV-1-positive samples, the infection statuses of other common porcine viruses were also determined as previously described [24,33,34,35], including PRRSV-2, classical swine fever virus (CSFV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), African swine fever virus (ASFV), pseudorabies virus (PRV) and porcine circoviruses (PCV2 and PCV3) (Table S1). In detail, total RNAs were extracted from serum samples or tissue sample homogenates using TRIpure reagent (Aidlab, Beijing, China). A PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa, Osaka, Japan) was used for first-strand cDNA synthesis. A PRRSV-1-specific probe, primer pairs and Premix Ex Taq (Probe qPCR, 2×) (TaKaRa, Osaka, Japan) were utilized for PRRSV-1 real-time PCR detection as we described previously [24].
Table 1.
PRRSV-1 detection in 1521 samples collected from February 2022 to May 2024.
| Region (City, Province) | Sample No. | PRRSV1-Positive No. | Percentage (%) |
|---|---|---|---|
| Fuyang, Anhui | 3 | 3 | 100 |
| Zhumadian, Henan | 329 | 0 | 0 |
| Qingdao, Shandong | 213 | 0 | 0 |
| Jinchang, Gansu | 108 | 0 | 0 |
| Neijiang, Sichuan | 87 | 0 | 0 |
| Yangzhou, Jiangsu | 77 | 0 | 0 |
| Shuangyashan, Heilongjiang | 62 | 0 | 0 |
| Hangzhou, Zhejiang | 40 | 0 | 0 |
| Chaozhou, Guangdong | 567 | 0 | 0 |
| Beijing | 24 | 0 | 0 |
| Xianyang, Shanxi | 4 | 0 | 0 |
| Shihezi, Xinjiang | 7 | 0 | 0 |
| Total | 1521 | 3 | 0.197 |
2.2. Virus Isolation and Immunofluorescence Assay (IFA)
Both primary alveolar macrophages (PAMs) and Marc-145 cells were used for virus isolation and then put through IFA detection as previously described [36]. PAMs were prepared with lung lavage fluid of 6-week-old healthy piglets [37,38]. PAMs were cultured in RPMI-1640 medium (HyClone, Midvale, UT, USA) supplemented with 10% FBS (EallBio, Beijing, China), 100 U/mL penicillin and 100 μg/mL streptomycin (Solarbio, Beijing, China). Marc-145 cells were cultured in DMEM (HyClone, Midvale, UT, USA) supplemented with 10% FBS [39]. The PRRSV-1-positive samples were used for infection. The cytopathic effects (CPEs) in infected Marc-145 cells were monitored daily up to 7 days. The infected PAMs and Marc-145 cells were collected at 48 hpi and put through IFA detection. In detail, the infected cells were washed with PBS and then fixed with 4% paraformaldehyde. Cell samples were permeabilized with 0.5% TritonX-100 for 10 min and blocked with 1% BSA for 2 h. PRRSV N protein-specific murine mAb 15A1 (1:500) (kindly provided by Professor Kegong Tian from the National Research Center for Veterinary Medicine) and Dylight 594 goat anti-mouse IgG (1:1000, Invitrogen, Carlsbad, CA, USA) were used as the primary and secondary antibodies [24]. The 4′, 6-diamidino-2-phenylindole (DAPI) was used for cellular nuclei counterstaining. The results were visualized with an IX53 inverted fluorescence microscope (Olympus, Tokyo, Japan).
2.3. Western Blotting (WB)
WB was performed as we described previously [40]. Briefly, cell samples were first lysed in radio-immunoprecipitation assay (RIPA) buffer (50 mM Tris pH 7.2, 150 mM NaCl, 1% sodium deoxycholate, 1% Triton X-100). Subsequently, the extracted proteins were separated by 15% SDS-PAGE gels and then transferred to polyvinylidene fluoride (PVDF) membranes (Merck Millipore, Billerica, MA, USA). Furthermore, membranes were blocked for 1 h using 5% non-fat milk. Moreover, the membrane was incubated with the primary mAbs (1:1000 anti-GADPH and 1:1000 PRRSV-N mAbs 15A1) at 4 °C overnight. Later on, the membrane was nurtured with HRP-conjugated goat anti-mouse IgG (1:10,000, BBI, Beijing, China) at 37 °C for 1 h. Upon addition of enhanced chemiluminescence (ECL) substrate (Biosharp, Anhui, China), the protein signals were observed and captured by the WB imaging system (Tanon, Shanghai, China).
2.4. Genomic Sequencing
To determine the complete genome of PRRSV-1 isolate, total RNA was extracted from PRRSV-1 infected PAMs using TRIpure Reagent (Aidlab, Beijing, China). First-strand cDNA was composited using the viral RNA and a PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa, Osaka, Japan). Complete PRRSV-1 genomes were amplified using 12 primer pairs (Table 2) modified from previous studies [22,24,41]. The 12 PCR products overlapped with each other spanning the entire genome. The obtained amplicons were put through Sanger Sequencing by GENEWIZ Company (Suzhou, China). The obtained PRRSV-1 sequences were pieced together using DNAMAN 6.0 software [42].
Table 2.
Primers used for PRRSV-1 genome amplification.
