Inotodiol Attenuates Mucosal Inflammation in a Mouse Model of Eosinophilic Chronic Rhinosinusitis

Abstract

Purpose

Inotodiol (22-hydroxy lanosterol), a unique component of chaga mushrooms, is believed to be a medicinal component with reported antitumor, antiviral, and anti-inflammatory properties. This study evaluated the therapeutic potential and underlying mechanisms of inotodiol in eosinophilic chronic rhinosinusitis (ECRS).

Methods

An ECRS mouse model was established using female BALB/c mice. Forty mice were categorized into 4 groups: the control group (n = 10), ECRS group treated with solvent (n = 10), ECRS group treated with inotodiol 20 mg/kg (n = 10), and ECRS group treated with dexamethasone 10 mg/kg (n = 10). The nasal lavage fluid and tissue samples from mice were analyzed for cytokine and chemokine expression as well as for the severity of mucosal inflammation. Enzyme-linked immunosorbent assay, quantitative reverse transcription-polymerase chain reaction, histopathological staining, and immunofluorescence techniques were employed. The human eosinophil cell line (EoL-1) and dispersed nasal polyp cells (DNPCs) were used to assess inotodiol-induced eosinophil apoptosis in vitro via immunofluorescence, flow cytometry, and proteome profiler antibody array analysis.

Results

Inotodiol significantly reduced the secretion of T2 cytokine and mast cell tryptase as well as the expression of Th cytokines, chemokines, and proinflammatory/inflammatory cytokines in ECRS mice. Furthermore, it suppressed mucosal inflammatory features such as polyp formation, epithelial thickening, and eosinophil infiltration. Inotodiol treatment reduced mast cell activation and increased eosinophil apoptosis in the nasal mucosa of ECRS mice. Notably, inotodiol also induced apoptosis in EoL-1 cells and DNPCs, which may contribute to its anti-inflammatory effects.

Conclusions

Inotodiol could be a potential therapeutic agent for ECRS by modulating immune responses and reducing mucosal inflammation.

INTRODUCTION

Chronic rhinosinusitis (CRS) is a prevalent inflammatory condition of the sinonasal cavity, affecting 5%–12% of adults worldwide with its prevalence being approximately 8.4% in Korea.¹,² Although the precise etiology of CRS remains unclear, there are several immunological pathways implicated in its pathogenesis, including type 1–3 immune responses which involve T helper cells and corresponding innate lymphocytes.³ Despite shared clinical symptoms, CRS exhibits diverse cytokine profiles, suggesting that distinct pathogenic pathways can be involved in similar presentations.⁴,⁵ CRS is categorized into CRS with nasal polyps (CRSwNP) and CRS without nasal polyps, with eosinophilic CRS (ECRS) representing a subtype of CRSwNP. ECRS is characterized by type 2 inflammation, notable eosinophilic infiltration, and persistent, refractory symptoms.⁵,⁶ This form of CRS is associated with a poor prognosis and is often observed as an intrinsic subtype in Western cases of CRSwNP.⁶ Currently, treatment options for ECRS primarily include intranasal or systemic corticosteroids.⁷ However, achieving effective symptom control is challenging due to corticosteroid-related side effects, so numerous patients eventually require surgical intervention, with high rates of polyp recurrence.⁴,⁷ Recently, biologic therapies, such as omalizumab and dupilumab, have shown promising results, improving symptom and endoscopic scores in ECRS patients, and raising hopes for definitive treatment.⁸

The chaga mushroom (Inonotus obliquus), traditionally used in folk medicine for treating various ailments, contains polysaccharides, triterpenes, and polyphenols which are known for their diverse biological effects.^{9 – 12} Inotodiol (22-hydroxy lanosterol), a lanostane-type triterpenoid unique to the chaga mushroom, is considered its primary medicinal component with reported antitumor, antiviral, and anti-inflammatory properties.^{13 – 16} In vitro studies have shown that inotodiol exerts antiproliferative effects by inducing apoptosis through caspase-3 activation in mouse leukemia P388 cells.¹⁴ However, few studies have investigated the therapeutic potential of inotodiol in ECRS. This study evaluated the therapeutic effects of inotodiol in a mouse model of ECRS and elucidated its underlying mechanisms.

