Carboxyl Terminal Modulator Protein Induces Cell Senescence and Is Upregulated With Aging by Zic2 in Rats

ABSTRACT

Carboxyl terminal modulator protein (CTMP) may be involved in various physiological and pathological processes, such as inflammation, tumor growth, and cardiac hypertrophy. Our recent study has shown that CTMP is increased with aging and plays a role in determining brain ischemic tolerance. However, it is not known how CTMP expression with aging is regulated and whether the changed CTMP expression has an effect on cell senescence. Here, cells that stably overexpressed CTMP were generated and cell senescence biomarkers were determined. The brains of Fischer 344 male rats were harvested for Western blot analysis and immunostaining to detect CTMP and the Zinc finger protein Zic2. The regulations of CTMP expression by Zic2 were examined by promoter activity assays. Increasing CTMP enhanced cells expressing senescence‐associated β‐galactosidase staining but without expression of Ki67, decreased cell proliferation and colony formation, and increased cells with condensed DNA of more than one pair of homologous chromosomes caused by senescence. Zic2 was decreased with aging in rats. Zic2 and CTMP were mainly expressed in the neurons in rats. Similarly, CTMP protein was expressed in the neurons of human brain. An anti‐Zic2 antibody immunoprecipitated DNA fragments of ctmp gene. Zic2 inhibited the activity of presumptive ctmp promoter. Overexpressing Zic2 decreased CTMP in cells. These results suggest that CTMP induces cell senescence and that Zic2 is a suppressor of CTMP expression. The decrease of Zic2 contributes to CTMP increase with aging.

Abbreviations

BSA

bovine serum albumin

ChIP

chromatin immunoprecipitation

CTMP

carboxyl terminal modulator protein

DAPI

4’6‐diamidino‐2‐phenylindole

Iba‐1

ionized calcium binding adaptor molecule 1

MAP2

microtubule‐associated protein 2

NeuN

neuronal nuclear protein

TBS

tris‐buffered saline

1. Introduction

Carboxyl terminal modulator protein (CTMP) is an endogenous inhibitor of Akt (Maira et al. 2001), an important signaling molecule that is involved in various functions, such as cell survival, tumor cell growth, and inflammation (Manning and Toker 2017). Consistent with this pattern of molecular interaction, CTMP has been found to increase inflammation and reduce cell survival after detrimental stimuli including ischemia (Li, Shan, and Zuo 2018; Miyawaki et al. 2009; Wang et al. 2014; Yu, Deng, and Zuo 2014) and to decrease pressure‐induced cardiac hypertrophy (Liu et al. 2018). CTMP may inhibit cancer cell growth (Knobbe et al. 2004), although the opposite finding has been reported (Liu et al. 2013). Our recent study has shown that CTMP is increased with aging in the brain and that this increase may contribute to the decreased brain ischemic tolerance in old rats (Li, Shan, and Zuo 2018). These findings suggest that CTMP may be involved in cell senescence because cell senescence is a presentation with aging and is involved in various diseases, especially aging‐related diseases (Kudlova, De Sanctis, and Hajduch 2022). To examine the role of CTMP in cell senescence, CTMP was overexpressed in rat fibroblasts to determine the senescence of these cells.

Although CTMP has been identified for more than 20 years (Maira et al. 2001), very little is known about how the expression of CTMP is regulated. We examined the sequence of 2000 bp upstream of the initial code of rat ctmp gene and found Zic2 binding sites in the sequence. Zic2 is a member of the zinc finger protein that regulates expression of various genes. One possible mechanism for this regulation is that Zic2 inhibits the transcriptional activity of β‐catenin/transcription factor 4 complex (Pourebrahim et al. 2011).

Based on the information, we hypothesize that Zic2 regulates CTMP expression and that this regulation contributes to the increase of CTMP with aging. To test these hypotheses, we examined the expression of Zic2 with aging in the brain and performed biochemical analyses to determine the effects of Zic2 on CTMP expression.

2. Methods and Materials

The animal protocol was approved by the Institutional Animal Care and Use Committee of the University of Virginia (Charlottesville, VA, USA; protocol number 3114). Fischer 344 male rats from the National Institutes of Health, USA, at the ages of 2 or 18 months were used to harvest brain tissues. These animals were maintained in standard living conditions and did not have a survival surgery or any treatments.

