Abstract
Hypopharyngeal and laryngeal cancers which belong to head and neck squamous cell carcinoma (HNSCC) are the two most malignant types of head and neck cancer, characterized by a low 5‐year survival rate, high recurrence and metastasis rate. It is vital to explore strategies to suppress metastasis and improve prognosis for patients with these cancers. In this research, we analyzed the clinical data and found that E3 ubiquitin ligase TRIM47 was upregulated in cancer tissues of hypopharyngeal cancer and was closely associated with poor survival outcomes. In terms of mechanism, we performed tandem affinity chromatography and denatured Ni‐NTA Agarose pulldown. As a result, TRIM47 was found to interact with vimentin and control vimentin stabilization through ubiquitination, specifically in the form of K63 chains. Importantly, through experiments of cancer cell viability and migration, we found that TRIM47 could enhance the proliferation and metastasis abilities of cancer cells in a vimentin‐dependent manner, thus promoting the advancement of hypopharyngeal and laryngeal cancers. TRIM47 was verified to regulate cancer cells metastasis in vivo using metastasis models. All these results imply that TRIM47 emerges as a potential biomarker for early diagnosis and metastasis prediction of hypopharyngeal and laryngeal cancers and represents a promising therapeutic target.
Keywords: hypopharyngeal and laryngeal cancers, metastasis, TRIM47, ubiquitination, vimentin
E3 ubiquitin ligase TRIM47 overexpresses in hypopharyngeal cancer and is related to poor prognosis. TRIM47 regulates vimentin which is associated with metastasis with K63‐linked ubiquitination in hypopharyngeal and laryngeal cancers.

1. INTRODUCTION
According to global cancer statistics in 2020, new cases and new deaths of head and neck cancer in the broad sense rank seventh among all cancers, involving over 930,000 and 460,000 cases, respectively. 1 Due to the deficiency of effective therapeutic targets, the treatments of hypopharyngeal and laryngeal cancers in clinical practice are still mainly surgery and chemoradiotherapy. Distant metastasis of cancer cells is the main reason for the low 5‐year survival rate in hypopharyngeal and laryngeal cancer patients. 2 , 3 , 4 , 5 Exploring new biomarker and therapeutic targets is still an important research direction in hypopharyngeal and laryngeal cancers.
TRIM47, belonging to the fourth subfamily of the TRIM family, which is a subset of the RING E3 ubiquitin ligase family, has the only one domain structure in its family. 6 As reported, TRIM47 facilitates the development of cancers. TRIM47 mediates K27 ubiquitination and stabilization of PKCε to induce endocrine therapy resistance in HR‐positive breast cancer cells. 7 Deficiency of TRIM47 accounts for the inactivation of the PI3K/AKT pathway, by which progression of triple‐negative breast cancer is suppressed. 8 In addition, TRIM47 executes ubiquitination degradation of Smad4 and FBP1 to promote cancer progression in colorectal cancer and pancreatic cancer, respectively. 9 , 10 However, TRIM47 inhibits in some cases. For instance, TRIM47 is upregulated in triple‐negative breast cancer, which leads to the sensitivity of cancer cells to drugs. 11 However, the function and the outcome of TRIM47 in hypopharyngeal and laryngeal cancers are not yet known.
Vimentin is a classic epithelial–mesenchymal transition (EMT) marker. As reported, high expression of vimentin and low expression of E‐cadherin jointly delineate a high metastasis rate in HNSCC patients. 12 Vimentin also promotes cancer cells to obtain fibroblast morphology in drug‐resistant cells from HNSCC. 13 It has been reported that vimentin is protected from ubiquitination degradation by the low modification of symmetrical dimethylarginine (sDMA ) in lung cancer 14 and hepatitis B virus X protein (HBX) in liver cancer. 15 However, the mechanism by which vimentin is regulated in hypopharyngeal and laryngeal cancer metastasis remains to be elucidated.
In this research, we investigated the function of TRIM47 in hypopharyngeal and laryngeal cancers. We found that vimentin was one of the molecules that interacted with TRIM47. Therefore, we explored the ubiquitination relationship between TRIM47 and vimentin. Our results showed that TRIM47 promotes the development of cancer cells by K63‐linked ubiquitination and stabilization of vimentin. Therefore, TRIM47 is a prospective biomarker and therapeutic target for metastasis of hypopharyngeal and laryngeal cancers.
2. MATERIALS AND METHODS
2.1. Cell culture
FaDu, Tu686 and HEK‐293T cells were obtained from the ATCC and were cultured at 37°C with 5% CO2. All cell lines were checked routinely for mycoplasma and tested cytogenetically to ensure their authentication.
2.2. Clinical specimens
Clinical hypopharyngeal cancer samples were obtained from the Qilu Hospital of Shandong University (Jinan, Shandong, China). All patients provided informed consent. Patients were pathologically and clinically diagnosed with hypopharyngeal cancer.
2.3. RNA isolation and quantitative real‐time polymerase chain reaction
Primers sequences were synthesized by BioSune company: TRIM47 (F: CTGACTCAGTCAGCTTCCTGCA, R: TCTCTCACTGCACGGACAGC), β‐ACTIN (F: CATGTACGTTGCTATCCAGGC, R: CTCCTTAATGTCACGCACGAT). β‐ACTIN was identified as the RNA internal control, and the calculated Ct value was normalized to the β‐ACTIN value.
2.4. Antibodies
Primary antibody: TRIM47(26885‐1‐AP, Proteintech), vimentin (10366‐1‐AP, Proteintech), β‐Actin (AC026, Abclonal).