MATERIALS AND METHODS

Development of staphylococcal enterotoxin B (SEB)-induced mouse model of ECRS

Four-week-old female BALB/c mice were obtained from Orient Bio Laboratory (Seongnam, Korea). All animal experiments were approved by the Institutional Animal Care and Use Committee of Chungnam National University (approval no. 021-A0012). The CRS mouse model was developed as previously described (Fig. 1).¹⁷,¹⁸ Forty mice were categorized into 4 groups: (1) control mice treated with phosphate-buffered saline (PBS) (CON, n = 10); (2) nasal polyp (NP) mice treated with solvent (Tween 80% + NaCl 0.9%) (NP, n = 10); (3) NP mice treated with inotodiol (NP + Ino, n = 10); and (4) NP mice treated with dexamethasone (NP + Dex, n = 10). The NP, NP + Ino, and NP + Dex groups received intraperitoneal injections of 20-µL solvent, 20 mg/kg inotodiol, and 10 mg/kg dexamethasone, respectively, from weeks 8 to 12 (Fig. 1). The treatment duration, frequency, and dosing were based on established protocols from previous studies.^{17 – 20}

Fig. 1. Experimental protocol for developing a murine model of eosinophilic chronic rhinosinusitis with nasal polyposis. Mice were intraperitoneally sensitized on days 0 and 5 with either 2 mg of aluminum hydroxide alone or 2 mg of aluminum hydroxide combined with 25 mg of OVA, followed by intranasal challenge with 3% OVA 5 times in week 3. The mice received 3% OVA and SEB from weeks 4 to 8, and from weeks 8 to 12, respectively, intranasally 3 times a week. Forty mice were divided into 4 groups: the CON group (n = 10), NP group (Tween 80% + 0.9% NaCl, n = 10), NP + Ino (n = 10), and NP + Dex group (n = 10). The CON group received phosphate-buffered saline instead of OVA, SEB, inotodiol, or dexamethasone. The NP, NP + Ino, and NP + Dex groups received intraperitoneal injections of 20 µL of solvent, 20 mg/kg inotodiol, and 10 mg/kg dexamethasone, respectively, from weeks 8 to 12.

OVA, ovalbumin; SEB, staphylococcal enterotoxin B; I.N., intranasal; I.P, intraperitoneal; CON, control group; NP, nasal polyp with solvent treatment group; NP + Ino, nasal polyp with inotodiol treatment group; NP + Dex, nasal polyp with dexamethasone treatment group.

Preparation of mouse tissues

To collect nasal lavage fluid (NLF), the trachea was surgically exposed and partially incised under deep anesthesia. A 24G intravenous catheter (Becton-Dickinson, Sandy, UT, USA) was inserted through the posterior choana via the tracheal incision. Then, the nasal cavities were gently lavaged twice with 350 µL of chilled PBS, and the fluid was collected from the nostrils and centrifuged for analysis.

For protein and RNA extraction (n = 5 mice per group), the nasal mucosa was carefully dissected under a microscope using a small curette and microforceps. The remainder of the sample was preserved in 4% paraformaldehyde for 2 days (n = 5 mice per group). The specimens were then decalcified in 1 M ethylenediaminetetraacetic acid (pH 8.0) for 2 weeks at room temperature. After decalcification, the samples were embedded in paraffin and coronally sectioned to a thickness of 4 μm, approximately 5 mm from the nasal vestibule, using a microtome (Leica, Wetzlar, Germany).

Enzyme-linked immunosorbent assay (ELISA)

NLF samples from each mouse or protein extracts from dispersed NP cells (DNPCs) were analyzed for mouse interleukin (IL)-4 (M400B; R&D Systems, Minneapolis, MN, USA), IL-5 (DY405; R&D Systems), IL-13 (DY213; R&D Systems), and mast cell tryptase (MCT, M1000B; R&D Systems) using ELISA, according to the manufacturer’s instructions. Sample absorbance was measured at 450 nm with a microplate reader.