2.1. Western Blot Analysis

The cerebral cortices of male Fischer 344 rats or cell cultures were harvested and lysed with RIPA buffer (Thermo Fisher Scientific, Waltham, MA, USA). Twenty microgram protein was separated on 12% SDS‐PAGE gel and then transferred to polyvinylidine difluoride membranes. Primary antibodies were anti‐Zic2 antibody (1:1000 dilution, Abcam, Cambridge, UK), anti‐CTMP antibody (1:1000 dilution, Cell signaling Technology, Danvers, MA, USA), and anti‐β‐actin antibody (1:1000 dilution, Cell Signaling Technology). The secondary antibody was a mouse anti‐rabbit antibody conjugated with horseradish peroxidase (1:5000 dilution, Santa Cruz Biotechnology, Dallas, TX, USA). The results of bands corresponding to Zic2 and CTMP proteins were normalized to the values of corresponding internal control proteins (Li, Shan, and Zuo 2018). At least seven animals or samples of cell cultures in each group were analyzed.

2.2. Generation of Rat Fibroblasts With Stable Overexpression of CTMP

To determine the role of CTMP in cell senescence, cells stably over‐expressing CTMP were needed for the studies. It was decided to use rat primary fibroblasts because fibroblasts but not major brain cells, such as neurons, astrocytes or microglia, could be used to generate a cell line to stably over‐express a target protein. Rat primary fibroblasts were isolated from 8‐week‐old Fischer 344 rat lungs and cultured in Eagle's minimum essential medium with 15% FBS, 1x penicillin/streptomycin, non‐essential amino acids and sodium pyruvate. Primary rat fibroblasts were seeded on 6‐well plate and transfected at 80% confluence with a plasmid containing CTMP open reading frame and mCherry code (CTMP‐ORF, NM001025017.1, Genecopoeia) or M56‐Vector control (M56‐Vector, Genecopoeia) by using EndoFectin Max transfection reagent (Genecopoeia). Seventy‐2 h later, 200 µg/mL geneticin (ThermoFisher) was added for 2 weeks for stable transfection selection. The overexpression of CTMP in these fibroblasts was confirmed by immunostaining and Western blot analysis. The percentage of the number of cells expressing transfected proteins in the total number of cells was quantified in the images taken by Leica Thunder TIRF.

The cells transfected with CTMP‐ORF or M56‐Vector were expanded and kept in Eagle's minimum essential medium with 200 µg/mL geneticin for the following studies.

2.2.1. Senescence‐Associated Beta‐Galactosidase (SA‐β‐Gal) and Antigen Kiel 67 (Ki67) Staining

Primary rat fibroblasts transfected with or without CTMP‐ORF or M56‐Vector were seeded on 8‐well chamber slide (5000 cells/well). SA‐β‐Gal staining was performed when cells grew to ~50% confluence by using a beta‐gal staining kit (Abcam) to avoid confluence‐induced SA‐β‐Gal activity increase (Yang and Hu 2005). Then, slides were stained with an anti‐Ki67 antibody (1:200, Abcam) overnight and counterstained with Hoechst33342 (1:1000, ThermoFisher Scientific). The secondary antibody used was Alexa Fluor 647 donkey anti‐rabbit IgG (H + L) antibody (1:200, Invitrogen). Images were taken by a Leica Thunder TIRF. Experiments were conducted three times independently with two slides for each experimental condition. Six images were taken from each slide at a 20x objective lens. The percentage of the number of cells that were positive for beta‐galactosidase staining and negative for Ki67 in the number of cells positive for beta‐galactosidase staining in each slide was quantified (the average of the 6 images of the slide).

2.2.2. Cell Proliferation and Viability Tests

As we described before (Lai et al. 2019), colony‐forming ability was assessed by plating 50 cells/well on a 12‐well plate for 2 weeks. Cells were fixed and stained with 1% crystal violet for 30 min. Colonies with more than 50 cells were counted. The percentage of the number of colonies in the total number of cells seeded was calculated to reflect the colony‐formation efficiency.

A cell counting kit (Abcam) was used to determine the proliferation of cells. Briefly, 5000 cells/well were plated on a 96‐well plate for 48 h and then incubated with 10 μL/well of WST‐8 solution at 37°C for 3 h before measuring the absorbance at 460 nm.