| Primers | Sequence (5′→3′) | Length (bp) | Region * |
|---|---|---|---|
| PRRSV1-1F | ATGATGTGTAGGGTATTCCCC | 21 | 1–1375 |
| PRRSV1-1R | CCATACCACTTGTGTGTCCC | 20 | |
| PRRSV1-2F | TCGATCCTGATGGTCCCAT | 19 | 1195–2588 |
| PRRSV1-2R | GTTGTCGGGTGTTTGCTCT | 19 | |
| PRRSV1-3F | AAGGTCCTGATGAACAAGCAC | 21 | 2335–3680 |
| PRRSV1-3R | GCTCTTTTGCTCTGTCGC | 18 | |
| PRRSV1-4F | TTGGAGAGGTCTCATGCTTTC | 21 | 3491–6279 |
| PRRSV1-4R | CACTGTTGGTCATAGCAAGG | 20 | |
| PRRSV1-5F | GCCTCTCGACTGTTCAACT | 19 | 5908–7371 |
| PRRSV1-5R | GGAGTTGACTAATGATGCGC | 20 | |
| PRRSV1-6F | GTTGGCACTGTTGTGATCG | 19 | 7176–8533 |
| PRRSV1-6R | GAATTTGTTTTTCCCCAAGGC | 21 | |
| PRRSV1-7F | CAAGGAGAATTGGCAAACTG | 20 | 8344–9770 |
| PRRSV1-7R | GCCCCACTATAAACTTGCTG | 20 | |
| PRRSV1-8F | ATAACAAAACAACGGCCCT | 19 | 9573–10,975 |
| PRRSV1-8R | TATGCGTCCTGTTGAAACG | 19 | |
| PRRSV1-9F | CACCAGAATAATCGGGCG | 18 | 10,766–12,106 |
| PRRSV1-9R | ACCATTTCATCAATTAGGTGGG | 22 | |
| PRRSV1-10F | CGCCTTCACTGAGTTCCTT | 19 | 11,830–13,284 |
| PRRSV1-10R | GATGACTTTGAAGCCTTTCTCG | 22 | |
| PRRSV1-11F | CGGCCATTCTTTTCCTCC | 18 | 12,941–14,022 |
| PRRSV1-11R | CTTCGAGGACGACATGTTTG | 20 | |
| PRRSV1-12F | CTGGGTTTTCTCACAACAAGC | 21 | 13,710–15,074 |
| PRRSV1-12R | AATTTCGGTCACATGGTTC | 19 |
2.5. Multiple Alignment, Phylogenetic Analysis and Recombination Detection
To compare the similarities among our PRRSV-1 isolate and previously identified PRRSV-1 strains, complete genome and fragment alignments were carried out using DNAMAN 6.0 [9]. To determine the evolutionary relationships between our PRRSV-1 isolate and representative PRRSV strains, the complete genomes from our PRRSV-1 isolate, 49 representative PRRSV-1 isolates and 3 representative PRRSV-2 isolates were put through multiple sequence alignment by Clustal X [10]. A genome-based phylogenetic tree was constructed by MEGA 6.06 [9,15]. To analyze the role of recombination events in the generation of our PRRSV-1 isolate, RDP4 and SimPlot 3.5.1 were used to screen potential cross-over events in the aligned PRRSV genomes [16,43].
2.6. Statistical Analysis
The in vitro virus replication in PAMs was shown in means ± standard deviations (SD). The differences among groups were detected using a Mann–Whitney U test embedded in the Graphpad Prism 8 XML project [44]. A p value < 0.05 indicated statistical significance.
3. Results
3.1. PRRSV-1 Detection
During the routine detection of PRRSV-1 in 1521 clinical samples, the PRRSV-1-positive rate was only 0.197% (3/1521) (Table 1). PRRSV-1 was only identified in three lung samples collected from severely diseased piglets in Fuyang city, Anhui province, on 19 January 2024 (Figure 1). Meanwhile, the other common porcine viruses (PRRSV-2, CSFV, PEDV, TGEV, PDCoV, ASFV, PRV, PCV2 and PCV3) turned out to be all negative in the three lung samples (Figure 1). These results indicated that severe clinical diseases in piglets might be associated PRRSV-1 infection.
Figure 1.
The detection of PRRSV-1 in a lung sample from severely diseased piglets. Real-time RT-PCR assays were utilized to detect PRRSV1, PRRSV-2, CSFV, PEDV, TGEV, PDCoV, ASFV, PRV, PCV2 and PCV3 as previously described [24,33,34,35]. Only PRRSV-1 was detected in the representative lung sample.
3.2. PRRSV-1 Isolation
To characterize the new PRRSV-1 strain, PRRSV-1-positive lung homogenates were put through virus isolation in PAMs and Marc-145 cells. IFA was performed using inoculated PAMs and Marc-145 cells at 48 hpi. As shown in Figure 2A, the new PRRSV-1 could be isolated in PAMs, which was denominated as AHEU2024-2671 strain. However, it could not be isolated in Marc-145 cells (Figure 2B). The replication efficacies of AHEU2024-2671 and SD1291 isolates in PAMs were also determined. Both growth curves and WB results supported that the AHEU2024-2671 isolate has significantly higher replication efficacy than the SD1291 isolate at 72–96 hpi (p < 0.05) (Figure 3).
Figure 2.
PRRSV-1 isolation in PAMs and Marc-145 cells. (A) The infected PAMs were examined by IFA at 48 hpi. PRRSV-1-specific antigen was detected in AHEU2024-2671-infected PAMs. PRRSV-1 SD1291 isolate-infected cells were used as positive control [24], while mock-infected cells were set as negative control. (B) The infected Marc-145 cells were also examined by IFA at 48 hpi. PRRSV-1 specific antigen could not be detected in AHEU2024-2671-infected Marc-145 cells. PRRSV-2 XJ17-5 isolate-infected cells were used as positive control [9], while mock-infected cells were set as negative control.
Figure 3.
Replication efficacies of PRRSV-1 isolates in PAMs. (A) Dynamics of virus replication in PAMs were detected by PRRSV-1-specific real-time RT-PCR assay [45]. Multiple-step growth curves showed that the AHEU2024-2671 isolate has significantly higher in vitro replication efficacy than the SD1291 isolate from 72 to 96 hpi (p < 0.05). (B) WB results also showed that PRRSV-1 N protein expression levels were higher in the AHEU2024-2671-infected PAMs than in the SD1291-infected PAMs at 72–96 hpi. ** indicates p < 0.01, *** indicates p < 0.001.
