Application of genome tagging technology in elucidating the function of sperm-specific protein 411 (Ssp411)

Abstract

The genome tagging project (GTP) plays a pivotal role in addressing a critical gap in the understanding of protein functions. Within this framework, we successfully generated a human influenza hemagglutinin-tagged sperm-specific protein 411 (HA-tagged Ssp411) mouse model. This model is instrumental in probing the expression and function of Ssp411. Our research revealed that Ssp411 is expressed in the round spermatids, elongating spermatids, elongated spermatids, and epididymal spermatozoa. The comprehensive examination of the distribution of Ssp411 in these germ cells offers new perspectives on its involvement in spermiogenesis. Nevertheless, rigorous further inquiry is imperative to elucidate the precise mechanistic underpinnings of these functions. Ssp411 is not detectable in metaphase II (MII) oocytes, zygotes, or 2-cell stage embryos, highlighting its intricate role in early embryonic development. These findings not only advance our understanding of the role of Ssp411 in reproductive physiology but also significantly contribute to the overarching goals of the GTP, fostering groundbreaking advancements in the fields of spermiogenesis and reproductive biology.

INTRODUCTION

As key molecules performing a myriad of biological functions, proteins are of paramount importance in the life sciences. However, advancements in protein research have been hindered by a lack of investigative tools, leading to an in-depth study of nearly half of the proteins remaining elusive. This phenomenon primarily stems from the reliance on specific antibodies in protein research, along with the diverse requirements of different experimental methods such as western blotting, flow cytometry, immunohistochemistry, co-immunoprecipitation (co-IP), and chromatin immunoprecipitation. To address this challenge, Li and his colleagues proposed the genome tagging project (GTP) in mice.1,2 This project involves the precise insertion of DNA sequences encoding tag peptides into either the N-terminus or C-terminus of the target gene in mice, resulting in the formation of tagged fusion proteins. This strategy allows for in situ labeling of proteins.1,2 Such an approach enables researchers to specifically identify target proteins using tag antibodies, facilitating in vivo, real time, dynamic study of proteins. This not only deepens our understanding of life processes and disease mechanisms but also propels the standardization of protein research.1,2,3

Sperm-specific protein 411 (Ssp411), also known as Spata20, is a highly conserved protein that is specifically expressed in spermatids and was first named and reported by our team.4,5 A preliminary study has indicated that the absence of Ssp411 leads to male infertility without affecting female fertility.5 Additionally, we found that although intracytoplasmic sperm injection (ICSI)-assisted reproductive technology can help Ssp411 knockout male mice reproduce and generate offspring, the lack of Ssp411 results in the first cleavage delay during embryogenesis (unpublished data from Miao Liu’s doctoral thesis, Fudan University, Shanghai, China). However, due to the lack of highly sensitive antibodies, we were unable to effectively detect the expression of Ssp411 in spermatozoa isolated from the mouse epididymis or in the cells of the early stages of embryogenesis. This hindrance has impeded further investigation into the role and mechanism of Ssp411 during early embryogenesis in mice. To overcome this, we used the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing technique to construct an hemagglutinin (HA)-tagged Ssp411 mouse model.

Furthermore, within the framework of the GTP, the comprehensive identification of proteins, given their vast diversity and spatial-temporal expression differences across various tissues and developmental stages, poses a considerable challenge. In our study, we focused on HA-tagged Ssp411 mice and specifically investigated the expression of Ssp411 in the male testis and epididymis. Concurrently, we conducted in-depth analyses of Ssp411 across various spatial and temporal dimensions. This approach not only ensures that HA-tagged Ssp411 mice serve as a robust tool for studying the pathophysiological functions of Ssp411 but also provides valuable experimental data and insights for the GTP project. This contributes significantly to advancing systematic studies and understanding of numerous protein functions in the future.

MATERIALS AND METHODS

Generation of the HA-tagged Ssp411 mouse model

HA-tagged Ssp411 mice (Ssp411^N-HA/N-HA mice) were generated using CRISPR/Cas9 technology as described in a previous study.6 In brief, Cas9 mRNA and single guide RNA (sgRNA) were transcribed in vitro by utilizing T7 RNA polymerase from HiScribe T7 ARCA mRNA Kit (E2060S; New England Biolabs, Ipswich, MA, USA). Subsequently, Cas9 mRNA, sgRNA, and the HA tag containing DNA templates were microinjected into zygotes. The injected zygotes were then cultured in EmbryoMax KSOM Mouse Embryo Media (MR-106; Sigma-Aldrich, St. Louis, MO, USA) until they reached the 2-cell stage before being transplanted into the oviducts of pseudopregnant Institute of Cancer Research (ICR) mice. The genotypes of the founders were determined by performing polymerase chain reaction (PCR) analysis of genomic DNA extracted from mouse tails using a Mouse Direct PCR Kit (B40013; Bimake, Shanghai, China) and confirmed through Sanger sequencing. Heterozygous mice were obtained by mating the founders with C57BL/6 mice. Homozygous offspring were generated by breeding the heterozygous mice. HA tag containing DNA template, specific primers for sgRNA preparation, and primer sets for mouse genotyping are listed in Supplementary Table 1.