Quantitative reverse transcriptase-polymerase chain reaction

Total RNA was extracted from the nasal mucosa of each mouse using TRIzol™ reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Subsequently, 2 μg of total RNA was reverse-transcribed into complementary DNA using the SuperScript First-Strand Synthesis System (Invitrogen) according to the manufacturer’s instructions. The mRNA levels were analyzed on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) with the Power SYBR® Green PCR Master Mix (Life Technologies Ltd., Warrington, UK). Primer sets were designed using the Primer3 program,²¹ and primers were procured from GenoTech (Daejeon, Korea). Table 1 presents the primer sequences used in this study.

Table 1. Details of the oligonucleotide sequences for quantitative reverse transcriptase-polymerase chain reaction.

Gene	5’ → 3’	Mouse
IL-4	Forward	ATCATCGGCATTTTAACGAGGTC
	Reverse	ACCTTGGAAGCCCTACAGACGA
IL-5	Forward	ATGGAGATTCCCATGAGCAC
	Reverse	CCCACGGACAGTTTGATTCT
IL-10	Forward	ATAACTGCACCCACTTCCCA
	Reverse	GGGCATCACTTCTACCAGGT
IL-13	Forward	CAGCATGGTATGGAGTGTGG
	Reverse	TGGGCTACTTCGATTTTGGT
IL-17A	Forward	TCCAGAAGGCCCTCAGACTA
	Reverse	AGCATCTTCTCGACCCTGAA
IFN-γ	Forward	ACTGGCAAAAGGATGGTGAC
	Reverse	TGAGCTCATTGAATGCTTGG
IL-6	Forward	TACCACTCCCAACAGACCTG
	Reverse	ACTCCAGAAGACCAGAGGAA
IL-1β	Forward	ACTCATTGTGGCTGTGGAGA
	Reverse	TTGTTCATCTCGGAGCCTGT
IL-25	Forward	ACCACAACCAGACGGTCTTC
	Reverse	AGCCAAGGAGACTCGGTAGA
IL-33	Forward	GCTGCGTCTGTTGACACATT
	Reverse	GACTTGCAGGACAGGGAGAC
CCL1	Forward	AGCATGCTTACGGTCTCCAA
	Reverse	CGTTTTGTTAGTTGAGGCGC
CCL2	Forward	AGGTGTCCCAAAGAAGCTGT
	Reverse	ACAGAAGTGCTTGAGGTGGT
CXCL2	Forward	TGAACTGCGCTGTCAATGC
	Reverse	GCTTCAGGGTCAAGGCAAAC

IL, interleukin; IFN, interferon; CCL, C-C motif chemokine ligand; CXCL2, chemokine (C-X-C motif) ligand 2.

Histopathological analysis of sinonasal cavity

Paraffin sections of the mouse head were stained with hematoxylin and eosin (H&E, ab245880; Abcam, Cambridge, UK), Congo red (amyloid stain, ab150663; Abcam), reagents from a periodic acid-Schiff kit (ab150680; Abcam), and toluidine blue (#198161; Sigma-Aldrich, St. Louis, MO, USA) according to the respective manufacturer’s protocols. Ten mucosal areas in the maxillary sinus or the lateral nasal cavity wall were randomly selected, and lesions were evaluated under high-power fields (400×) by 2 blinded examiners. The numbers of polyps, eosinophils, goblet cells, and mast cells, along with epithelial thickness, were assessed using the CaseViewer program (v. 1.15.3; 3DHISTECH Ltd., Budapest, Hungary).

Immunofluorescence staining

Following deparaffinization and antigen retrieval, sections were incubated in a solution blocking streptavidin and biotin for 1 h (Vector Laboratories, Burlingame, CA, USA). They were stained with primary antibodies for MCT (#MA5-38007; ThermoFisher Scientific, Waltham, MA, USA), cleaved caspase-3 (#9669; Cell Signaling, Danvers, MA, USA), major basic protein (MBP, #PA5-102628; Thermo Fisher Scientific), and Siglec-F (#14-1702-82, eBioscience™). Alexa Fluor 488-conjugated anti-mouse IgG and Alexa Fluor 594-conjugated anti-rabbit IgG (Invitrogen) were used as secondary antibodies. Nuclear counterstaining was performed with 4′,6-diamidino-2-phenylindole at a concentration of 300 nM (Invitrogen). The slides were examined using a fluorescence microscope (Leica).