3.3. Genomic Comparison
To determine the genomic feature of the new PRRSV-1 isolate, the complete genome of AHEU2024-2671 was identified. The AHEU2024-2671 genome is 15,074 bp in length excluding the poly (A) tail. The genome sequence of AHEU2024-2671 has been deposited into the GenBank database with the accession number PQ640355. In addition, ORF5 sequencing confirmed that the other two PRRSV-1-positive clinical samples contain nearly identical viruses to AHEU2024-2671 (100% ORF5 identity). As shown in Table 3, the AHEU2024-2671 isolate only shared 86.67% and 84.06% genome similarities with the representative LV strain and the predominant BJEU06-1 isolate in China, respectively. Noticeably, the AHEU2024-2671 isolate had the highest genome homology (90.67%) with the SC2020-1 isolate. Each fragment comparison showed that nsp2TF and GP3 are the most variable nonstructural and structural proteins, respectively. As shown in Figure 4, multiple nsp2 alignment showed that the AHEU2024-2671 isolate had the same single amino acid (aa) deletions at 324 and 423 positions as SC2020-1 and SCPJ2023 isolates (Figure 4A). In addition, a 4-aa deletion was also identified at 64–67 positions within the GP3 and GP4 overlap regions of the AHEU2024-2671, SL-01, SC2020-1 and SCPJ2023 isolates (Figure 4B). Moreover, 31 aa substitutions were observed in GP5 of the AHEU2024-2671 isolate when compared with the LV strain, including 2 aa mutations (S194P and A201V) within a B-cell epitope (189–201 aa) (Figure 4C). Remarkably, here, we also identified for the first time that there is a 6 nt deletion between ORF1b and ORF2 genes in the genomes of AHEU2024-2671, SC2020-1 and SCPJ2023 isolates (Figure 4D).
Table 3.
Detailed comparisons of AHEU2024-2671 isolate to representative PRRSV-1 strains.
| Region | Length * | Similarity to AHEU2024-2671 (%) | |||||
|---|---|---|---|---|---|---|---|
| LV | Amervac | BJEU06-1 | HKEU06 | NMEU09-1 | SC2020-1 | ||
| Nucleotides (nt) | |||||||
| 5′UTR | 221 | 92.34 | 91.89 | 91.44 | 91.44 | 90.54 | 91.44 |
| ORF1a | 7185 | 85.18 | 83.41 | 81.82 | 81.88 | 79.82 | 89.23 |
| ORF1b | 4392 | 88.39 | 87.30 | 86.13 | 86.20 | 84.45 | 92.94 |
| ORFs 2–7 | 3177 | 87.21 | 86.52 | 85.55 | 86.37 | 85.99 | 90.78 |
| 3′UTR | 114 | 94.74 | 92.11 | 94.74 | 92.98 | 94.74 | 96.49 |
| Complete | 15,074 | 86.67 | 85.34 | 84.06 | 84.24 | 82.68 | 90.67 |
| Proteins (aa) | |||||||
| Nsp1α | 180 | 92.22 | 90.56 | 89.44 | 87.78 | 90.56 | 90.00 |
| Nsp1β | 205 | 81.95 | 80.00 | 80.00 | 79.02 | 75.61 | 82.44 |
| Nsp2N | 729 | 76.06 | 73.87 | 69.04 | 69.90 | 65.53 | 82.58 |
| Nsp2TF | 898 | 64.27 | 62.68 | 58.45 | 73.89 | 70.67 | 84.86 |
| Nsp2 | 1076 | 82.00 | 80.24 | 76.60 | 77.46 | 73.84 | 86.73 |
| Nsp3 | 230 | 92.61 | 92.61 | 90.43 | 92.17 | 91.74 | 94.78 |
| Nsp4 | 203 | 91.13 | 92.12 | 87.68 | 89.66 | 84.24 | 94.09 |
| Nsp5 | 170 | 93.53 | 91.76 | 92.94 | 93.53 | 90.00 | 95.29 |
| Nsp6 | 16 | 93.75 | 93.75 | 93.75 | 100.00 | 93.75 | 100.00 |
| Nsp7α | 149 | 95.97 | 95.30 | 95.97 | 94.63 | 96.64 | 97.32 |
| Nsp7β | 108 | 92.59 | 89.81 | 92.59 | 92.59 | 88.89 | 91.67 |
| Nsp8 | 45 | 95.56 | 93.33 | 93.33 | 93.33 | 95.56 | 97.78 |
| Nsp9 | 685 | 95.62 | 95.33 | 95.18 | 95.18 | 94.74 | 96.06 |
| Nsp10 | 442 | 93.44 | 92.99 | 94.57 | 91.18 | 92.31 | 96.38 |
| Nsp11 | 224 | 96.88 | 96.88 | 96.88 | 94.64 | 94.64 | 96.88 |
| Nsp12 | 152 | 93.42 | 94.08 | 92.76 | 93.42 | 90.13 | 94.74 |
| GP2a | 249 | 89.96 | 87.55 | 88.35 | 87.15 | 87.15 | 94.38 |
| E | 70 | 94.29 | 94.29 | 94.29 | 90.00 | 94.29 | 98.57 |
| GP3 | 261 | 78.60 | 78.60 | 77.12 | 78.87 | 80.07 | 84.87 |
| GP4 | 179 | 83.06 | 84.15 | 80.33 | 83.06 | 83.06 | 84.70 |
| GP5 | 201 | 84.58 | 86.57 | 88.56 | 88.56 | 85.57 | 88.06 |
| GP5a | 43 | 95.35 | 93.02 | 88.37 | 93.02 | 95.35 | 90.70 |
| M | 173 | 91.91 | 91.91 | 89.60 | 93.64 | 91.33 | 91.33 |
| N | 128 | 92.97 | 92.19 | 85.94 | 89.06 | 88.28 | 90.63 |
Figure 4.
Multiple sequence alignments of representative PRRSV-1 strains. (A) The AHEU2024-2671 isolate has 2 single aa deletions at 324 and 423 positions (in pink) of nsp2. The grey highlights are deletions in nsp2 of other PRRSV-1 isolates. (B) The AHEU2024-2671 isolate has 4 aa deletions (in turquoise) at positions 64–67 in the GP3-GP4 overlap region. The grey highlights are corresponding deletions in other PRRSV-1 isolates. (C) The AHEU2024-2671 isolate has 31 aa substitutions compared with the LV strain, including two mutations within the 189-201 B-cell epitope. The grey highlights are the B-cell epitope sites in GP5. (D) The AHEU2024-2671-like isolates have a unique 4 nt deletion (green) between theORF1b gene and the ORF2 gene.