Supplementary Table 1.

Primers used in the study

Oligo	Sequence (5’–3’)
sgRNA	TGAGGAATGGTGGCTCATTG
HA template	CTACCGCCAGGTCCAAGAAGCTGGGGGAGACTAACCTGGCA GGGAGCCCCCAATGTACCCATACGATGTTCCAGATTACGCTG GCGGTGGCGGAAGTAGCCACCATTCCTCACCACCCCCAAAA CATAAGGGGGAGCACAAAGGCCACGG
Ssp411-HA-Fw	TGAATGCTAAGGATGCCTGC
Ssp411-HA-Rv	AGACCCCCACTCTTTGTCCA
Ssp411 F1	GCAGGGAGCCCCCAATG
Ssp411 F5	GGAGCCCCCAATGAGCC
Ssp411 R3	GAGCTGCCCCTTTCTGAAC
HA F4	GCGGTGGCGGAAGTAGC
β-actin F1	CACTGTCGAGTCGCGTCC
β-actin R1	CGCAGCGATATCGTCATCCA

Collection of testicular germ cells and epididymal spermatozoa

Testicular germ cells and epididymal spermatozoa were isolated from Ssp411^N-HA/N-HA mice as described in a previous study.7 The testicular tunica albuginea was removed and the tubules were transferred to 1.5 ml tubes containing phosphate-buffered saline (PBS). Subsequently, the tubes were settled in a metal bath at 37°C for 15 min and inverted every 5 min, after which the tissue fractions were removed using 40-μm filters. The supernatant was centrifuged (Centrifuge 5430R; Eppendorf AG, Hamburg, Germany) to harvest the testicular germ cells at 800g for 5 min, and the cell pellet was washed with cold PBS for three times. The epididymal spermatozoa were collected from the epididymis and placed in PBS. After being incubated at 37°C for 30 min, the supernatant was filtered through 40-μm filters. The spermatozoa were washed with PBS for three times.

Collection of MII oocytes and early embryos

For MII oocytes, 8-week-old wild-type (Ssp411^+/+) or Ssp411^N-HA/N-HA female mice were superovulated by intraperitoneal injection of 7.5 international units (IU) of pregnant mare serum gonadotropin (PMSG), followed by 7.5 IU of human chorionic gonadotropin (hCG) 48 h later. At 14 h post-hCG injection, oocyte-cumulus complexes (OCC) were obtained by dissecting the ampulla of the oviduct. For the early embryos, after the injection of hCG, the Ssp411^+/+ or Ssp411^N-HA/N-HA female mice were paired with the Ssp411^N-HA/N-HA or Ssp411^+/+ mice for mating. The following morning, the mice with vaginal plugs were euthanized, and the ampulla of the oviduct was placed in M2 medium (MR-015; Sigma-Aldrich). Subsequently, the oocytes were incubated in hyaluronidase solution to isolate OCC, and then, the oocytes were washed in M2 medium and cultured in K⁺ Simplex Optimised Medium (KSOM) medium for embryogenesis. Embryos were collected at various developmental stages, including zygotes, 2-cell embryos, 4- to 8-cell embryos, morulae, and blastocysts, and transferred to R1 Buffer from Single Cell RNA Purification Kit (JXCN-5001; Nanjing Your True-Life, Nanjing, China). The collected samples were promptly flash-frozen in liquid nitrogen and stored at −80°C for subsequent analysis.

Immunohistochemistry and immunofluorescence assays

Immunohistochemistry was performed as described previously.8 In brief, the slides were blocked in 10% bovine serum albumin (BSA; ST023-50g; Beyotime Biotech, Nantong, China) in PBS at 37°C. Subsequently, the blocked slides were incubated with HA-tag (C29F4) Rabbit mAb (#3742; Cell Signaling Technology, Danvers, MA, USA) at a 1:1000 dilution in PBS overnight at 4°C. After being incubated with a secondary antibody at room temperature, the 3,3’-diaminobenzidine (DAB) reaction was stopped using 0.1 mol l⁻¹ acetate buffer. Subsequently, the slides were stained with hematoxylin and differentiated with Acid Alcohol Fast Differentiation Solution (C0163M; Beyotime). Finally, the slides were dehydrated using ethanol, made transparent with xylene, and sealed using neutral gum.