Flow cytometry-based apoptosis assay

Peripheral blood mononuclear cells (PBMCs) were isolated from the peripheral blood of CRS patients under Institutional Review Board (IRB) approval (IRB No: 2023-10-071, Chungnam University Hospital, Daejeon, South Korea) using gradient centrifugation with an equal volume of Ficoll-Paque™ PLUS (#17-140-09; GE Healthcare, Chicago, IL, USA). After plating on 12-well plates, PBMCs were treated with 2 mL of solvent, inotodiol (5 and 10 µg/mL), or dexamethasone (0.5 and 1 µM) and incubated at 37°C with 5% CO₂ for 1 day. The cells were subsequently harvested and stained with FITC-labeled annexin V and propidium iodide (BD Biosciences, San Jose, CA, USA) according to the manufacturer’s instructions. Flow cytometric analysis was performed within 1 h of harvesting using a NovoCyte Flow cytometer (Oyster; Agilent Technologies, Inc., Santa Clara, CA, USA). Data were analyzed with NovoExpress software (BD Biosciences).

Culture of human eosinophil cell line (EoL-1)

The human eosinophil cell line EoL-1, obtained from Sigma-Aldrich, was cultured in RPMI medium (GenDEPOT, Katy, TX, USA) and differentiated into mature eosinophils through stimulation with butyric acid (#19215; Sigma-Aldrich). After 2 days, eosinophils exhibited typical morphology, including a bilobed nucleus and highly condensed chromatin. Cell morphology was assessed under a microscope (400×) following a 1-day treatment with inotodiol (5 and 10 µg/mL) and dexamethasone (1 µM).

Proteome profiler antibody array analysis

Proteins were isolated from EoL-1 cells using RIPA lysis buffer (iNtRON, Kirkland, WA, USA). A membrane-based sandwich immunoassay was conducted using the Proteome Profiler Human XL Cytokine Array Kit (#ARY022B; R&D Systems) according to the manufacturer’s instructions. Each membrane was incubated overnight at 4°C with 100 μL of pooled supernatant. Captured proteins were detected using biotinylated antibodies and visualized with streptavidin-horseradish peroxidase and chemiluminescent detection reagents. Each capture spot produced a signal proportional to the amount of bound protein. Band intensities were analyzed using Quick Spots Image Analysis Software (Western Vision Software, http://www.wvision.com/QuickSpots.html).²²

DNPC culture

Between September and December 2023, 19 CRSwNP patients were enrolled in the study (Table 2; IRB No: 2023-10-071). All patients provided written informed consent prior to enrollment. The diagnosis of sinus disease was based on the criteria outlined in European Position Paper on Rhinosinusitis and Nasal Polyps 2020 (EPOS 2020).² Enrolled patients were excluded if they had taken oral or nasal corticosteroids, antibiotics, or antileukotrienes within 4 weeks prior to sample collection, or if they had experienced recent upper respiratory tract infections or were undergoing revision sinus surgery.

Table 2. Patient characteristics.

Groups	Non-ECRS (n = 8)	ECRS (n = 11)
Sex (male)	8 (100.0)	8 (72.7)
Age (yr)	50.2 ± 21	46.8 ± 12
Asthma	1 (12.5)	3 (27.2)
Atopy	4 (50.0)	7 (63.6)
Smoking	3 (37.5)	3 (27.2)
Lund-Mackay CT score	12.5 ± 4.92	13.7 ± 4.87

Values are presented as number (%) or mean ± standard deviation.

ECRS, eosinophilic chronic rhinosinusitis; CT, computed tomography.