3.4. Phylogenetic Analysis
To evaluate the evolutionary relationships between the AHEU2024-2671 isolate and other PRRSV-1 isolates, a genome-based phylogenetic tree was constructed (Figure 5). In addition to the previously described five subgroups, including LV-like, Amervac-like BJEU06-1-like, HKEU16-like and NMEU09-1-like isolates, recent Chinese PRRSV-1 isolates were also clustered within three new subgroups. The AHEU2024-2671 isolate was grouped with SC2020-1, SL-01 and SCPJ2023 isolates, forming a new subgroup 2 within subtype 1 of PRRSV-1 (Figure 5).
Figure 5.
Genome-based phylogenetic tree for Chinese PRRSV-1 isolates. The phylogenetic tree was constructed based on 50 PRRSV-1 and 3 PRRSV-2 genomes. The AHEU2024-2671 isolate was grouped within a new subgroup.
3.5. Recombination Detection
To detect the role of recombination in the generation of the AHEU2024-2671 isolate, potential cross-over events were detected by RDP4 and SimPlot methods using the 53 multiple aligned PRRSV genomes. No cross-over event was detected in the AHEU2024-2671 genome using both methods.
4. Discussion
Even though PRRSV-2 isolates are still predominant in China, a recent review showed that PRRSV-1 has been spread to at least 23 regions in China [32]. More importantly, novel PRRSV-1 isolates with high genetic and pathogenic diversity have kept emerging in Chinese swine herds in recent years [24,30,31,48,49,50]. Therefore, it is extremely important to monitor the prevalence and evolution of PRRSV-1 in China. In this study, we routinely detected PRRSV-1 from February 2022 to May 2024. Within 1521 clinical samples collected from 12 regions in China, only 3 PRRSV-1-positive samples were detected from severely diseased piglets. No other common porcine viruses were detected in these PRRSV-1-positive samples. The new PRRSV-1 strain (AHEU2024-2671) could be isolated in PAMs but not in Marc-145 cells. Genome sequencing and comparison showed that the AHEU2024-2671 isolate showed the highest genome similarity (90.67%) with the SC2020-1 isolate. In addition, aa deletions were identified in nsp2 and the GP3-GP4 overlap region. Noticeably, a novel deletion was first identified between ORF1b and ORF2 genes in this study. Furthermore, phylogenetic analysis indicated that the AHEU2024-2671 isolate is a novel isolate belonging to a new subgroup within subtype 1 of PRRSV-1 isolates. However, no recombination event was detected in the AHEU2024-2671 genome.
Our previously identified PRRSV-1, BJEU06-1 and NMEU09-1 strains were also isolated in PAMs but could not infect Marc-145 cells [22]. In addition, the HLJB1 strain recombined from the BJEU06-1-like isolate and the Amervac vaccine-like isolate also could not replicate in Marc-145 cells [41,51]. Similarly, our AHEU2024-2671 isolate could only be isolated in PAMs but not in Marc-145 cells. However, the Amervac-like GZ11-G1 isolate could be isolated within Marc-145 cells [29]. Similar results were obtained from a previous study by comparing PRRSV isolation in ZMAC and Marc-145 cells [43]. Noticeably, a previous study showed that the 88/94/95 amino acid substitutions in GP2a play a critical role in determining PRRSV-1 adaptation to Marc-145 cells [52]. However, they only evaluated the influences of the triple substitutions in two PRRSV-1 isolates (13V091 and IVI-1173) that are already able to infect Marc-145 cells. Whether these substitutions are sufficient or essential factors for AHEU2024-2671 adaptation to Marc-145 cells deserves further investigation.
PRRSV-1 was first isolated in the Netherlands more than 30 years ago and is still circulating in many European countries such as the Netherlands, Italy and Hungary [9,17,42]. In China, previous epidemiological investigations showed that PRRSV-1-positive rates could range from 0.26% to 32% in different regions, while the majority of studies indicated that the PRRSV-1-positive rate was generally less than 3% [24,48,50,53,54,55,56,57]. For instance, the PRRSV-1-positive rate might reach up to 32% during an outbreak on Taiwan pig farms [48]. In addition, PRRSV-1 was detected in 186 out of 750 samples (24.8%) collected from 50 pig farms in Guangdong province in 2016 [57]. However, an investigation by OIE reference laboratory showed that the percentages of PRRSV-1-positive samples were 1.4% (53/3823) and 2.5% (119/4764) on breeding pig farms from 2018 to 2019 [30]. Our previous studies using 712 clinical samples and 257 clinical samples showed that PRRSV-1-positive rates were 0.28% and 0.39%, respectively [24,54]. In this study, the PRRSV-1-positive rate was only 0.197% during the detection of 1521 clinical samples, indicating that PRRSV-1 is sporadically spread in China.
Nsp2 is the most variable nonstructural protein. Insertions and deletions are commonly detected in the nsp2 of PRRSV-1 isolates [49]. In this study, we also identified two single aa deletions within nsp2 of the AHEU2024-2671 isolate. The nsp2 deletions are identical to previously isolated SC2020-1 and SCPJ2023 strains [31]. Similarly, the same deletion was also detected in the GP3-GP4 overlap region between the AHEU2024-2671 isolate and three previous isolates (SL-01, SC2020-1 and SCPJ2023 strains). Remarkably, positions 48–76 of the GP3-GP4 overlap region was identified as a B-cell epitope site (ES12) previously [58]. The deletion in the ES12 might disturb humoral immune responses by causing conformational changes [59]. Moreover, a novel deletion was first identified between ORF1b and ORF2 genes among AHEU2024-2671, SC2020-1 and SCPJ2023 strains in this study. The exact influences of these deletions on the novel AHEU2024-2671-like isolates deserve further investigation.
Until 2017, Chinese PRRSV-1 isolates were clustered within five subgroups (LV-like, HKEU16-like, BJEU06-1-like, NMEU09-1-like and Amervac-like) [41]. Within this, BJEU06-1-like isolates are predominant in Chinese swine herds [32]. However, more and more novel PRRSV-1 isolates have been detected in China in recent years. Several novel PRRSV-1 genomes have been submitted to GenBank. However, the genomic and pathogenic characteristics of these novel PRRSV-1 isolates were rarely described. In this study, we showed that novel Chinese PRRSV-1 isolates might be divided into three new subgroups within subtype 1 of PRRSV-1. The AHEU2024-2671 isolate was grouped with SL-01, SC2020-1 and SCPJ2023 isolates, forming the new subgroup 2. Our results are consistent with previous studies that novel PRRSV-1 keeps emerging in Chinese swine herds, which deserves more attention.