2.5. Transfection of plasmids and siRNA
The siRNAs targeting TRIM47 and vimentin were synthesized by GenePharma: si‐TRIM47‐1: sense: CAAAUCAUCCCAAGCUGUCCGUGCA, antisense: UGCACGGACAGCUUGGGAUGAUUUG; si‐TRIM47‐2: sense: GCAGCUGUUUGGAACCAAATT, antisense: UUUGGUUCCAAACAGCUGCTT. si‐Vimentin: sense: GUACGUCAGCAAUAUGAAA, antisense: UUUCAUAUUGCUGACGUAC. Plasmids were purchased from SinoBiological and modified ourselves.
2.6. Immunofluorescence
The cells on the slides were fixed with 4% paraformaldehyde and permeabilized in 0.1% Triton X‐100. They were blocked by 5% BSA blocking buffer and incubated with primary antibody overnight at 4°C and incubated with secondary antibody. DAPI was used to visualize nuclei. The slides were mounted with Antifade Solution (H‐1700, VECTASHIELD Vibrance).
2.7. In vivo ubiquitination assay
Cells were lysed in a denatured lysis buffer. The protein of each group was incubated with Ni‐NTA Agarose at 4°C overnight. The Ni‐NTA Agarose bound with protein was washed in 0.1% Triton X‐100 PBS followed by boiling in 1× loading buffer at 100°C prior to western blot analysis.
2.8. Cell proliferation assay
Cell viability was determined by CCK8 assay (CK04, DOJINDO), MTT assay(C0009M, Beyotime) and the incorporation of 5‐bromo‐2‐deoxyuracil (EdU) (40276ES60, YEASEN) as per the manufacturer's instructions.
2.9. Transwell assay
Cells were reseeded into the upper chambers. After 48 h, the cells on the membrane of the upper chambers were fixed in 4% paraformaldehyde and stained with crystal violet. For the invasion assay, the upper chambers were coated with Matrigel at 37°C.
2.10. Wound healing assay
The 12‐well plates were prepared with double‐hole silicone plug‐in units to make the “wound.” The cells were then reseeded into it. Twenty‐four hours later, the plug‐in units were pulled out. The images of every timepoint were taken using a LIONHEART automated microscope (BioTek).
2.11. Immunohistochemistry
The slides were subjected to 1× Tris‐EDTA antigen retrieval buffer (C1038, Solarbio) and incubated in endogenous peroxidase blockers (3% hydrogen peroxide, GK600505, Genetech). The slides were incubated in 5% BSA followed by incubation with the primary antibody overnight at 4°C and then incubated with the secondary antibody. Then the slides were developed using DAB color development solution and counterstained with hematoxylin.
2.12. Metastasis model
In an experimental metastasis model, 4‐week‐old nude mice were housed under specific pathogen‐free conditions. FaDu cells with plasmids PCDH‐CMV‐MCS‐EF1a‐LUC‐T2A‐PURO (BioSune) and then shCONTROL, shTRIM47‐1 and shTRIM47‐2 respectively (1 × 106 cells each nude mouse) were injected into the tail veins of mice. After intraperitoneal injection of d‐Luciferin, Sodium Salt (40901ES02, Yeasen) (150 mg/kg), the bioluminescence of metastatic tumors was detected using an IVIS Spectrum (Perkin Elmer, USA). For the spontaneous metastasis model, FaDu cells of shCONTROL, shTRIM47‐1 and shTRIM47‐2 (1 × 106 cells each nude mouse) were injected subcutaneously into the left back of nude mice. When the tumor masses grew to a diameter of about 1.5 cm, they were removed. After 3 months, all the mice were dissected for metastases search.
2.13. Quantification and statistical analysis
All data were derived from at least triplicate experiments. All the error bars used in the figures were obtained from three independent experiments and data were presented as mean ± standard deviation (SD). The significance of Figure 1A was evaluated by t‐test. The significance of Figures 2, 3 and 6 except Figure 6F was determined by one‐way ANOVA followed by post hoc Dunnett test. In addition, the significance of Figures 1C and 5 was determined by Student's t‐test and the significance of Figure 6F was evaluated by Fisher's exact test. Statistical calculations were performed using SPSS 17.0 (IBM) and GraphPad Prism 5.0 (GraphPad Software, USA). p‐values < 0.05 were considered statistically significant.
FIGURE 1.

TRIM47 is overexpressed in hypopharyngeal cancer and indicates poor survival of patients. (A) Relative mRNA level of TRIM47 in cancer compared to mucosa in 90 patients of hypopharyngeal cancer (***p ≤ 0.001). (B) Representative protein level of TRIM47 in tumor tissue compared to normal tissue of 10 patients with hypopharyngeal cancer. (C) Statistical analysis of protein level of TRIM47 in 40 pairs of normal tissue and tumor tissue from patients with hypopharyngeal cancer (**p ≤ 0.01). (D) Representative immunohistochemistry staining images of TRIM47 in adjacent tissue and cancer tissue with high and low TRIM47 expression, respectively (scale bar 100 μm and 20 μm are showed in images). (E) Percentage of high TRIM47 expression and low TRIM47 expression in adjacent tissue and cancer tissue, respectively. (F) Kaplan–Meier curves of the relationship between overall survival and TRIM47 expression in hypopharyngeal cancer patients. *p ≤ 0.05 is considered statistically significant.
FIGURE 2.