Immunofluorescence for testes, spermatozoa, and testicular germ cells was carried out as described previously.5 The frozen sections were heated at 65°C for 5 min and rehydrated in PBS. The slides were incubated in retrieval buffer for antigen retrieval. For spermatozoa and testicular germ cells, the cells were fixed with 4% Tissue Fix Solution (T17024; Saint-Bio Biotech, Shanghai, China) at room temperature. Subsequently, the fixed cells were settled on coated slides, and permeabilized with 0.5% Triton X-100 in PBS. The tissue and cell samples were blocked with 5% BSA in PBST (PBS with 0.05% Tween-20), and then, the slides were incubated with HA-tag (C29F4) Rabbit mAb at a 1:300 dilution in PBS overnight at 4°C. After being washed with PBST, the slides were incubated with Rhodamine (tetramethylrhodamin isothiocyanate [TRITC])-conjugated AffiniPure goat anti-rabbit IgG (H+L) (111-025-003; Jackson ImmunoResearch, West Grove, PA, USA) at a 1:800 or anti-rabbit IgG-Atto 488 antibody produced in goat (18772; Sigma-Aldrich) at a 1:800 in PBS plus 1% BSA at room temperature. Peanut agglutinin (PNA; L32458; Thermo Fisher Scientific, Rockford, IL, USA) was used at a 1:50 dilution (20 μg ml⁻¹ in final) in PBS. The slides were then mounted with Antifade Mounting Medium with Hoechst 33342 (P0133; Beyotime Biotech) and imaged using inverted laser confocal microscopy (Ti-E+AIR+Storm; Nikon, Tokyo, Japan). Immunofluorescence for oocytes or embryos was carried out as described previously.9 The oocytes or embryos were fixed at room temperature with 4% paraformaldehyde (PFA) and then washed by transferring them through drops of Wash Buffer from Blastocyst Cell Staining and Counting Kit (JXCN-7010; Nanjing Your True-Life). After being permeabilized with 0.5% Triton X-100, the cells were blocked with 10% BSA, followed by incubation with primary antibodies at 4°C overnight. Subsequently, the cells were washed by transferring them through drops of Wash Buffer and then incubated with anti-rabbit IgG-Atto 488 antibody produced in goat at a 1:800 in PBS plus 1% BSA at room temperature. Finally, the cells were smeared on slides, mounted with antifade mounting medium with Hoechst 33342, sealed with nail polish, and imaged using inverted laser confocal microscopy. The detailed information about antibodies and reagents used for the immunohistochemistry and immunofluorescence assays are listed in Supplementary Table 2.

Supplementary Table 2.

The antibodies and reagents used in the study

Products	Cat number	Host	Source	Dilution
HA-tag Rabbit mAb	#C29F4	Rabbit	Cell Signaling	WB: 1:2500–1:5000 IF: 1:300
Anti β-tubulin	66240-1-Ig	Mouse	ProteinTech	WB: 1:5000
Anti α-tubulin	66031-1-Ig	Mouse	ProteinTech	WB: 1:5000
Anti Ssp411	F1-3	Mouse	Made by Our Lab	WB: 1:1000
TRITC-conjugated Anti-Rabbit IgG (H+L)	111-025-03	Goat	Jackson ImmunoResearch	IF: 1:800
Anti-Rabbit-IgG-Atto 488	18772	Goat	Sigma	IF: 1:800
Anti-rabbit IgG, HRP-linked Antibody	#7074	Goat	Cell Signaling	WB: 1:10000
Anti-mouse IgG, HRP-linked Antibody	#7076	Goat	Cell Signaling	WB: 1:10000
PNA	L32458		ThermoFisher Scientific	1:50
Antifade Mounting Medium with Hoechst 33342	#P0133		Beyotime Biotech
Acid Alcohol Fast Differentiation Solution	C0163M		Beyotime Biotech
Single Cell RNA Purification Kit	JXCN-5001		Nanjing Your True-Life
Blastocyst Cell Staining and Counting Kit	JXCN-7010		Nanjing Your True-Life
4% Tissue Fix Solution	T17024		Saint-Bio Biotech
2×FastStart Universal SYBR Green Master	4913850001		Roche
RIPA Lysis Buffer	P0013E		Beyotime Biotech
Pierce™ BCA Protein Assay Kit	#23225		ThermoFisher
Precast gel Hepes-Tris 10%	GSH2001		Shanghai WSHTIO
PVDF membrane	FFP77		Beyotime Biotech
cOmplet ULTRA Tablets, Mini, EASYpack	05892970001		Roche
BeyoECL Moon Kit	P0018FM		Beyotime Biotech
Nonfat Milk Powder	A600669-0250		Sangon Biotech	5%
BSA	ST023-50g		Beyotime Biotech	1%–5%
FBS	C0251		Beyotime Biotech	10%
Triple Color Prestained Protein Ladder	P6110		Suzhou UElandy
Mouse Direct PCR Kit	B40013		Bimake
HiScribe® T7 ARCA mRNA Kit (with tailing)	E2060S		New England Biolabs