2.2.3. Flow Cytometry

As we described previously (Xu, Feng, and Zuo 2008), cells were harvested and washed two times in PBS. Cells were re‐suspended in 1.2 mL PBS (Ca²⁺ and Mg²⁺ free) and mixed with 3 mL ice‐cold 95% ethanol dropwise while being vortexed. Cells were fixed in the final 70% ethanol for at least 30 min. Cells were then washed twice with 12 mL PBS (centrifuged at 2000 rpm for 10 min) and then re‐suspended in cell staining buffer (Biolegend, San Diego, CA, USA) containing 0.1 µg/mL 4'6‐diamidino‐2‐phenylindole (DAPI) (Biolegend) to stain 1 × 10⁶ cells on ice for 30 min. Cells were analyzed by a flow cytometer Attune NxT. The percentage of cells with polyploid DNA was measured.

2.3. Immunofluorescence Staining

Immunofluorescence staining was performed as we described before (Shan et al. 2019; Zeng et al. 2021). Briefly, rats were perfused with normal saline under deep anesthesia. Brain slices from Bregma −2 to −5 mm were fixed in 4% paraformaldehyde for 48 h at 4°C and then embedded in paraffin. Five‐micrometer thick coronal sections were mounted on slides. After antigen retrieval in sodium citrate buffer (10 mM sodium citrate, 0.1% tween 20, pH 6.0) for 20 min, sections were blocked in 10% donkey serum plus 1% bovine serum albumin (BSA) in tris‐buffered saline (TBS) containing 0.1% triton‐X 100 for 2 h at room temperature and then incubated with the corresponding primary antibodies at 4°C overnight. Primary antibodies were rabbit polyclonal anti‐CTMP antibody (1:50 dilution, Abcam, Waltham, MA, USA), mouse monoclonal anti‐neuronal nuclear protein (NeuN) (1:200 dilution, Millipore Sigma, Burlington, MA, USA), rabbit polyclonal anti‐Zic2 antibody (1:100 dilution, Abcam), mouse monoclonal anti‐S100β (1:100 dilution, Santa Cruz Biotechnology) or goat polyclonal anti‐ionized calcium binding adaptor molecule 1 (Iba1) (1:200 dilution, Abcam). On Day 2, sections were rinsed with TBS containing 0.1% triton‐X 100 and then incubated with donkey anti‐mouse/goat/rabbit IgG antibody conjugated with Alexa Fluor 488 or Alexa Fluor 594 (1:200 dilution, Thermo Fisher Scientific) for 1 h at room temperature. Slides were mounted for microscopic observation.

In another study to determine the human relevance of the findings from rats, human cerebral cortex sections were provided by the University of Virginia Biorepository and Tissue Research Facility, Charlottesville, VA. They were incubated with mouse monoclonal anti‐MAP2 antibody (1:500 dilution, Invitrogen) or rabbit polyclonal anti‐CTMP antibody (1:500 dilution, Abcam) and then with secondary antibody as described above for rat brain sections.

2.4. Chromatin Immunoprecipitation Assay

The chromatin immunoprecipitation (ChIP) assay was conducted as we described before with some modifications (Feng et al. 2014). Briefly, cerebral cortex of 2‐month‐old Fischer 344 male rats was cross‐linked by 1.5% formaldehyde for 15 min at room temperature. The cross‐linked tissue was then grinded and passed through a 28‐gauge needle to prepare a single‐cell suspension. Sonication was applied to fragment the DNA into 500–1000 base pairs in lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris‐HCl, pH 8.1) containing protease inhibitors. The resulting DNA fragments were incubated with an anti‐Zic2 antibody (2 µg/mL, Abcam) in ChIP dilution buffer overnight (0.01% SDS, 1.1% Triton X‐100, 1.2 mM EDTA, 16.7 mM Tris‐HCl, pH 8.1, 167 mM NaCl). Normal rabbit IgG (Millipore Sigma) and an anti‐RNA polymerase II antibody (2 ug/mL, Millipore Sigma) were used as a negative and positive control, respectively. On Day 2, 20 µL Dynabead slurry (Thermo Fisher Scientific) per 1 mL sample was added and incubated at 4°C for 2 h on a rotator. After incubation, beads were pelleted with magnet and washed twice with following buffers, low salt immune complex wash buffer (0.1% SDS, 1% Triton X‐100, 2 mM EDTA, 20 mM Tris‐HCl, pH 8.1, 150 mM NaCl), LiCl immune complex wash buffer (0.25 M LiCl, 1% NP40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris‐HCl, pH 8.1) and 1X Tris‐EDTA (TE) buffer (10 mM Tris‐HCl, 1 mM EDTA, pH 8.0). After the last wash, beads were re‐suspended in elution buffer (1X TE, pH 8.0, 1% SDS, 150 mM NaCl, 5 mM DTT). Reverse cross‐links were performed by incubating samples at 65°C for 5 h. After proteinase K treatment, phenol/chloroform extraction was performed to precipitate DNA. The final DNA sample was dissolved in 10 mM Tris‐HCl, pH 8.1, for further use.