TRIM47 enhances the proliferation of hypopharyngeal and laryngeal cancer cells. (A) Knockdown efficiency of two siRNAs targeting TRIM47 by reverse‐transcriptase quantitative PCR in FaDu and Tu686 (***p ≤ 0.001). (B) Knockdown of TRIM47 validated by western blot in FaDu and Tu686 cells. (C) Overexpression (OE) of TRIM47 confirmed by western blot in FaDu and Tu686 cells. (D) Flow diagram of stable cell lines construction and determination of TRIM47 levels in stable cell lines by western blot. (E) CCK8 assay of FaDu cells after TRIM47 was knocked down (***p ≤ 0.001). (F) MTT assay of Tu686 cells after TRIM47 was knocked down (***p ≤ 0.001). (G) EdU (5‐ethynyl‐2′‐deoxyuridine) incorporation assay and statistical analysis of FaDu and Tu686 cells after TRIM47 was knocked down (*p ≤ 0.05). (H) Plate clonality assays and statistical analysis of FaDu and Tu686 when TRIM47 was knocked down (*p ≤ 0.05). (I) Protein levels of proliferation markers when TRIM47 was knocked down in hypopharyngeal and laryngeal cancer cells.
FIGURE 3.

TRIM47 promotes the migration and invasion of hypopharyngeal and laryngeal cancer cells. (A) Wound healing assay and statistical line chart of TRIM47‐knockdown FaDu cells (***p ≤ 0.001). (B) Wound healing assay and statistical line chart of TRIM47‐knockdown Tu686 cells (**p ≤ 0.01). (C) Transwell assay and related statistical bar chart of TRIM47‐knockdown FaDu cells (**p ≤ 0.01, ***p ≤ 0.001). (D) Transwell assay and related statistical bar chart of TRIM47‐knockdown Tu686 cells (*p ≤ 0.05, ***p ≤ 0.001). (E) Protein level of metastasis markers when TRIM47 was knocked down in four kinds of HNSCC cells.
FIGURE 6.

TRIM47 promotes metastasis of hypopharyngeal cancer in vivo. (A) Schematic diagram of the experimental metastasis model on nude mice. (B) Representative living images and statistical analysis after tail vein injection with LUC‐shCONTROL, LUC‐shTRIM47‐1 and LUC‐shTRIM47‐2 FaDu cells in nude mice in experimental metastasis model (*p ≤ 0.05, **p ≤ 0.01). (C) Representative images of metastatic nodules on the lungs of nude mice in experimental metastasis model. (D) Statistical analysis of lung nodules from experimental metastasis model (**p ≤ 0.01). (E) Statistical analysis of lymph node metastases count in spontaneous metastasis model (**p ≤ 0.01). (F) The proportion of nude mice with lung metastases in each group in spontaneous metastasis model (*p ≤ 0.05). (G) Protein level of vimentin in the lymph node metastasis tissue in spontaneous metastasis model. (H) Representative images of lymph node metastases and lung metastases in each group in spontaneous metastasis model (Green arrows: Lymph node metastases and lung metastases; Red arrows: The lymph node metastases in the bodies were displayed with rulers). (I) Hematoxylin–Eosin staining of lymph node metastasis and normal lymph node (Black arrows: Proliferating cancer cells).
FIGURE 5.

TRIM47 promotes progression of hypopharyngeal and laryngeal cancers through vimentin. (A, B) Transwell assays and statistical analysis of FaDu and Tu686 cells transfected with plasmids and siRNA of TRIM47 and vimentin according to different groups (*p ≤ 0.05, **p ≤ 0.01). (C, D) CCK8 assays of FaDu and Tu686 cells transfected with plasmids and siRNA of TRIM47 and vimentin according to different groups (*p ≤ 0.05, **p ≤ 0.01). (E, F) Plate clonality assays and statistical analysis of FaDu and Tu686 which were transfected with plasmids and siRNA of TRIM47 and vimentin according to different groups (*p ≤ 0.05, **p ≤ 0.01). (G) Protein level of TRIM47 and vimentin in different transfection groups.
3. RESULTS
3.1. TRIM47 is overexpressed in hypopharyngeal cancer and indicates the poor survival of patients
To investigate whether TRIM47 is related to the progression of hypopharyngeal cancer, we collected samples and information belonging to patients with hypopharyngeal cancer. We first examined TRIM47 expression in RNA samples isolated from fresh mucosa and cancerous tissue by reverse‐transcriptase quantitative PCR (RT‐qPCR) as well as in protein samples from tumor tissues and paired normal tissues of patients by western blotting (WB). As shown in Figure 1A, the average mRNA level of TRIM47 was obviously higher in the cancer sample when compared with the mucosa sample. The protein level of TRIM47 in tumor tissues was also notably highly regulated when compared with normal tissues (Figure 1B,C). Furthermore, immunohistochemistry (IHC) staining and statistics analysis of adjacent tissue and cancerous tissue provided additional evidence that indicated that TRIM47 was overexpressed in 63% of hypopharyngeal cancer tissues, whereas only 30% of adjacent tissues displayed high TRIM47 expression (Figure 1D,E). To investigate the relationship between TRIM47 and the prognosis of hypopharyngeal cancer patients, we collected 145 cases of hypopharyngeal cancer patients whose clinical data are described in Table 1 and survival data were plotted using Kaplan–Meier survival curves; statistical significance was calculated using the log‐rank test (Figure 1F). High levels of TRIM47 were closely associated with a low probability of survival, as depicted in the figure. Taken together, these data unraveled that TRIM47 is related to the progression of hypopharyngeal cancer.
TABLE 1.