PCR: polymerase chain reaction; BSA: bovine serum albumin; RIPA: radio immunoprecipitation assay; PNA: peanut agglutinin; TRITC: tetramethylrhodamin isothiocyanate; IF: immunofluorescence; WB: western blotting; HA-tag: hemagglutinin-tagged; FBS: fetal bovine serum; BCA: Bicinchoninic acid assay; PVDF: polyvinylidene fluoride

Flow-cytometric analyses

Single testicular germ cells were prepared as described in a previous study.10 The isolated single cells were fixed with 4% PFA at room temperature. Then, they were permeabilized with 0.5% Triton X-100. After centrifugation at 500g for 5 min (Centrifuge 5430R; Eppendorf AG) and washing, the permeabilized testicular germ cells were blocked with 10% FBS (C0251; Beyotime), followed by incubation with the HA-tag (C29F4) rabbit mAb at a 1:1000 dilution in PBS overnight at 4°C. After being washed with PBS, the samples were incubated with anti-rabbit IgG-Atto 488 antibody produced in goat at a 1:800 dilution at room temperature. Finally, the samples were resuspended in 1 ml PBS, filtered through a 40-μm filter, and transferred to a Falcon flow tube for FACS (BD LSRFortessa; BD Biosciences, Franklin Lakes, NJ, USA) detection. These data were analyzed by FlowJo software (version 10.8.1; BD Biosciences).

Single-cell quantitative real-time PCR (qRT-PCR) for oocytes and early stages of embryos

Total RNA from isolated individual oocytes and early-stage embryos was extracted, reverse transcribed to cDNA and preamplified using the Single Cell Sequence Specific Amplification Kit (P621-01; Vazyme Biotech, Nanjing, China) according to the manufacturer’s instructions. In brief, the reaction mixtures were prepared on ice and then amplified on a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA).

After amplification, the products were diluted by adding 45 µl of RNase-free water. Actin and Ssp411 mRNA were quantified using 2×FastStart Universal SYBR Green Master Mix (4913850001; Roche Diagnostics GmbH, Mannheim, Germany) on a quantitative PCR (qPCR) system (ABI 7900HT Fast; Thermo Fisher Scientific). The primers used for Actin and Ssp411 are listed in Supplementary Table 1, and the reagents used are listed in Supplementary Table 2.

Western blotting

Tissue samples from Ssp411^+/+ and Ssp411^N-HA/N-HA mice were homogenized with cold radioimmunoprecipitation assay (RIPA) Lysis Buffer (P0013E; Beyotime Biotech) containing the protease inhibitor cocktail complete ULTRA tablets, Mini, EASYpack (05892970001; Roche Diagnostics GmbH). The sample lysates were centrifuged at 12 000g, the pellets were discarded, and the protein concentration was determined using a Pierce BCA Protein Assay Kit (23225; Thermo Fisher Scientific). Subsequently, the supernatants were mixed with protein sample loading buffer for sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE; ES003; Shanghai WSHTIO, Shanghai, China) and then boiled at 95°C. For cauda epididymis spermatozoa samples, oocytes, and embryos, the cells were extracted with 1× SDS-PAGE Loading Buffer and then boiled at 95°C. For each sample, total proteins were loaded per well and separated in Precast gel Hepes-Tris 10% (GSH2001; Shanghai WSHTIO). The proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (FFP77; Beyotime Biotech) and then blocked with 5% dry nonfat milk solution in PBST (0.05% Tween 20) at room temperature. The membrane was incubated with primary antibodies in PBST overnight at 4°C, followed by incubation with secondary antibodies in PBST at room temperature. Subsequently, the proteins were visualized using a BeyoECL Moon Kit (P0018FM; Beyotime Biotech) and scanned using a Tanon 5200 (Tanon, Shanghai, China). The antibodies and reagents used for western blotting are listed in Supplementary Table 2.