Primers used to amplify the ctmp fragment were as follows:

F: 5'‐GGCTAACTCTATCCAATCCA‐3',

R: 5'‐GTAGGTCACTCGCACATT‐3', PCR product size would be 201 bp.

Primers for the positive control glyceraldehyde‐3‐phosphate dehydrogenase (gapdh) were:

F: 5'‐TCACTACCGAAGAACAACGA‐3',

R: 5'‐GGATAGGACTCAGGGAATACA‐3', PCR product size would be 248 bp.

2.5. Luciferase Assay

To determine the regulation of the transcription factor Zic2 on ctmp gene, plasmid containing Zic2 open reading frame cDNA (rat) was purchased from Genecopoeia (Rockville, Maryland, USA). A presumptive promoter sequence of the rat ctmp gene in chromosome 2 from −1176 bp to 174 bp was amplified and engineered into the pGL3‐enhancer vector (pGL3‐Ctmp‐Luc ⁺ ‐enhancer, Promega, Madison, WI, USA) (Feng et al. 2014). Constructed plasmid was sequenced to confirm the accuracy of DNA before use in the experiment. Primers used to amplify the sequence containing ctmp promoter region were ctmp‐F: 5'‐tccGGTACCATGTTCCAGATTAGCAACCT‐3' and ctmp‐R: 5'‐ggcAAGCTTCAATGTCCTCTCAACCAGAA‐3'. KpnI and HidIII enzymatic sites were labeled in bold.

293FT cells were cultured in 12‐well plates in Eagle's Minimum Essential Medium containing 10% fetal bovine serum. When cells grew to 50% confluence, Zic2‐ORF plasmid, pGL3‐ Ctmp‐Luc ⁺ ‐enhancer and pRL‐TK (Promega) were cotransfected into cells with Lipofectamine LTX (Thermo Fisher Scientific). For the control group, backbone of the plasmid for containing the Zic2 open reading frame, pReceiver‐M02 plasmid, was used for cotransfection together with pGL3‐Ctmp‐enhancer and pRL‐TK. The Renilla luciferase vector pRL‐TK was cotransfected as an internal control. Cells were lysed for luciferase activity test 48 h after transfection. Luciferase activity was measured by a kit (Dual‐Luciferase Reporter Assay System, Promega). Three independent experiments with two to three sets of samples each time were conducted.

2.6. Overexpression of Zic2

To facilitate the transfection with plasmid and the expression of target proteins, 293FT cells were used in the overexpression experiments. They were transfected with a plasmid containing rat Zic2 open reading frame cDNA (Zic2‐ORF, NM_001108392, Genecopoeia, Rockville, MD, USA) or pReceiver‐M02 plasmid (vector control, Genecopoeia) for 48 h. Cells were lysed with RIPA buffer (ThermoFisher Scientific). Twenty microgram protein was separated on 10% SDS‐PAGE gel and then transferred to polyvinylidine difluoride membranes. Primary antibodies were anti‐Zic2 antibody (1:1000 dilution, Abcam), anti‐CTMP antibody (1:1000 dilution, Cell Signaling Technology), and anti‐β‐actin antibody (1:1000 dilution, Cell Signaling Technology). Secondary antibody was a goat anti‐rabbit antibody conjugated with horseradish peroxidase (1:5000 dilution, Santa Cruz Biotechnology). The results of bands corresponding to Zic2 and CTMP proteins were normalized to the values of β‐actin.