Clinical data of 145 cases of hypopharyngeal cancer.
| Characteristics | Total | TRIM47 expression | χ 2 | p‐value | |
|---|---|---|---|---|---|
| 145 | Low | High | |||
| Age (years) | |||||
| ≥60 | 92 | 44 | 48 | 0.915 | 0.3388 |
| <60 | 53 | 21 | 32 | ||
| Gender | |||||
| Male | 138 | 59 | 79 | 3.3862 | 0.0657 |
| Female | 7 | 6 | 1 | ||
| Smoke | |||||
| No | 28 | 18 | 10 | 5.3122 | 0.0212* |
| Yes | 117 | 47 | 70 | ||
| Drink | |||||
| No | 26 | 14 | 12 | 1.0418 | 0.3074 |
| Yes | 119 | 51 | 68 | ||
| T classification | |||||
| T1 | 26 | 11 | 15 | 3.6002 | 0.3152 |
| T2 | 66 | 35 | 31 | ||
| T3 | 45 | 16 | 29 | ||
| T4 | 8 | 3 | 5 | ||
| N classification | |||||
| N0 | 44 | 26 | 18 | 8.2919 | 0.0409* |
| N1 | 30 | 13 | 17 | ||
| N2 | 62 | 25 | 37 | ||
| N3 | 9 | 1 | 8 | ||
| AJCC stage | |||||
| I | 11 | 7 | 4 | 9.7252 | 0.0214* |
| II | 21 | 15 | 6 | ||
| III | 38 | 15 | 23 | ||
| IV | 75 | 28 | 47 | ||
| Tumor differentiation | |||||
| In situ | 3 | 2 | 1 | 8.6153 | 0.1794 |
| Well | 14 | 5 | 9 | ||
| Well moderately | 24 | 14 | 10 | ||
| Moderately | 40 | 18 | 22 | ||
| Moderately poorly | 27 | 7 | 20 | ||
| Poorly | 33 | 18 | 15 | ||
| Others | 4 | 1 | 3 | ||
Note: *p value < 0.05 is considered statistically significant.
3.2. TRIM47 enhances proliferation of hypopharyngeal and laryngeal cancer cells
To investigate the role of TRIM47 in hypopharyngeal and laryngeal cancers, TRIM47 was transiently knocked down or overexpressed by transfection of siRNA targeting TRIM47 or plasmid Flag‐TRIM47 into hypopharyngeal cancer (FaDu) and laryngeal cancer (Tu686) cell lines, respectively. Figure 2A,B shows the results of knockdown verified by RT‐qPCR and WB and Figure 2C shows the overexpression of TRIM47 determined by antibody binding to TRIM47 itself and Flag tag. In order to perform experiments that lasted for a long period, we knocked down TRIM47 in FaDu and Tu686 cell lines using a lentivirus expressing shTRIM47/shCONTROL; the stable knockdown of TRIM47 was confirmed in the indicated cell lines (Figure 2D).
To explore whether TRIM47 had an impact on the proliferation of hypopharyngeal and laryngeal cancer cell lines, we performed a CCK8 assay on FaDu cells (Figure 2E) and MTT assay on Tu686 cells (Figure 2F). The outcomes demonstrated that knockdown of TRIM47 reduced the ability of proliferation in hypopharyngeal and laryngeal cancers cell lines. Similar to the viability data above, the EdU incorporation assay showed that the knockdown of TRIM47 apparently decreased the total population of cells in the field of vision and the count of cells that exhibited EdU incorporation (Figure 2G). Next, we ascertained the effect that TRIM47 had on hypopharyngeal and laryngeal cancers by plate clonality assays with stable knockdown cell lines, which displayed a clear decrease in colonies number under knockdown of TRIM47 even though we seeded the same number of cells initially (Figure 2H). Next, we tested how proliferation‐related markers were expressed in hypopharyngeal and laryngeal cancer cell lines when TRIM47 was knocked down. As Figure 2I describes, c‐Myc was affected by the decrease in TRIM47. Together, these results suggested that the knockdown of TRIM47 impaired the proliferation of hypopharyngeal and laryngeal cancers.
3.3. TRIM47 promotes the migration and invasion of hypopharyngeal and laryngeal cancer cells
We then investigated whether TRIM47 influenced the migration and invasion of hypopharyngeal and laryngeal cancers. First, we conducted wound healing assays to examine the effect that knockdown of TRIM47 had on cell migration. As Figure 3A,B depicts, knockdown of TRIM47 obviously slowed down the speed of hypopharyngeal and laryngeal cancer cell migration. Consistent with the outcome of wound healing assays, the results of transwell assays indicated that the knockdown of TRIM47 reduced the number of cancer cells going across the membrane and impaired the migration and invasion abilities of hypopharyngeal and laryngeal cancers (Figure 3C,D). We used WB to test the level of metastasis markers when TRIM47 was knocked down (Figure 3E) and found that N‐cadherin and vimentin were distinctly decreased while E‐cadherin expression had increased slightly. It was intriguing that there was less vimentin and more E‐cadherin protein in Scc9 than in the other three kinds of cell lines, which implied that the protein levels of vimentin and E‐cadherin were important in Scc9. Taken together, these data, especially the drastic decrease in transwell assays revealed that TRIM47 promoted the migration and invasion in hypopharyngeal and laryngeal cancer cells.