Statistical analyses

GraphPad Prism 9 software (GraphPad Software, San Diego, CA, USA) was used for statistical analysis with a two-tailed Student’s t-test. The results are presented as the mean ± standard error of the mean (s.e.m.), and P < 0.05 was considered as statistical significance.

Ethics statement

Ethical Review (No.2020-13) was granted by the Animal Care Committee of the Shanghai Institute for Biomedical and Pharmaceutical Technologies, ensuring all protocols adhered to stringent ethical guidelines. Our commitment to animal welfare is reflected in the continuous monitoring and optimization of housing conditions, with the aim of minimizing distress and maximizing the well-being of the animals involved in our research.

RESULTS

Generation and identification of the Ssp411^N-HA/N-HA mouse model

In this study, we constructed an HA-tagged Ssp411 mouse model using CRISPR/Cas9 gene editing technology (Figure 1a and 1b). To confirm the successful generation of homozygous HA-tagged Ssp411 mice, we determined the genotypes of Ssp411^N-HA/N-HA mice through tail genomic PCR (Figure 1c) and genomic sequencing (Figure 1d). The genomic sequencing results revealed the precise insertion of the HA tag into the Ssp411 genome after the start codon ATG. Additionally, the genotype of the Ssp411^N-HA/N-HA mice was confirmed through western blotting with an anti-HA antibody and an Ssp411 antibody. As anticipated, western blotting (Figure 1e) revealed a specific band in the testes of both Ssp411^N-HA/N-HA mice and Ssp411^+/+ mice using the Ssp411 antibody. Furthermore, the presence of Ssp411 was exclusively observed in Ssp411^N-HA/N-HA mice when the anti-HA antibody was used.

Figure 1.

Generation and identification of the Ssp411^N-HA/N-HA mouse model. (a) Schematic diagram of the generation of the Ssp411^N-HA/N-HA mouse model. (b) Diagram of the sgRNA targeting site. (c) Agarose gel electrophoresis of the tail genome PCR results of Ssp411^N-HA/N-HA mice, Ssp411^+/HA mice, and Ssp411^+/+ mice. (d) Sequencing results for the Ssp411^N-HA/N-HA mouse. (e) Western blotting of testes from Ssp411^+/+ and Ssp411^N-HA/N-HA mice using an anti-HA antibody and an anti-Ssp411 antibody (F1-3); α-tubulin was used as the internal control. Ssp411: sperm-specific protein 411; sgRNA: single guide RNA; HA: hemagglutinin; PCR: polymerase chain reaction; HDR: homology directed repair; ARM: homology arm; Cas9: CRISPR associated protein 9.

Temporal expression of Ssp411 in testes and distribution of Ssp411 in seminiferous tubules in the Ssp411^N-HA/N-HA mouse model

To investigate the dynamic expression of Ssp411 in the testes during mouse development, we collected testicular tissues from Ssp411^N-HA/N-HA mice at multiple postnatal time points spanning from 7 days to 365 days and analyzed Ssp411 expression at both the mRNA and protein levels. The results of RT-PCR analysis showed that Ssp411 mRNA was first detected in the testes of mice at postnatal day 21, after which its expression persisted to postnatal day 365 (Figure 2a). However, western blotting revealed that Ssp411 was initially expressed in mouse testes at postnatal day 28 (Figure 2b).

Figure 2.

Expression of the HA-Ssp411 protein in the testes of Ssp411^N-HA/N-HA mice at different postnatal ages. (a) Agarose gel electrophoresis analysis of Ssp411 mRNA in testes from Ssp411^N-HA/N-HA mice at different postnatal ages using a primer set. β-actin was used as the internal control, and nuclease free water was used as the negative control (NC). (b) Western blotting of testes from Ssp411^N-HA/N-HA mice at different postnatal ages using an anti-HA antibody. α-tubulin was used as the internal control. (c) IF staining of testes from Ssp411^N-HA/N-HA and Ssp411^+/+ mice using an anti-HA antibody. Ssp411^+/+ mice were used as the negative control. Red: HA-TRITC (HA-Ssp411); blue: Hoechst 33342 (nucleus). (d) IHC staining of testes from Ssp411^N-HA/N-HA mice using an anti-HA antibody. Normal IgG was used as the negative control. A: type A differentiated spermatogonia; ln: intermediate spermatogonia; B: type B spermatogonia; Pl: preleptotene; L: leptotene; Z: zygotene; P: pachytene; D: diplotene spermatocytes; meiosis: meiotic figure; S2: secondary spermatocyte; rST: round spermatids; eST: elongating/elongated spermatids; Ssp411: sperm-specific protein 411; HA: hemagglutinin; TRITC: tetramethylrhodamin isothiocyanate; IHC: immunohistochemistry; IF: immunofluorescence; F: forward; R: reverse.