2.7. Statistical Analysis

Results are presented as mean ± SD (parametric data in normal distribution) or median with 95% CI (non‐parametric data or parametric data in non‐normal distribution). The data of individual animals or experiments are presented in the figures. The normality of the data was tested by the Shapiro–Wilk test. Data were tested by t‐test or one‐way analysis of variance followed by Tukey test as appropriate. Differences were considered significant at p < 0.05. All statistical analyses were performed with GraphPad Prism (GraphPad Software, Boston, MA).

Reagent & Antibody	Company	Catalog number
Rabbit polyclonal anti‐Zic2	Abcam	ab150404
Goat polyclonal anti‐Iba1	Abcam	ab5076
Rabbit polyclonal anti‐CTMP	Cell Signaling Technology	4612s
Mouse anti‐S100β (C‐3)	Santa Cruz Biotechnology	sc‐393919
Rabbit polyclonal anti‐β‐actin	Cell Signaling Technology	4967
Donkey anti‐goat IgG conjugated with Alexa Fluor 488	ThermoFisher Scientific	A11055
Goat anti‐rabbit IgG‐HRP	Santa Cruz Biotechnology	sc‐2357
Mouse monoclonal anti‐NeuN	Abcam	Ab104224
Mouse monoclonal anti‐MAP2	Invitrogen	13‐1500 (M13)
Rabbit polyclonal anti‐CTMP (IF)	Abcam	ab106435
Donkey anti‐rabbit IgG antibody conjugated with Alexa Fluor 594	ThermoFisher Scientific	A21207
Donkey anti‐mouse IgG antibody conjugated with Alexa Fluor 488	ThermoFisher Scientific	A21202
Hoechst 33342	ThermoFisher Scientific	62249
DAPI	Biolegend	422801
Zic2‐ORF cDNA (Rat) plasmid	Genecopoeia	EX‐Rn12827‐M02
pReceiver‐M02 plasmid	Genecopoeia	EX‐NEG‐M02
pGL3‐enhancer vector	Promega	E1771
Renilla luciferase vector pRL‐TK	Promega	E2241
Lipofectamine LTX	ThermoFisher Scientific	A12621
CTMP‐ORF	Genecopoeia	EX_Rn17554‐M56_GS
M56‐Vector	Genecopoeia	EX‐NEG‐M56
EndoFectin Max transfection reagent	Genecopoeia	EF013
Geneticin	ThermoFisher Scientific	11811023
Alexa Fluor 647 donkey anti‐rabbit IgG (H + L)	Invitrogen	A31573
Rabbit polyclonal anti‐Ki67	Abcam	Ab15580
Cell staining buffer	Biolegend	420201
10× RIPA buffer	ThermoFisher Scientific	89901
Protease inhibitor cocktail	Sigma‐Aldrich	P2714

3. Results

3.1. CTMP Induced Cell Senescence

Our previous study has shown that CTMP in the brain is increased with aging (Li, Shan, and Zuo 2018), suggesting a role of CTMP in cell senescence. To examine this possibility, rat primary fibroblasts were transfected with a plasmid containing rat CTMP cDNA and mCherry code. The majority of cells were transfected by the plasmid as shown by the expression of mCherry (Figure 1A,B). These cells expressed more CTMP than control cells or cells transfected with empty plasmid (Figure 1C,D). This CTMP overexpression increased the number of cells expressing SA‐β‐Gal and the number of cells expressing SA‐β‐Gal but without the expression of Ki67 [Ki67(−)SA‐β‐Gal(+) cells] (Figure 2). Ki67 is a marker for cycling cells (Scholzen and Gerdes 2000). SA‐β‐Gal is a commonly used marker for cell senescence but can be increased by various factors including confluence stress and oxidative stress (Yang and Hu 2005). These factors often increase Ki67. Thus, positive staining for SA‐β‐Gal but negative staining for Ki67 is considered a good indicator for cell senescence (Alessio et al. 2021). Our results suggest an increase of senescent cells in cells expressing a high level of CTMP. CTMP overexpression decreased colony formation and cell proliferation, and increased the percentage of cells with polypoid DNA (Figures 3 and 4), indicators of senescence (Kudlova, De Sanctis, and Hajduch 2022). These results suggest that CTMP increase induces cell senescence.

Figure 1.