The novel AHEU2024-2671 isolate has higher in vitro replication efficacy than the BJEU06-1-like SD1291 isolate. The SD1291 isolate has been determined to be a moderately pathogenic strain in piglets [24]. More importantly, the AHEU2024-2671 strain was isolated from severely diseased piglets that tested negative for other common porcine viruses. In addition, our AHEU2024-2671 isolate shared the highest genomic similarity with the SC2020-1 isolate, which was closely associated with a 15% abortion rate in sows from Sichuan province [31]. Whether the AHEU2024-2671 isolate had increased pathogenicity and was responsible for clinically severe diseases requires further investigation.
5. Conclusions
This study isolated a novel PRRSV-1 isolate from severely diseased piglets in 2024. Complete genome characterization identified novel deletions in the AHEU2024-2671 genome for the first time. In addition, a genome-based phylogenetic tree showed that the AHEU2024-2671 isolate is a novel PRRSV-1 isolate belonging to a new subgroup within subtype 1 of PRRSV-1 isolates. The pathogenicity of the AHEU2024-2671 isolate should be determined to evaluate whether it is responsible for severe clinical diseases.
Supplementary Materials
The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/vetsci12010061/s1. Table S1: Primers and probes used for the detection of porcine viruses.
Author Contributions
Conceptualization, N.C.; methodology, S.Y., M.C. and C.L.; software, N.C.; validation, S.Y., M.C., M.Q., X.Z. and N.C.; formal analysis, S.Y. and N.C.; investigation, S.Y., M.C., C.L., M.Q., X.Z., Y.L., Y.M., Y.Q. and W.Q.; resources, N.C.; data curation, S.Y., M.C., C.L., M.Q., X.Z., Y.L., Y.M., Y.Q., H.L. and W.Q.; writing—original draft preparation, N.C. and S.Y.; writing—review and editing, H.L., W.Z., K.F., J.Z. and N.C.; visualization, N.C. and S.Y.; supervision, N.C. and K.F.; project administration, J.Z. and N.C.; funding acquisition, N.C. and K.F. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The genome sequence of the PRRSV-1 AHEU2024-2671 isolate has been deposited into the GenBank database with the accession number PQ640355.
Conflicts of Interest
The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.
Funding Statement
This research was funded by the National Key R&D Program of China (2023YFD1800504), the Open Project Program of Fujian Provincial Key Laboratory for Prevention and Control of Animal Infectious Diseases and Biotechnology (ZDSYS2024001), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), and 111 Project D18007. Kewei Fan was selected as “Innovation Star” in the Forth Batch of Talent Project in Fujian Province (Fujian Special Letter [2023] No.110).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Lunney J.K., Fang Y., Ladinig A., Chen N., Li Y., Rowland B., Renukaradhya G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016;4:129–154. doi: 10.1146/annurev-animal-022114-111025. [DOI] [PubMed] [Google Scholar]
- 2.Cohen J. Meat from gene-edited pigs could hit the market. Science. 2024;383:940–941. doi: 10.1126/science.ado9328. [DOI] [PubMed] [Google Scholar]
- 3.Cavanagh D. Nidovirales: A new order comprising Coronaviridae and Arteriviridae. Arch. Virol. 1997;142:629–633. [PubMed] [Google Scholar]
- 4.Walker P.J., Siddell S.G., Lefkowitz E.J., Mushegian A.R., Adriaenssens E.M., Dempsey D.M., Dutilh B.E., Harrach B., Harrison R.L., Hendrickson R.C., et al. Changes to virus taxonomy and the Statutes ratified by the International Committee on Taxonomy of Viruses (2020) Arch. Virol. 2020;165:2737–2748. doi: 10.1007/s00705-020-04752-x. [DOI] [PubMed] [Google Scholar]
- 5.Stadejek T., Larsen L.E., Podgorska K., Botner A., Botti S., Dolka I., Fabisiak M., Heegaard P.M.H., Hjulsager C.K., Huc T., et al. Pathogenicity of three genetically diverse strains of PRRSV Type 1 in specific pathogen free pigs. Vet. Microbiol. 2017;209:13–19. doi: 10.1016/j.vetmic.2017.05.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yim-Im W., Anderson T.K., Paploski I.A.D., VanderWaal K., Gauger P., Krueger K., Shi M., Main R., Zhang J. Refining PRRSV-2 genetic classification based on global ORF5 sequences and investigation of their geographic distributions and temporal changes. Microbiol. Spectr. 2023;11:e0291623. doi: 10.1128/spectrum.02916-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Wensvoort G., Terpstra C., Pol J.M., ter Laak E.A., Bloemraad M., de Kluyver E.P., Kragten C., van Buiten L., den Besten A., Wagenaar F., et al. Mystery swine disease in The Netherlands: The isolation of Lelystad virus. Vet. Q. 1991;13:121–130. doi: 10.1080/01652176.1991.9694296. [DOI] [PubMed] [Google Scholar]
- 8.Collins J.E., Benfield D.A., Christianson W.T., Harris L., Hennings J.C., Shaw D.P., Goyal S.M., McCullough S., Morrison R.B., Joo H.S., et al. Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs. J. Vet. Diagn. Investig. 1992;4:117–126. doi: 10.1177/104063879200400201. [DOI] [PubMed] [Google Scholar]
- 9.Bálint A., Jakab S., Kaszab E., Marton S., Bányai K., Kecskeméti S., Szabó I. Spatiotemporal Distribution of PRRSV-1 Clades in Hungary with a Focus on the Era of Disease Eradication. Animals. 2024;14:175. doi: 10.3390/ani14010175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Rowland R.R.R., Lunney J.K. Alternative strategies for the control and elimination of PRRS. Vet. Microbiol. 2017;209:1–4. doi: 10.1016/j.vetmic.2017.09.006. [DOI] [PubMed] [Google Scholar]