3.4. TRIM47 mediates K63 ubiquitination and protein stabilization of vimentin
To gain an insight into the mechanism by which TRIM47 influences the progression of hypopharyngeal and laryngeal cancers and identify its substrate as an E3 ubiquitin ligase in ubiquitination, we constructed stable overexpressing cell lines by transfection of the plasmid Flag‐HA‐TRIM47 and completed tandem affinity chromatography including Flag Agarose pulldown and HA Agarose pulldown with the whole‐cell protein lysates, followed by silver staining (Figure 4A) to detect differential protein bands in the resultant immunoprecipitation (IP), and final protein identification by mass spectrometry. We identified several proteins that interacted with TRIM47 compared with CONTROL cell lines, as shown in Figure 4B, and vimentin was one of them (Figure 4C). The general list of proteins identified is shown in Table S1. As vimentin decreased when TRIM47 was knocked down, as observed in the results above, and vimentin appeared on the list of proteins that interacted with TRIM47, we decided to investigate the relationship between TRIM47 and vimentin. The images of immunofluorescence revealed the colocalization of TRIM47 and vimentin (Figure 4D). Then, we confirmed whether TRIM47 interacted with vimentin by performing HA‐IP using cancer cells transfected with plasmid HA‐vimentin; endogenous TRIM47 protein was pulled down by HA Agarose, as indicated in Figure 4E. As TRIM47 is known to mediate the ubiquitination of substrates, we hypothesized that the TRIM47–vimentin interaction was associated with ubiquitination. Therefore, we first obtained the whole‐cell lysates that were transfected with plasmids of Flag‐TRIM47, HA‐vimentin and His‐Ub according to different groups, followed by Ni‐NTA Agarose pulldown. The results indicated that increasing expression of TRIM47 obviously enhanced the ubiquitination and quantity of vimentin (Figure 4F). To further characterize the form of ubiquitination between TRIM47 and vimentin, we decided to perform Ni‐NTA Agarose pulldown with whole‐cell lysates previously transfected with different mutants of Ub. As shown in Figure 4G,H, the ubiquitination of vimentin was enhanced due to TRIM47 overexpression only when the 63rd lysine was left and ubiquitination of vimentin reduced only when the 63rd lysine was mutated. These results implied that TRIM47 mediates K63 ubiquitination of vimentin. Given the synchronous change between TRIM47 and vimentin observed in the results above, such as in Figure 3E, we deduced that TRIM47 catalyzed the ubiquitination of vimentin for stabilization but not degradation. Next, TRIM47 was overexpressed in gradients; Figure 4I shows that the endogenous level of vimentin was upregulated following the overexpression of TRIM47. Taken together, these results indicated that TRIM47 mediates K63 ubiquitination of vimentin, leading to stabilization of vimentin.
FIGURE 4.

TRIM47 mediates K63 ubiquitination and protein stabilization of vimentin. (A) Silver staining after immunoprecipitation of TRIM47‐OE cells and control cells. (B) Mass spectrum results of TRIM47 (PSMs: Peptide Spectrum Matches; AAs: Amino Acids; MW: Molecular Weight). (C) Mass spectrometry identification of protein which interact with TRIM47 recognized vimentin as a substrate of TRIM47. (D) Colocalization of TRIM47 and vimentin shown by immunofluorescence (white arrow indicated). (E) HA‐IP between HA‐vimentin and endogenous TRIM47 was performed and shown by WB. (F) Ni‐NTA Agarose denatured pulldown of vimentin (Ub)n after plasmids Flag‐TRIM47, HA‐vimentin and His‐Ub‐WT were transfected. (G) Ni‐NTA Agarose denatured pulldown of vimentin (Ub)n after plasmids Flag‐TRIM47, HA‐vimentin and His‐Ub‐WT/His‐Ub‐Kx‐only were transfected respectively. (H) Ni‐NTA Agarose denatured pulldown of vimentin (Ub)n after plasmids Flag‐TRIM47, HA‐vimentin and His‐Ub‐WT /His‐Ub‐Kx‐mutant were transfected respectively. (I) Protein level of vimentin when TRIM47 level increased in a gradient.
3.5. TRIM47 promotes the progression of hypopharyngeal and laryngeal cancers through vimentin
To further confirm whether TRIM47 regulated the progression of hypopharyngeal and laryngeal cancers through vimentin, we performed rescue experiments in FaDu and Tu686 after transfection with diverse groups of knockdown or overexpression of TRIM47 or vimentin as shown in Figure 5A,B. Consistent with our predicted results, transwell assays showed that knockdown of vimentin reduced the number of cancer cells crossing the membrane and overexpression of TRIM47 enhanced it. When vimentin was exhausted after overexpression of TRIM47, TRIM47 was not able to strengthen the ability of cancer cells to invade. While vimentin was overexpressed, TRIM47 restored its competency to promote cancer cell invasion. Similarly, we also arranged different groups for rescue experiments when we investigated whether TRIM47 was capable of increasing cell viability through vimentin. These results were similar to those of the transwell assays (Figure 5C–F). Figure 5G offered a verification of the protein level of TRIM47 and vimentin in different groups mentioned above. Taken together, TRIM47 promoted the progression of cancer cells through the interaction and regulation of vimentin.
3.6. TRIM47 promotes metastasis of hypopharyngeal cancer in vivo
Finally, a metastasis model was constructed to examine the effect of TRIM47 on hypopharyngeal cancer in vivo. Three stable cell lines that were able to express Luciferase (LUC)‐shCONTROL or LUC‐shTRIM47‐1 or LUC‐shTRIM47‐2 were screened out. Then cells were counted and diluted at the same concentration, followed by injection into BALB/c‐nude mice through the tail vein. After that, BALB/c‐nude mice were fed for 8 weeks followed by intraperitoneal substrate injection and live imaging (Figure 6A). Live images displayed that the BALB/c‐nude mice injected with LUC‐shTRIM47 FaDu cells showed fewer and smaller fluorescent masses than the BALB/c‐nude mice injected with the LUC‐shCONTROL FaDu cells (Figure 6B). Moreover, the knockdown of TRIM47 reduced the quantity and size of metastasis nodules on the surface of the lungs, which were the main organs of metastasis (Figure 6C,D).