Increase of CTMP expression in rat fibroblast cultures stably transfected with ctmp cDNA. Rat fibroblast cells were transfected with M56‐Vector or CTMP‐ORF containing CTMP and mCherry expression codes. (A) mCherry expression in transfected cells. Scale bar: 50 µm. (B) percentage of the number of mCherry positive cells in the total number of cells. Results are median with 95% CI (n = 6) with the presence of values of individual samples. (C) representative images of Western blot analysis. (D) quantitative data of CTMP abundance. Results are median with 95% CI (n = 10–19) with the presence of values of individual samples. Experiments were conducted at least three times independently with 2 to 3 sets of samples each time. Normality was tested by the Shapiro–Wilk test. Statistical analysis was done by one‐way ANOVA.

Figure 2.

Increase in SA‐β‐Gal positive and Ki67 negative cells with CTMP overexpression. (A) representative images of Ki67 and SA‐β‐Gal staining of various groups. Scale bar: 25 µm. (B) quantitative data of SA‐β‐Gal positive cells [SA‐β‐Gal(+) cells]. Results are median with 95% CI (n = 6) with individual sample values. (C) percentage of the number of cells positive for SA‐β‐Gal and negative for Ki67 [Ki67(‐)SA‐β‐Gal(+) cells] in the total number of SA‐β‐Gal(+) cells. Results are median with 95% CI (n = 6) with individual sample values. Experiments were conducted three times independently with two sets of samples each time. Normality was tested by the Shapiro–Wilk test. Statistical analysis was done by one‐way ANOVA.

Figure 3.

Decrease in colony formation and proliferation in rat fibroblast cells with CTMP overexpression. (A) representative images of cell colonies stained with 1% crystal violet. (B) quantitative data of cell colonies of various groups. (C) quantitative data of cell counting kit‐8 (CCK8) tests of various groups. Results are mean ± SD (n = 20) with the presence of values of individual samples. Experiments were conducted four times independently with 4–6 sets of samples each time. Normality was tested by the Shapiro–Wilk test. Statistical analysis was done by one‐way ANOVA.

Figure 4.

Increase in the number of cells with polyploid DNA in cells with CTMP overexpression. (A–C) representative images of flow cytometry analysis of various groups. (D) percentage of the number of cells with polyploid DNA in the total number of cells analyzed. Results are median with 95% CI (n = 3) with the presence of values of individual samples. Experiments were conducted three times independently. 25,000 live events were collected for analysis each time. Normality was tested by the Shapiro–Wilk test. Statistical analysis was done by one‐way ANOVA.

3.2. CTMP Expression Was Increased and Zic2 Was Decreased With Aging

As we have shown before (Li, Shan, and Zuo 2018), Western blot analysis analyses showed that CTMP was increased with aging in the cerebral cortex. Interestingly, Zic2 was decreased with aging in this brain region (Figure 5). These results suggest a reciporcal expression pattern of CTMP and Zic2 in rat brain. CTMP and Zic2 were mostly expressed in the neurons but were observed in the astrocytes and microglia of the brain of Fischer 344 rats because CTMP and Zic were expressed in cells expressing neuronal nuclei (NeuN), S100β and ionized calcium binding adaptor molecule 1 (Iba‐1) (Figure 6), biomarkers of neurons, astrocytes and microglia, respectively (Zhang et al. 2014). Similarly, CTMP staining was colocalized with the staining of microtubule‐associated proein 2 (MAP2), a biomarker of neurons (Cassimeris and Spittle 2001), in human cerebral cortex (Figure 7), suggesting that CTMP is expressed in the neurons of human brain.

Figure 5.

Expression of CTMP and Zic2 changes with aging in the cerebral cortex. (A,B) representative images of Western blot analysis to analyze the expression of CTMP and Zic2 in the prefrontal cortex of 2‐ and 18‐month‐old rats. (C) quantitative data of CTMP abundance. (D) quantitative data of Zic2. Results are mean ± SD (n = 8–10 rats per group) with the presence of values of individual animal. Statistical analysis was done by t‐test. Data passed Shapiro–Wilk normality test. 2 M: 2‐month old, 18 M: 18‐month old.

Figure 6.