Furthermore, an immunofluorescence assay was conducted with HA antibody using frozen sections of testicular tissues from Ssp411^N-HA/N-HA and Ssp411^+/+ mice. Compared to Ssp411^+/+ mouse testes, Ssp411 was expressed in the seminiferous tubules of Ssp411^N-HA/N-HA mouse testes, and no Ssp411 was detected in the seminiferous tubules of Ssp411^+/+ mouse testes using an HA antibody (Figure 2c). Additionally, immunohistochemistry revealed weak expression of Ssp411 in round spermatids, as showed particularly in Stage VII and Stage VIII (Figure 2d). The expression of Ssp411 increased and peaked in elongating spermatids at Stage IX and Stage X (Figure 2d). All of these data are consistent with the results published in previous studies.4,5

Immunofluorescence of germ cells isolated from Ssp411^N-HA/N-HA mouse testes and the epididymis

To determine whether Ssp411 is present in a variety of adult mouse tissues, we conducted western blotting with an HA antibody. The results showed that Ssp411 was abundantly expressed in the testis, rarely in the epididymis, and not detectable in other tissues (Figure 3a). Then, we performed the western blotting analysis using mature spermatozoa from the epididymides of Ssp411^N-HA/N-HA and Ssp411^+/+ mice. The results, based on western blotting analysis and corresponding grayscale values, demonstrated an approximately 89 kDa band present in Ssp411^N-HA/N-HA spermatozoa (Figure 3b and 3c), as showed in the Ssp411^N-HA/N-HA testes and epididymis (Figure 3a).

Figure 3.

Immunofluorescence assays of testicular germ cells from Ssp411^N-HA/N-HA mouse testes. (a) Western blotting analysis of various tissues from Ssp411^N-HA/N-HA mice using an anti-HA antibody. β-tubulin was used as the internal control. (b) Western blotting analysis of cauda spermatozoa isolated from the epididymis of Ssp411^N-HA/N-HA mice. α-tubulin was used as the internal control. (c) Statistical analysis of the grayscale values of Ssp411 relative to the internal control. Three replicated were performed. ^****P < 0.0001. (d) IF staining of testicular germ cells from Ssp411^HA/HA mice using an anti-HA antibody (HA-Ssp411, green), PNA (acrosome, red), and Hoechst 33342 (nucleus, blue). (e) IF staining of epididymal spermatozoa using anti-HA antibody (HA-Ssp411, green), Normal IgG was used as a negative control, and Hoechst 33342 (nucleus, blue) and TD (bright field) were used. Ssp411: sperm-specific protein 411; HA: hemagglutinin; PNA: peanut agglutinin; TD: transmitted light detection; IF: immunofluorescence.

Additionally, to clarify the subcellular localization of Ssp411 in testicular germ cells or epididymal spermatozoa, we collected these cells from Ssp411^N-HA/N-HA testes or the epididymis and conducted an immunofluorescence assay with an anti-HA antibody and PNA as the acrosome indicator in testicular germ cells. The results showed that the expression of Ssp411 was initiated in round spermatids at step 7/8 and primarily occurred in elongating spermatids during mouse spermiogenesis (Figure 3d). During these steps, Ssp411 was predominantly distributed in the cytoplasm (Figure 3d). Unexpectedly, we found that Ssp411 was mainly distributed in the sperm flagellum of elongated spermatids and epididymal spermatozoa (Figure 3d and 3e).

Effectiveness of HA-tagging in the Ssp411^N-HA/N-HA mouse model

To test the possibility and specificity of the HA antibody and Ssp411^N-HA/N-HA mouse model for the study of Ssp411, a flow-cytometric assay was also conducted using testicular germ cells from the Ssp411^N-HA/N-HA and Ssp411^+/+ mice. Ssp411 signals were detected in the testicular germ cells of the Ssp411^N-HA/N-HA but not in the testicular germ cells of the wild type of Ssp411^+/+ group (Figure 4a and 4b).

Figure 4.