In a spontaneous metastasis model, FaDu cells of shCONTROL, shTRIM47‐1 and shTRIM47‐2 were injected subcutaneously into the left back of nude mice. Tumors were removed when approaching a diameter of 1.5 cm. After 3 months, the nude mice were dissected to seek any metastases. The results showed that the number of lymph node metastases (Figure 6E,H) and the proportion of nude mice with lung metastases (Figure 6F,H) in the shCONTROL group were higher than that in any two shTRIM47 groups, indicating that knockdown of TRIM47 obviously impaired the ability of cancer cells to metastasize in vivo. The protein level of vimentin in the lymph node metastasis tissue from the right axilla (Figure 6G) suggested that vimentin was involved in the effect of TRIM47 on the metastasis of cancer cells. Figure 6I shows H&E staining of lymph node metastasis from right axilla and normal lymph node which displays disordered lymph node structure and proliferating cancer cells in lymph node metastasis.
Together, TRIM47 promoted the progression of hypopharyngeal cancer in vivo and regulated the metastasis of hypopharyngeal cancer through vimentin.
4. DISCUSSION
The proportion of advanced clinical stage patients is high in HNSCC due to the high tendency of cancer cells to metastasize and its late diagnosis. Advanced stage cancers that have metastasized account for a 5‐year survival rate of <50%. 2 However, effective drug treatments aimed at retarding metastasis have not yet been exploited effectively. Here, we identified TRIM47 as a molecule with high expression in cancer tissues compared with normal tissues from hypopharyngeal cancer. TRIM47 enhanced the metastasis and proliferation of hypopharyngeal and laryngeal cancer cells. We then identified vimentin as one of the molecules that interacted with TRIM47. TRIM47 mediated K63 ubiquitination of vimentin and stabilized vimentin.
Members in the TRIM family including TRIM47 share the most common domains and partial members play a vital role in metastasis. 6 TRIM7 is higher in osteosarcoma and assists in its migration. 16 The transcription and translation levels of TRIM17 are at a high platform level in gastric cancer. 17 TRIM47 usually displays the opposite trend to decreased substrate and advances cancers significantly. 9 , 10 , 18 Similarities exist between the above study and our findings that revealed higher mRNA and protein levels for TRIM47 in hypopharyngeal cancer tissues. Importantly, when we reduced the expression of TRIM47, the number of cells that crossed the membrane in transwell assays was sharply reduced, so we agreed that TRIM47 obviously affected migration and invasion in hypopharyngeal and laryngeal cancers.
To increase the specificity in finding the interactionist of TRIM47, we constructed the plasmid of Flag‐HA‐TRIM47 and performed tandem affinity chromatography. Vimentin, which is related to migration, appeared on the list. TRIM27, which belongs to the same subfamily as TRIM47, controlled the level of vimentin through regulation of the p‐AKT pathway to promote EMT and cancer migration. 19 Our following study showed that TRIM47 bound to vimentin to function.
In breast cancer and glioma, researchers have detected less vimentin in the cell lysates when TRIM47 was knocked down compared with the control group. 8 , 20 Vimentin is also downregulated when TRIM47 was decreased in human embryonic lung fibroblasts. 21 However, whether TRIM47 controls vimentin and how to control it were not clarified. Here, we found that TRIM47 was able to promote the ubiquitination of vimentin by performing denatured pulldown between TRIM47 and vimentin. As reported previously, TRIM47 stabilized substrate protein PKCε with K27 ubiquitination in breast cancer. 7 This research verified that TRIM47 regulated the ubiquitination of vimentin in its K63 form and stabilized vimentin by ubiquitination. Several members of the TRIM family that are similar to TRIM47 also play a role in substrate stabilization or activation with ubiquitination. For instance, TRIM15 mediates K63 polyubiquitination of ERK and promotes its activation by MEK. 22 TRIM11 regulates the ubiquitination of ERα and stabilizes it, so that ERα is conducive to the progression of breast cancer cells. 23 In addition, TRIM8, which interacts with TRIM47, 24 participates in the activation of TAK1 protein in the form of K63 ubiquitination. 25 Overall, vimentin is generally degraded by ubiquitination with E3 ubiquitin ligases such as NEURL3 and RNF208. 26 , 27 However, in our research, vimentin expression was upregulated by TRIM47. And TRIM47 ubiquitinated vimentin with polyubiquitin chains. What is more, knockdown of vimentin impaired the ability of cancer cells to invade and proliferate that was promoted by TRIM47 overexpression; increasing expression of vimentin rescued the ability mentioned above.
As an important biomarker of EMT, the increased levels of vimentin suggested a high invasion and migration rate. Interestingly, we found that TRIM47 promoted cancer cell proliferation and viability through vimentin, which was similar to previous findings. For example, vimentin promoted the expression of ki67 and the ability to proliferate in fibroblasts. 28 Vimentin upregulated the positive rate of PCNA and the frequency of cell division in hepatic stellate cells. 29 In addition, vimentin enhanced proliferation capacity in colorectal cancer. 30 The potential mechanism of vimentin and proliferation deserved further investigation.
The clinical application of drugs targeting vimentin is not ideal. For example, vimentin is inhibited by Withaferin A, but drug toxicity, poor oral bioavailability and low production quantity of Withaferin A are not conducive to its clinical application. 31 , 32 In addition, vimentin is suppressed by silibinin, 33 which appeared to cause hyperbilirubinemia in phase 1 of a clinical trial. 34 Therefore, targeting other proteins that regulate vimentin may be a potentially effective strategy for treating tumor progression caused by vimentin. This research verified that TRIM47 regulated the stabilization of vimentin as an upstream molecule of vimentin. More importantly, TRIM47 is the only member with only one PRY domain at the C‐terminal in the fourth subfamily of the TRIM family that belongs to the RING E3 ubiquitin family. 6 Competition binding of substrates tends to be a strategy to inhibit the function of RING E3 ubiquitin ligase and the PRY domain related to RNA binding. 35 However, research on targeting TRIM47 as a treatment is still to be reported. Therefore, TRIM47 is a promising candidate for drug development. Exploiting small‐molecule inhibitors that bind to the substrate binding domain competitively or to find some non‐coding RNA to inhibit TRIM47 specifically is a potential strategy. According to the quoted research, we can combine reagents targeting TRIM47 and reagents targeting vimentin to treat experimental animals for further drug utilization research and seek out whether a combination of treatments is able to suppress metastasis in hypopharyngeal and laryngeal cancers.