Immunofluorescence staining of CTMP in the cerebral cortex of 18‐month‐old rats and Zic2 in the cerebral cortex of 2‐month‐old rats. (A) co‐staining of Zic2 or CTMP with NeuN. (B) co‐staining of Zic2 or CTMP with Iba1. (C) co‐staining of Zic2 or CTMP with s100β. Scale bar = 50 µm.

Figure 7.

Co‐staining of CTMP with MAP2 in human cerebral cortex. Scale bar = 200 µm.

3.3. Zic2 Directly Inhibited CTMP Expression

To determine whether Zic2 was involved in the regulation of CTMP expression, DNA samples prepared from 2‐month‐old Fischer 344 rats were immunoprecipitated by an anti‐Zic2 antibody. The immunoprecipates contained DNA fragments whose sequences were consistent with those of presumptive promoter regions of ctmp gene. As a negative control, nonspecific IgG did not precipitate such DNA fragments. As a positive control, an anti‐RNA polymerase II antibody precipitated DNA fragments of gapdh gene (Figure 8A). These results suggest that Zic2 proteins bind the presumptive promoter regions of ctmp gene.

Figure 8.

Direct regulation of CTMP expression by Zic2. (A) chromatin immunoprecipitation results prepared using a rabbit anti‐Zic2 antibody to precipitate the DNA samples of the cerebral cortex. The precipitants were amplified by PCR with a pair of primers. Normal rabbit IgG and an anti‐RNA polymerase II were used as negative and positive controls, respectively. (B) diagram of the constructs of the plasmid containing the presumptive CTMP promoter regions and coding sequence for luciferase. (C) diagram of CTMP promoter activity assays. (D) quantitative results of CTMP promoter activity. The luciferase (Luc) results were normalized by the corresponding Renilla luciferase (RL) data. Results are mean ± SD (n = 7–8) with the presence of values of individual sample. Experiments were conducted three times independently with two to three sets of samples each time. Data passed the Shapiro–Wilk normality test. Statistical analysis was done by one‐way ANOVA.

To determine whether the binding of Zic2 to ctmp gene affected the promoter activity, a plasmid that carried code for luciferase was constructed. The expression of luciferase was under the control of the preumptive promoter of the rat ctmp gene (Figure 8B). The 293FT cells transfected with this plasmid had incerased luciferase activity. This activity was decreased by co‐transfecting the cells with a M02 plasmid carrying code for Zic2. However, the plasmid that carried the backbone of the M02 plasmid but without the code for Zic2 did not affect the luciferase activity of cells transfected with the plasmid carrying code for luciderase whose expression was under the control of ctmp promoter (Figure 8C,D). These results suggest that Zic2 inhibits the activity of ctmp promoter.

To determine whether Zic2 regulated CTMP expression in cells, 293FT cells were transfected with a plasmid containing rat Zic2 cDNA. These cells had a very high level of Zic2 protein but a decrease in CTMP protein compared with control cells or cells that were transfected with empty plasmid (Figure 9). These results, along with the results of Zic2 binding to the ctmp gene and the inhibition of Zic2 on the ctmp promoter activity, suggest that Zic2 can directly inhibit the expression of CTMP.

Figure 9.

Reduction of CTMP expression in cells with overexpression of Zic2. (A) representative images of Western blot analysis of various groups. B: quantitative data of Zic2 abundance. Results are median with 95% CI with the presence of values of individual sample (n = 9–10). (C) quantitative data of CTMP abundance. Results are mean ± SD (n = 7–9) with the presence of values of individual samples. Experiments were conducted three times independently with two to three sets of samples each time. Normality was tested by the Shapiro–Wilk test. Statistical analysis was done by one‐way ANOVA.

4. Discussion

Various biological functions of CTMP have been revealed since it was discovered in 2001 (Li, Shan, and Zuo 2018; Maira et al. 2001; Miyawaki et al. 2009; Wang et al. 2014; Yu, Deng, and Zuo 2014). One important finding in this study is that CTMP may induce cell senescence. Cells expressing a high level of CTMP present multiple senescence biomarkers including SA‐β‐Gal expression but without the expression of Ki67, containing polypoid DNA, and a decrease in proliferation and colony formation. Cell senescence is a status of irreversible growth arrest of cells and is closely connected with aging (Kudlova, De Sanctis, and Hajduch 2022). Cell growth and proliferation are important in tissue repair and regeneration and in maintaining immunofunction. Thus, cell senescence will impair these functions. Various senolytic interventions have been proposed (Lucas, Cavadas, and Aveleira 2023). Our study has identified a novel molecular target, CTMP, to regulate cell senescence and reducing CTMP expression may be senolytic to improve tissue repair and regeneration. On the other hand, cell senescence is beneficial in preventing cancer transformation (Huang et al. 2022). Thus, increasing CTMP may be a method to reduce cancer transformation of cells. Further studies are needed to test this possibility. Interestingly, CTMP is mainly expressed in the neurons in the brain of rats and humans. Mature neurons do not proliferate. The potential of CTMP in inducing cell senescence may contribute to the loss of proliferation ability in neurons.