- 11.Albina E. Epidemiology of porcine reproductive and respiratory syndrome (PRRS): An overview. Vet. Microbiol. 1997;55:309–316. doi: 10.1016/S0378-1135(96)01322-3. [DOI] [PubMed] [Google Scholar]
- 12.Kuwahara H., Nunoya T., Tajima M., Kato A., Samejima T. An outbreak of porcine reproductive and respiratory syndrome in Japan. J. Vet. Med. Sci. 1994;56:901–909. doi: 10.1292/jvms.56.901. [DOI] [PubMed] [Google Scholar]
- 13.Fang Y., Schneider P., Zhang W.P., Faaberg K.S., Nelson E.A., Rowland R.R. Diversity and evolution of a newly emerged North American Type 1 porcine arterivirus: Analysis of isolates collected between 1999 and 2004. Arch. Virol. 2007;152:1009–1017. doi: 10.1007/s00705-007-0936-y. [DOI] [PubMed] [Google Scholar]
- 14.Balka G., Hornyak A., Balint A., Kiss I., Kecskemeti S., Bakonyi T., Rusvai M. Genetic diversity of porcine reproductive and respiratory syndrome virus strains circulating in Hungarian swine herds. Vet. Microbiol. 2008;127:128–135. doi: 10.1016/j.vetmic.2007.08.001. [DOI] [PubMed] [Google Scholar]
- 15.Prajapati M., Acharya M.P., Yadav P., Frossard J.P. Farm characteristics and sero-prevalence of porcine reproductive and respiratory syndrome virus (PRRSV) antibodies in pigs of Nepal. Vet. Med. Sci. 2023;9:174–180. doi: 10.1002/vms3.1011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Donneschi A., Recchia M., Romeo C., Pozzi P., Salogni C., Maisano A.M., Santucci G., Scali F., Faccini S., Boniotti M.B., et al. Infectious Agents Associated with Abortion Outbreaks in Italian Pig Farms from 2011 to 2021. Vet. Sci. 2024;11:496. doi: 10.3390/vetsci11100496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Balka G., Podgórska K., Brar M.S., Bálint A., Cadar D., Celer V., Dénes L., Dirbakova Z., Jedryczko A., Márton L., et al. Genetic diversity of PRRSV 1 in Central Eastern Europe in 1994–2014: Origin and evolution of the virus in the region. Sci. Rep. 2018;8:7811. doi: 10.1038/s41598-018-26036-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Guo B.Q., Chen Z.S., Liu W., Cui Y.Z. Isolation and identification of porcine reproductive and respiratory syndrome (PRRS) virus from aborted fetuses suspected of “PRRS”. Chin. J. Prev. Vet. Med. 1996;2:1–5. [Google Scholar]
- 19.Tian K., Yu X., Zhao T., Feng Y., Cao Z., Wang C., Hu Y., Chen X., Hu D., Tian X., et al. Emergence of fatal PRRSV variants: Unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PLoS ONE. 2007;2:e526. doi: 10.1371/journal.pone.0000526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Zhao K., Ye C., Chang X.B., Jiang C.G., Wang S.J., Cai X.H., Tong G.Z., Tian Z.J., Shi M., An T.Q. Importation and Recombination Are Responsible for the Latest Emergence of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus in China. J. Virol. 2015;89:10712–10716. doi: 10.1128/JVI.01446-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zhang H.L., Zhang W.L., Xiang L.R., Leng C.L., Tian Z.J., Tang Y.D., Cai X.H. Emergence of novel porcine reproductive and respiratory syndrome viruses (ORF5 RFLP 1-7-4 viruses) in China. Vet. Microbiol. 2018;222:105–108. doi: 10.1016/j.vetmic.2018.06.017. [DOI] [PubMed] [Google Scholar]
- 22.Chen N., Cao Z., Yu X., Deng X., Zhao T., Wang L., Liu Q., Li X., Tian K. Emergence of novel European genotype porcine reproductive and respiratory syndrome virus in mainland China. J. Gen. Virol. 2011;92:880–892. doi: 10.1099/vir.0.027995-0. [DOI] [PubMed] [Google Scholar]
- 23.Hsueh F.C., Kuo K.L., Hsu F.Y., Wang S.Y., Chiu H.J., Wu M.T., Lin C.F., Huang Y.H., Chiou M.T., Lin C.N. Molecular Characteristics and Pathogenicity of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) 1 in Taiwan during 2019–2020. Life. 2023;13:843. doi: 10.3390/life13030843. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li C., Qiu M., Li S.B., Sun Z., Huang Z.T., Qi W.H., Qiu Y.J., Li J.X., Feng B.H., Zhao D.S., et al. Metagenomic and Pathogenic Assessments Identify a Pathogenic Porcine Reproductive and Respiratory Syndrome Virus 1 with New Deletions from Adult Slaughter Pig in 2022. Transbound. Emerg. Dis. 2023;2023:1975039. doi: 10.1155/2023/1975039. [DOI] [Google Scholar]
- 25.Wang X., Bai X., Wang Y., Wang L., Wei L., Tan F., Zhou Z., Tian K. Pathogenicity characterization of PRRSV-1 181187-2 isolated in China. Microb. Pathog. 2023;180:106158. doi: 10.1016/j.micpath.2023.106158. [DOI] [PubMed] [Google Scholar]
- 26.Xu H., Gong B.J., Sun Q., Li C., Zhao J., Xiang L.R., Li W.S., Guo Z.Y., Tang Y.D., Leng C.L., et al. Genomic Characterization and Pathogenicity of BJEU06-1-Like PRRSV-1 ZD-1 Isolated in China. Transbound. Emerg. Dis. 2023;2023:6793604. doi: 10.1155/2023/6793604. [DOI] [Google Scholar]
- 27.Gong B.J., Xu H., Sun Q., Li C., Xiang L.R., Zhao J., Li W.S., Guo Z.Y., Li J.H., Wang Q., et al. Dissecting Genetic Diversity and Evolutionary Trends of Chinese PRRSV-1 Based on Whole-Genome Analysis. Transbound. Emerg. Dis. 2024;2024:9705539. doi: 10.1155/2024/9705539. [DOI] [Google Scholar]