AUTHOR CONTRIBUTIONS
Shichao Qin: Writing – original draft; writing – review and editing. Fen Chang: Writing – review and editing. Xiangkai Sun: Writing – review and editing. Zinan Li: Writing – review and editing. Yin Wang: Writing – review and editing. Dapeng Lei: Funding acquisition; writing – review and editing.
FUNDING INFORMATION
The study was funded by the National Natural Science Foundation of China (No. 82071918), the National Natural Science Foundation of China (No. 82471149) and the Natural Science Foundation of Shandong Province (ZR2021QC062).
CONFLICT OF INTEREST STATEMENT
The author declares no conflict of interest.
ETHICS STATEMENT
Approval of the research protocol by an Institutional Reviewer Board: This study was performed in line with the principles of the Declaration of Helsinki. This study was approved by the ethics committee of Qilu Hospital of Shandong University (ethical approval number: KYLL‐2020(KS)‐320).
Informed Consent: Clinical hypopharyngeal cancer samples were obtained from Qilu Hospital of Shandong University (Jinan, Shandong, China). All patients provided informed consent.
Registry and the Registration No. of the study/trial: N/A.
Animal Studies: The animal testing procedures have been approved by the Code of Ethics and reviewed and implemented according to the guidelines of the Animal Care and Use Committee of The First Clinical Medical School, Shandong University (number: KYLL‐2023(ZM)‐150).
Supporting information
Table S1.
ACKNOWLEDGMENTS
This work was supported by the National Natural Science Foundation of China (No. 82071918), the National Natural Science Foundation of China (No. 82471149) and the Natural Science Foundation of Shandong Province (ZR2021QC062).
Qin S, Chang F, Sun X, Li Z, Wang Y, Lei D. TRIM47 promotes hypopharyngeal and laryngeal cancers progression through promoting K63‐linked ubiquitination of vimentin. Cancer Sci. 2025;116:367‐380. doi: 10.1111/cas.16397
DATA AVAILABILITY STATEMENT
All data generated or analyzed during this study are included in this published article or its supplementary information.
REFERENCES
- 1. Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209‐249. [DOI] [PubMed] [Google Scholar]
- 2. Chow LQM. Head and neck cancer. N Engl J Med. 2020;382(1):60‐72. [DOI] [PubMed] [Google Scholar]
- 3. Cramer JD, Burtness B, Le QT, Ferris RL. The changing therapeutic landscape of head and neck cancer. Nat Rev Clin Oncol. 2019;16(11):669‐683. [DOI] [PubMed] [Google Scholar]
- 4. Osman AA, Arslan E, Bartels M, et al. Dysregulation and epigenetic reprogramming of NRF2 signaling Axis promote Acquisition of Cisplatin Resistance and Metastasis in head and neck squamous cell carcinoma. Clin Cancer Res. 2023;29(7):1344‐1359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Echevarria MI, Yang GQ, Chen DT, et al. Phase 1 dose escalation of stereotactic body radiation therapy and concurrent cisplatin for Reirradiation of Unresectable, recurrent squamous cell carcinoma of the head and neck. Int J Radiat Oncol Biol Phys. 2023;117(2):341‐347. [DOI] [PubMed] [Google Scholar]
- 6. Huang N, Sun X, Li P, et al. TRIM family contribute to tumorigenesis, cancer development, and drug resistance. Exp Hematol Oncol. 2022;11(1):75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Azuma K, Ikeda K, Suzuki T, Aogi K, Horie‐Inoue K, Inoue S. TRIM47 activates NF‐kappaB signaling via PKC‐epsilon/PKD3 stabilization and contributes to endocrine therapy resistance in breast cancer. Proc Natl Acad Sci USA. 2021;118(35):e2100784118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Wang Y, Liu C, Xie Z, Lu H. Knockdown of TRIM47 inhibits breast cancer tumorigenesis and progression through the inactivation of PI3K/Akt pathway. Chem Biol Interact. 2020;317:108960. [DOI] [PubMed] [Google Scholar]
- 9. Liang Q, Tang C, Tang M, Zhang Q, Gao Y, Ge Z. TRIM47 is up‐regulated in colorectal cancer, promoting ubiquitination and degradation of SMAD4. J Exp Clin Cancer Res. 2019;38(1):159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Li L, Yu Y, Zhang Z, et al. TRIM47 accelerates aerobic glycolysis and tumor progression through regulating ubiquitination of FBP1 in pancreatic cancer. Pharmacol Res. 2021;166:105429. [DOI] [PubMed] [Google Scholar]
- 11. Liu F, Xie B, Ye R, et al. Overexpression of tripartite motif‐containing 47 (TRIM47) confers sensitivity to PARP inhibition via ubiquitylation of BRCA1 in triple negative breast cancer cells. Oncogene. 2023;12(1):13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Nijkamp MM, Span PN, Hoogsteen IJ, van der Kogel AJ, Kaanders JH, Bussink J. Expression of E‐cadherin and vimentin correlates with metastasis formation in head and neck squamous cell carcinoma patients. Radiother Oncol. 2011;99(3):344‐348. [DOI] [PubMed] [Google Scholar]