Flow-cytometric analysis of Ssp411^N-HA/N-HA testicular germ cells. (a) Flow cytometric analysis of testicular germ cells isolated from the Ssp411^+/+ mice. The wild type indicates the Ssp411^+/+ mice. (b) Flow cytometric analysis of testicular germ cells isolated from the Ssp411^N-HA/N-HA mice. Hoechst 33342 (blue) was used to stain the nucleus. HA-FITC (green) indicates HA-Ssp411. Q1: Hoechst 33342 negative and HA positive; Q2: Hoechst 33342 positive and HA positive; Q3: Hoechst 33342 positive and HA negative; Q4: Hoechst 33342 negative and HA negative. Ssp411: sperm-specific protein 411; HA: hemagglutinin; FITC: fluorescein isothiocyanate.

Exploring the expression of Ssp411 in oocytes and in single early embryos

To determine the expression and distribution of Ssp411 in oocytes, we performed western blotting and immunofluorescence analysis with an HA antibody and an anti-Ssp411 antibody (F1-3) using mature oocytes isolated from the female Ssp411^N-HA/N-HA and Ssp411^+/+ mice. Compared to those in Ssp411^+/+ and Ssp411^N-HA/N-HA testicular cells, no Ssp411 band was detected in oocytes at the MII stage from Ssp411^N-HA/N-HA and Ssp411^+/+ female mice (Figure 5a). Moreover, no immunofluorescence signal for Ssp411 was detected in MII oocytes from female Ssp411^N-HA/N-HA mice (Figure 5b).

Figure 5.

Exploring the expression of Ssp411 in oocytes and in single early embryos. (a) Western blotting of oocytes isolated from Ssp411^+/+ and Ssp411^N-HA/N-HA female mice using anti-HA antibody and anti-Ssp411 antibody (F1-3). α-tubulin was used as the internal control, the HEK-293T cell line was used as an Ssp411-negative control, Ssp411^+/+ testicular cells were used as an HA-negative control, and Ssp411^N-HA/N-HA testicular cells were used as the positive control. (b) IF staining of oocytes isolated from Ssp411^N-HA/N-HA mice using an anti-HA antibody. Ssp411^+/+ mice were used as a negative control. Hoechst 33342 indicates the nucleus, and HA-TRITC indicated the HA-Ssp411. (c) IF staining of the cells at the zygote and 2-cell stages isolated from female mice mated with Ssp411^N-HA/N-HA male mice or Ssp411^+/+ male mice using an anti-HA antibody. Hoechst 33342 indicates the nucleus, and HA-TRITC indicates HA-Ssp411. (d) Diagrams of cells cultured in vitro. (e) Primer design strategy. (f) qRT-PCR of single Ssp411^+/+ MII oocytes, Ssp411^N-HA/N-HA mature oocytes, and heterozygous embryos from zygote to blastocyst stages. Each group contained 7 or 8 cells. Single-round spermatids from Ssp411^+/+ and Ssp411^N-HA/N-HA male mice were used as positive controls. WT RS: Ssp411^+/+ round spermatid; HA RS: Ssp411^N-HA/N-HA round spermatid; Ssp411: sperm-specific protein 411; HA: hemagglutinin; TRITC: tetramethylrhodamin isothiocyanate; qRT-PCR: quantitative real-time polymerase chain reaction; MII: metaphase II; IF: immunofluorescence; F: forward; R: reverse.

Moreover, we utilized immunofluorescence to detect the expression of Ssp411 in cells during early embryogenesis. Ssp411 was not detected at the heterozygous zygote or 2-cell stage embryo (Figure 5c).

Additionally, we utilized single-cell fluorescence quantitative PCR to detect the transcription of Ssp411 mRNA in single homozygous oocytes from Ssp411^N-HA/N-HA and Ssp411^+/+ female mice and in heterozygous embryos during early embryogenesis cultured in vitro, as illustrated in the paradigm (Figure 5d and 5e). However, Ssp411 mRNA was not detected in mature oocytes at the MII stage or in embryos during the process of early embryogenesis (Figure 5f).

DISCUSSION

In this study, we successfully generated an HA-tagged Ssp411 mouse model, providing a novel and effective tool for investigating the expression or function of Ssp411. When comparing the expression of Ssp411 in HA-tagged Ssp411 mice and wild-type mice, we observed no impact of the HA tag on the natural expression or function of the Ssp411 protein. Moreover, the use of the HA tag in this study streamlined the experimental procedure for detecting Ssp411. This approach enabled us to conveniently utilize a single antibody and consistently detect Ssp411 across various experimental techniques, such as western blotting, immunohistochemistry, immunofluorescence, and flow cytometry. These findings strongly support the feasibility of the GTP.