- 28.Zheng J.Y., Wu Y., Gao X.P., Lin L.M., Chang H., Zhu G.J., Fang S.Y., Li W., Ren B.H., Li Q.H., et al. Characterization and Pathogenicity of the Novel Porcine Reproductive and Respiratory Syndrome Virus 1 Strain SL-01 in China. Transbound. Emerg. Dis. 2024;2024:6873468. doi: 10.1155/2024/6873468. [DOI] [Google Scholar]
- 29.Wang X.C., Yang X.R., Zhou R., Zhou L., Ge X.N., Guo X., Yang H.C. Genomic characterization and pathogenicity of a strain of type 1 porcine reproductive and respiratory syndrome virus. Virus Res. 2016;225:40–49. doi: 10.1016/j.virusres.2016.09.006. [DOI] [PubMed] [Google Scholar]
- 30.Tan F.F., Zhou Z., Tian K.G. Epidemic status and prevention strategies of PRRSV-1 in China. Chin. J. Prev. Vet. Med. 2022;44:1125–1130. [Google Scholar]
- 31.Zhao J., Zhu L., Deng H., Li F., Xu L., Sun X., Yin W., Kuang S., Li S., Zhou Y., et al. Genetic characterization of a novel porcine reproductive and respiratory syndrome virus type I strain from southwest China. Arch. Virol. 2021;166:1769–1773. doi: 10.1007/s00705-021-04998-z. [DOI] [PubMed] [Google Scholar]
- 32.Sun Q., Xu H., An T., Cai X., Tian Z., Zhang H. Recent Progress in Studies of Porcine Reproductive and Respiratory Syndrome Virus 1 in China. Viruses. 2023;15:1528. doi: 10.3390/v15071528. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Chen N., Huang Y., Ye M., Li S., Xiao Y., Cui B., Zhu J. Co-infection status of classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circoviruses (PCV2 and PCV3) in eight regions of China from 2016 to 2018. Infect. Genet. Evol. 2019;68:127–135. doi: 10.1016/j.meegid.2018.12.011. [DOI] [PubMed] [Google Scholar]
- 34.Feng B.H., Li C., Qiu Y.J., Qi W.H., Qiu M., Li J.X., Lin H., Zheng W.L., Zhu J.Z., Chen N.H. Genomic Characterizations of Porcine Epidemic Diarrhea Viruses (PEDV) in Diarrheic Piglets and Clinically Healthy Adult Pigs from 2019 to 2022 in China. Animals. 2023;13:1562. doi: 10.3390/ani13091562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Chen N.H., Li S., Ye M.X., Huang Y.C., Huang Y., Xiao Y.Z., Yu X., Dong J.B., Tian K.G., Zhu J.Z. A novel NADC30-like porcine reproductive and respiratory syndrome virus (PRRSV) plays a limited role in the pathogenicity of porcine circoviruses (PCV2 and PCV3) and PRRSV co-infection. Transbound. Emerg. Dis. 2019;66:28–34. doi: 10.1111/tbed.13026. [DOI] [PubMed] [Google Scholar]
- 36.Li S., Li X., Qiu M., Li J., Xiao Y., Lin H., Zheng W., Zhu J., Chen N. Transcriptomic profiling reveals different innate immune responses in primary alveolar macrophages infected by two highly homologous porcine reproductive and respiratory syndrome viruses with distinct virulence. Microb. Pathog. 2021;158:105102. doi: 10.1016/j.micpath.2021.105102. [DOI] [PubMed] [Google Scholar]
- 37.Chen N., Ye M., Li S., Huang Y., Zhou R., Yu X., Tian K., Zhu J. Emergence of a novel highly pathogenic recombinant virus from three lineages of porcine reproductive and respiratory syndrome virus 2 in China 2017. Transbound. Emerg. Dis. 2018;65:1775–1785. doi: 10.1111/tbed.12952. [DOI] [PubMed] [Google Scholar]
- 38.Karniychuk U.U., Geldhof M., Vanhee M., Van Doorsselaere J., Saveleva T.A., Nauwynck H.J. Pathogenesis and antigenic characterization of a new East European subtype 3 porcine reproductive and respiratory syndrome virus isolate. BMC Vet. Res. 2010;6:30. doi: 10.1186/1746-6148-6-30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Chen N., Li S., Tian Y., Li X., Li S., Li J., Qiu M., Sun Z., Xiao Y., Yan X., et al. Chimeric HP-PRRSV2 containing an ORF2-6 consensus sequence induces antibodies with broadly neutralizing activity and confers cross protection against virulent NADC30-like isolate. Vet. Res. 2021;52:74. doi: 10.1186/s13567-021-00944-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Xu Y., Ye M., Zhang Y., Sun S., Luo J., Jiang S., Zhang J., Liu X., Shao Q., Cao Q., et al. Screening of Porcine Innate Immune Adaptor Signaling Revealed Several Anti-PRRSV Signaling Pathways. Vaccines. 2021;9:1176. doi: 10.3390/vaccines9101176. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Chen N., Liu Q., Qiao M., Deng X., Chen X., Sun M. Whole genome characterization of a novel porcine reproductive and respiratory syndrome virus 1 isolate: Genetic evidence for recombination between Amervac vaccine and circulating strains in mainland China. Infect. Genet. Evol. 2017;54:308–313. doi: 10.1016/j.meegid.2017.07.024. [DOI] [PubMed] [Google Scholar]
- 42.Dortmans J.C.F.M., Buter G.J., Dijkman R., Houben M., Duinhof T.F. Molecular characterization of type 1 porcine reproductive and respiratory syndrome viruses (PRRSV) isolated in the Netherlands from 2014 to 2016. PLoS ONE. 2019;14:e0218481. doi: 10.1371/journal.pone.0218481. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Yim-Im W., Huang H.Y., Park J., Wang C., Calzada G., Gauger P., Harmon K., Main R., Zhang J.Q. Comparison of ZMAC and MARC-145 Cell Lines for Improving Porcine Reproductive and Respiratory Syndrome Virus Isolation from Clinical Samples. J. Clin. Microbiol. 2021;59:e01757-20. doi: 10.1128/JCM.01757-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Qiu M., Li S., Ye M., Li J., Sun Z., Li X., Xu Y., Xiao Y., Li C., Feng B., et al. Systemic Homologous Neutralizing Antibodies Are Inadequate for the Evaluation of Vaccine Protective Efficacy against Coinfection by High Virulent PEDV and PRRSV. Microbiol. Spectr. 2022;10:e0257421. doi: 10.1128/spectrum.02574-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Chen N., Ye M., Xiao Y., Li S., Huang Y., Li X., Tian K., Zhu J. Development of universal and quadruplex real-time RT-PCR assays for simultaneous detection and differentiation of porcine reproductive and respiratory syndrome viruses. Transbound. Emerg. Dis. 2019;66:2271–2278. doi: 10.1111/tbed.13276. [DOI] [PubMed] [Google Scholar]