- 13. Maseki S, Ijichi K, Tanaka H, et al. Acquisition of EMT phenotype in the gefitinib‐resistant cells of a head and neck squamous cell carcinoma cell line through Akt/GSK‐3beta/snail signalling pathway. Br J Cancer. 2012;106(6):1196‐1204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Chang WH, Chen YJ, Hsiao YJ, et al. Reduced symmetric dimethylation stabilizes vimentin and promotes metastasis in MTAP‐deficient lung cancer. EMBO Rep. 2022;23(8):e54265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. You H, Yuan D, Bi Y, et al. Hepatitis B virus X protein promotes vimentin expression via LIM and SH3 domain protein 1 to facilitate epithelial‐mesenchymal transition and hepatocarcinogenesis. Cell Commun Signal. 2021;19(1):33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Zhou C, Zhang Z, Zhu X, et al. N6‐Methyladenosine modification of the TRIM7 positively regulates tumorigenesis and chemoresistance in osteosarcoma through ubiquitination of BRMS1. EBioMedicine. 2020;59:102955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Shen J, Yang H, Qiao X, et al. The E3 ubiquitin ligase TRIM17 promotes gastric cancer survival and progression via controlling BAX stability and antagonizing apoptosis. Cell Death Differ. 2023;30(10):2322‐2335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Chen JX, Xu D, Cao JW, et al. TRIM47 promotes malignant progression of renal cell carcinoma by degrading P53 through ubiquitination. Cancer Cell Int. 2021;21(1):129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Zhang Y, Feng Y, Ji D, et al. TRIM27 functions as an oncogene by activating epithelial‐mesenchymal transition and p‐AKT in colorectal cancer. Int J Oncol. 2018;53(2):620‐632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Chen L, Li M, Li Q, Xu M, Zhong W. Knockdown of TRIM47 inhibits glioma cell proliferation, migration and invasion through the inactivation of Wnt/beta‐catenin pathway. Mol Cell Probes. 2020;53:101623. [DOI] [PubMed] [Google Scholar]
- 21. Li L, Zhang S, Wei L, et al. Anti‐fibrotic effect of melittin on TRIM47 expression in human embryonic lung fibroblast through regulating TRIM47 pathway. Life Sci. 2020;256:117893. [DOI] [PubMed] [Google Scholar]
- 22. Zhu G, Herlyn M, Yang X. TRIM15 and CYLD regulate ERK activation via lysine‐63‐linked polyubiquitination. Nat Cell Biol. 2021;23(9):978‐991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Tang J, Luo Y, Tian Z, et al. TRIM11 promotes breast cancer cell proliferation by stabilizing estrogen receptor alpha. Neoplasia. 2020;22(9):343‐351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Hatakeyama S. TRIM family proteins: roles in autophagy, immunity, and carcinogenesis. Trends Biochem Sci. 2017;42(4):297‐311. [DOI] [PubMed] [Google Scholar]
- 25. Li Q, Yan J, Mao AP, et al. Tripartite motif 8 (TRIM8) modulates TNFalpha‐ and IL‐1beta‐triggered NF‐kappaB activation by targeting TAK1 for K63‐linked polyubiquitination. Proc Natl Acad Sci USA. 2011;108(48):19341‐19346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Zhou SQ, Feng P, Ye ML, et al. The E3 ligase NEURL3 suppresses epithelial‐mesenchymal transition and metastasis in nasopharyngeal carcinoma by promoting vimentin degradation. J Exp Clin Cancer Res. 2024;43(1):14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Pang K, Park J, Ahn SG, et al. RNF208, an estrogen‐inducible E3 ligase, targets soluble Vimentin to suppress metastasis in triple‐negative breast cancers. Nat Commun. 2019;10(1):5805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Cheng F, Shen Y, Mohanasundaram P, et al. Vimentin coordinates fibroblast proliferation and keratinocyte differentiation in wound healing via TGF‐beta‐slug signaling. Proc Natl Acad Sci USA. 2016;113(30):E4320‐E4327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Wang PW, Wu TH, Lin TY, Chen MH, Yeh CT, Pan TL. Characterization of the roles of Vimentin in regulating the proliferation and migration of HSCs during hepatic Fibrogenesis. Cells. 2019;8(10):1184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Li Z, Feng M, Zhang J, et al. WD40 repeat 43 mediates cell survival, proliferation, migration and invasion via vimentin in colorectal cancer. Cancer Cell Int. 2021;21(1):418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Xing Z, Su A, Mi L, et al. Withaferin a: a dietary supplement with promising potential as an anti‐tumor therapeutic for cancer treatment ‐ pharmacology and mechanisms. Drug Des Devel Ther. 2023;17:2909‐2929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Dhami J, Chang E, Gambhir SS. Withaferin a and its potential role in glioblastoma (GBM). J Neuro‐Oncol. 2017;131(2):201‐211. [DOI] [PubMed] [Google Scholar]
- 33. Wu KJ, Zeng J, Zhu GD, et al. Silibinin inhibits prostate cancer invasion, motility and migration by suppressing vimentin and MMP‐2 expression. Acta Pharmacol Sin. 2009;30(8):1162‐1168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Flaig TW, Gustafson DL, Su LJ, et al. A phase I and pharmacokinetic study of silybin‐phytosome in prostate cancer patients. Investig New Drugs. 2007;25(2):139‐146. [DOI] [PubMed] [Google Scholar]
- 35. D'Amico F, Mukhopadhyay R, Ovaa H, Mulder MPC. Targeting TRIM proteins: a quest towards drugging an emerging protein class. Chembiochem. 2021;22(12):2011‐2031. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1.
Data Availability Statement
All data generated or analyzed during this study are included in this published article or its supplementary information.