Our previous study has shown a potential role of CTMP in the brain changes with aging (Li, Shan, and Zuo 2018). This current study has provided initial evidence that Zic2 expression is decreased in the brain with aging. More importantly, Zic2 is a direct suppressor for the expression of CTMP because Zic2 and CTMP had a reciprocal expression pattern in the brain with aging, Zic2 proteins bound the presumptive ctmp promoter region, Zic2 proteins inhibited ctmp promoter activity and overexpression of Zic2 decreased CTMP expression. These results suggest that the increase of CTMP in the brain with aging may be due to the decrease of Zic2. There was only one prior study that investigated the transcription regulation of CTMP expression. That study showed that the neuroprotective effects of activating transcription factor 3 may be related to its inhibition of CTMP expression under hypoxic conditions (Huang et al. 2015).

Zic2 plays an important role in the development of the central nervous system (Heeg‐Truesdell and LaBonne 2006). Mutations in the Zic2 gene are associated with holoprosencephaly in humans (Brown et al. 1998; Warr et al. 2008). Zic2 increases neural progenitors via inhibiting the canonical Wnt/β‐catenin signaling (Heeg‐Truesdell and LaBonne 2006; Pourebrahim et al. 2011). Our results showed that the expression of Zic2 was decreased in the brain with aging. Zic2 existed at a very low level in the brain of old rats. Considering the previous findings of Zic2 on neural progenitors, the decreased Zic2 with aging may be a molecular mechanism for brain aging including decreased brain cell genesis in the old brain.

Our study was focused on determining the role of Zic2 in regulating CTMP expression with the primary focus on the brain. This regulating role shall occur in other tissues such as cancer cells and myocardium where CTMP has been found to regulate the growth of these cells (Liu et al. 2018; Liu et al. 2013). Nevertheless, additional studies showing the reciprocal expression of CTMP and Zic2 as well as the binding of Zic2 to the ctmp gene in those cells and tissues may be needed to support the role of Zic2 in inhibiting the expression of CTMP in those cells. Also, the regulation of Zic2 on CTMP expression appears to be direct because Zic2 binds ctmp gene. However, indirect mechanisms such as via inhibiting the Wnt/β‐catenin signaling cannot be excluded.

5. Conclusions

Our study has shown that CTMP can induce cell senescence. Our study has also shown that Zic2 is a suppressor for the expression of CTMP. This suppression was decreased with aging in the brain. Thus, a decrease of Zic2 and an increase of CTMP with aging may be a molecular mechanism for brain aging. These findings help us understand the mechanisms of cell senescence and expand our knowledge of CTMP functions. If our findings are confirmed in humans, inhibition of CTMP expression or functions may be an effective approach to reduce cell senescence.

Author Contributions

ZZ conceived the concept of the project; WS, JL and ZZ designed the studies; WS, JL and ZP performed the experiments; WS analyzed the data and wrote the Methods section, ZZ wrote the paper.

Ethics Statement

Not a clinical study. Animal protocol was approved by the institutional Animal Care and Use Committee of the University of Virginia (Charlottesville, VA, USA).

Consent

All authors have approved the submission and publication of the findings. There is no need to get approval from funding agencies for publication. Four human cerebral cortical sections on slides were obtained from the University of Virginia Biorepository and Tissue Research Facility, Charlottesville, VA. There was no identifiable information associated with the sections except that the Facility confirmed that these sections were from normal controls assessed by pathologists. Thus, consent for publication of the immunostaining images of human sections is not needed. All other experimental data are from animals or cell cultures. Consent for publication is not needed for those data.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request. Data will be available upon reasonable request.