Previous studies have detected the expression of Ssp411 in epididymal spermatozoa from humans, rats, and mice using mass spectrometry.11,12,13,14,15,16 However, including in our own preliminary research, some studies have not been able to identify this protein in epididymal spermatozoa.5,17,18 In the present study, utilizing an HA-tagged Ssp411 mouse model, we confirmed the expression and localization of Ssp411 in epididymal spermatozoa. This study represents the first documented observation of the predominant localization of Ssp411 along the sperm flagellum in epididymal spermatozoa, as detected through the use of an HA-tagged mouse model. We hypothesize that the expression level of Ssp411 in epididymal spermatozoa might be very low, thus requiring highly sensitive techniques such as proteomic analysis (which also carries a greater risk of false positive) or the use of highly specific and sensitive antibodies to detect its presence.

Sperm-borne factors can influence the early stages of embryonic development through two potential mechanisms, namely, direct action and indirect action.19,20,21 The former entails the introduction of proteins or mRNAs by the sperm into the oocyte or their subsequent expression during fertilization, thereby directly influencing embryonic development, as exemplified by the proteins phospholipase C zeta (PLCζ) and Glc seven-like phosphatase 3/4 (GSP-3/4), as reported in previous studies.22,23,24,25 PLCζ, a soluble sperm-borne protein, is assumed to be a key trigger of Ca²⁺ oscillations in eggs, exerting its function by targeting the intracellular membranous source of phosphatidylinositol 4,5-bisphosphate (PI[4,5]P₂).22,23 GSP-3/4, two sperm-specific protein phosphatase type 1 (PP1) phosphatase homologs, physically interact with and activate meiosis-to-mitosis transition-associated (MEMI) signaling pathway-related meiotic division in fertilized Caenorhabditis elegans oocytes.24,25 However, our findings indicate that Ssp411 was not detected in mature oocytes, zygotes, or 2-cell stage embryos, even when highly sensitive HA-tagging techniques were used, which is consistent with previous studies.26,27,28 These findings collectively exclude the possibility of direct involvement of Ssp411 in early embryonic development. We hypothesize that Ssp411 may interact with key proteins related to early embryonic development or contribute to the formation of sperm subcellular structures, such as the sperm annulus. The absence of Ssp411 may consequently lead to abnormalities in these subcellular structures and altered localization or expression of these proteins that interact with Ssp411, thereby indirectly affecting the processes involved in early embryonic development. Although direct support for this proposed indirect mechanism action is currently lacking in the literature, similar indirect action mechanisms have been demonstrated for other sperm proteins, such as SPE-11, as reported in previous studies.29,30 Similar to Ssp411, SPE-11 is expressed in mature spermatozoa but not in oocytes, and it was the first sperm protein shown to contribute to the development of embryos from fertilized eggs, as reported in previous studies.29,31,32 Recent research has highlighted the pivotal role of SPE-11 depletion in inducing pleiotropic developmental anomalies during the early stages of embryogenesis, accompanied by decreased mRNA expression levels of genes crucial for the oocyte-to-embryo transition or embryonic development in mature sperm.30 To further elucidate the reasons for the significant impact of Ssp411 on the processes of cleavage and early embryonic development, we successfully generated an Ssp411^-/- mouse model. Future in-depth investigations utilizing these two complementary mouse models, the Ssp411^N-HA/N-HA model and the Ssp411^-/- mouse model, will contribute to clarifying the precise functions and underlying mechanisms of Ssp411 in a comprehensive manner.

In summary, by applying HA-tagging technology to model animals, our study provides not only a powerful tool for investigating the functions of Ssp411 but also a significant contribution to the GTP. The discoveries and methodologies unveiled in this research hold substantial significance for further studies in spermiogenesis and reproductive biology, potentially leading to groundbreaking advancements in these fields.

AUTHOR CONTRIBUTIONS

XHZ carried out the experiments and drafted the manuscript. MMH conducted the FACS and revised the manuscript. MMH, JNT, and XMW performed the oocytes collection and cultured embryos in vitro. BGW assisted in constructing the mouse model and participated in breeding mice. CGS designed the primers for single cell qRT-PCR and helped to analyze these data. YY and JW helped to perform the genetic experiments. BW carried out the generation and purification of the Ssp411 antibody F1-3. BLZ and YSS conducted the preparation of testicular tissue sections. HJS and TCZ designed the experiments, and conceived the manuscript. All authors read and approved the final manuscript.

COMPETING INTERESTS

All authors declare no competing interests.