- 46.Fang Y., Treffers E.E., Li Y., Tas A., Sun Z., van der Meer Y., de Ru A.H., van Veelen P.A., Atkins J.F., Snijder E.J., et al. Efficient -2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein. Proc. Natl. Acad. Sci. USA. 2012;109:E2920–E2928. doi: 10.1073/pnas.1211145109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Fang Y., Snijder E.J. The PRRSV replicase: Exploring the multifunctionality of an intriguing set of nonstructural proteins. Virus Res. 2010;154:61–76. doi: 10.1016/j.virusres.2010.07.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Lin W.H., Kaewprom K., Wang S.Y., Lin C.F., Yang C.Y., Chiou M.T., Lin C.N. Outbreak of Porcine Reproductive and Respiratory Syndrome Virus 1 in Taiwan. Viruses. 2020;12:316. doi: 10.3390/v12030316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Zhang Q., Song Z., Yu Y., Huang J., Jiang P., Shan H. Genetic analysis of a porcine reproductive and respiratory syndrome virus 1 strain in China with new patterns of amino acid deletions in nsp2, GP3 and GP4. Microb. Pathog. 2020;149:104531. doi: 10.1016/j.micpath.2020.104531. [DOI] [PubMed] [Google Scholar]
- 50.Yu F., Liu L., Tian X., Chen L., Huang X., Sun Y., Yan Y., Tian Z., Cai X., Liu D., et al. Genomic Analysis of Porcine Reproductive and Respiratory Syndrome Virus 1 Revealed Extensive Recombination and Potential Introduction Events in China. Vet. Sci. 2022;9:450. doi: 10.3390/vetsci9090450. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Li S., Qiu M., Li S., Li C., Lin H., Qiu Y., Qi W., Feng B., Cui M., Yang S., et al. A chimeric porcine reproductive and respiratory syndrome virus 1 strain containing synthetic ORF2-6 genes can trigger T follicular helper cell and heterologous neutralizing antibody responses and confer enhanced cross-protection. Vet. Res. 2024;55:28. doi: 10.1186/s13567-024-01280-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Xie J.X., Trus I., Oh D., Kvisgaard L.K., Rappe J.C.F., Ruggli N., Vanderheijden N., Larsen L.E., Lefèvre F., Nauwynck H.J. A Triple Amino Acid Substitution at Position 88/94/95 in Glycoprotein GP2a of Type 1 Porcine Reproductive and Respiratory Syndrome Virus (PRRSV1) Is Responsible for Adaptation to MARC-145 Cells. Viruses. 2019;11:36. doi: 10.3390/v11010036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Liu J.K., Wei C.H., Dai A.L., Fan K.W., Yang B.H., Huang C.F., Li X.H., Yang X.Y., Luo M.L. Complete genomic characterization of two European-genotype porcine reproductive and respiratory syndrome virus isolates in Fujian province of China. Arch. Virol. 2017;162:823–833. doi: 10.1007/s00705-016-3136-9. [DOI] [PubMed] [Google Scholar]
- 54.Chen N.H., Xiao Y.Z., Ye M.X., Li X.S., Li S.B., Xie N.J., Wei Y., Wang J.L., Zhu J.Z. High genetic diversity of Chinese porcine reproductive and respiratory syndrome viruses from 2016 to 2019. Res. Vet. Sci. 2020;131:38–42. doi: 10.1016/j.rvsc.2020.04.004. [DOI] [PubMed] [Google Scholar]
- 55.Zhao J., Xu Z.W., Xu T., Zhou Y.C., Li J.L., Deng H.D., Li F.Q., Xu L., Sun X.A., Zhu L. Molecular Characterization of the Nsp2 and ORF5s of PRRSV Strains in Sichuan China during 2012-2020. Animals. 2022;12:3309. doi: 10.3390/ani12233309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Li C., Xu H., Zhao J., Gong B.J., Sun Q., Xiang L.R., Li W.S., Guo Z.Y., Li J.H., Tang Y.D., et al. Epidemiological investigation and genetic evolutionary analysis of PRRSV-1 on a pig farm in China. Front. Microbiol. 2022;13:1067173. doi: 10.3389/fmicb.2022.1067173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Zhai S.L., Lin T., Zhou X., Pei Z.F., Wei Z.Z., Zhang H., Wen X.H., Chen Q.L., Lv D.H., Wei W.K. Phylogeographic analysis of porcine reproductive and respiratory syndrome virus 1 in Guangdong province, Southern China. Arch. Virol. 2018;163:2443–2449. doi: 10.1007/s00705-018-3873-z. [DOI] [PubMed] [Google Scholar]
- 58.Oleksiewicz M.B., Botner A., Toft P., Normann P., Storgaard T. Epitope mapping porcine reproductive and respiratory syndrome virus by phage display: The nsp2 fragment of the replicase polyprotein contains a cluster of B-cell epitopes. J. Virol. 2001;75:3277–3290. doi: 10.1128/JVI.75.7.3277-3290.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Oleksiewicz M.B., Botner A., Toft P., Grubbe T., Nielsen J., Kamstrup S., Storgaard T. Emergence of porcine reproductive and respiratory syndrome virus deletion mutants: Correlation with the porcine antibody response to a hypervariable site in the ORF 3 structural glycoprotein. Virology. 2000;267:135–140. doi: 10.1006/viro.1999.0103. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The genome sequence of the PRRSV-1 AHEU2024-2671 isolate has been deposited into the GenBank database with the accession number PQ640355.