NP tissues were obtained from patients undergoing endoscopic sinus surgery for CRSwNP. The collected NPs were stored on ice before the experiments were conducted. Paraffin sections of the NPs were prepared, and H&E staining was performed to differentiate between ECRS and non-ECRS while culturing DNPCs. The slides were examined under 400× magnification, and eosinophil counts were recorded in 5 randomly selected high-power fields. ECRS was defined as an eosinophil count exceeding 70 per high-power field.

NPs were chopped into small pieces in DMEM containing 1× collagenase/hyaluronidase (#07912; STEMCELL, Vancouver, Canada) and 1 μg/mL DNase (Sigma-Aldrich). The minced tissue was gently dissociated in a rotary shaker at 37°C until all tissue fragments were digested. The resulting cell suspension was filtered through a 70-μm cell strainer (SPL, Pocheon, Korea) to remove any undigested tissue. The cell pellet was then resuspended in RPMI 1640 medium supplemented with 10% fetal bovine serum and a mixture of penicillin G (10,000 U/mL) + streptomycin (10,000 μg/mL) + amphotericin B (25 μg/mL). After stabilization in a 5% CO₂ atmosphere at 37°C for 2 h, DNPCs were treated with 0.5 μg/mL SEB or PBS and incubated for 1 h. Subsequently, 10 μg/mL inotodiol was added, and the cells were cultured for an additional 20 h. DNPCs were analyzed for eosinophil apoptosis and IL-13 production using immunofluorescence and ELISA, respectively.

Statistical analysis

Results were analyzed using GraphPad Prism software (v5.0; GraphPad Software Inc., La Jolla, CA, USA). Data are expressed as the mean ± standard error of the mean. Differences among groups were assessed using one-way analysis of variance followed by Tukey’s multiple comparison test. Data normality was evaluated using the D'Agostino–Pearson omnibus normality test as appropriate. Statistical significance was set at P < 0.05, with significance levels defined as follows: P < 0.05, P < 0.01, P < 0.001, and P < 0.0001.

RESULTS

Effects of inotodiol treatment on NLF levels of T2 cytokines and MCT

T2 cytokines, including IL-4, IL-5, and MCT, in the NLF were examined using ELISA (Fig. 2). The concentrations of IL-4, IL-5, and MCT were significantly elevated in the NP group compared to the CON group (P < 0.001 for all), the NP + Inotodiol (NP + Ino) group (P < 0.001 for all), and the NP + Dexamethasone (NP + Dex) group (P < 0.001 for IL-4 and MCT, P < 0.01 for IL-5). These results suggest that inotodiol treatment may effectively suppresses the secretion of T2 cytokines and the degranulation of mast cells in mice with ECRS.

Fig. 2. Comparison of IL-4, IL-5, and MCT production in the nasal lavage fluid between the experimental groups. (A–C) Levels of IL-4 (A), IL-5 (B), and MCT (C) were measured using enzyme-linked immunosorbent assay (n = 8). The NP group showed significantly higher levels of IL-4, IL-5, and MCT than in the control, NP + Ino, and NP + Dex groups.

IL, interleukin; CON, control group; NP, nasal polyp with solvent treatment group; NP + Ino, nasal polyp with inotodiol treatment group; NP + Dex, nasal polyp with dexamethasone treatment group; MCT, mast cell tryptase.

^*P < 0.01, ^†P < 0.001.

Inotodiol treatment suppresses mRNA expression of Th cytokines, proinflammatory cytokines, epithelium-derived innate cytokines, and chemokines in the nasal mucosa

The expression levels of T2 cytokines, including IL-4, IL-5, IL-10, IL-13, IL-17A, and interferon (IFN)-γ, were significantly elevated in the NP group compared to the CON group (P < 0.0001 for IL-4, IL-10, IL-13, IL-17A, and IFN-γ; P < 0.001 for IL-5). Similar trends were observed in the NP + Ino group (P < 0.0001 for IL-4 and IL-13; P < 0.001 for IL-10 and IFN-γ; P < 0.01 for IL-5 and IL-17A) and the NP + Dex group (P < 0.0001 for IL-4, IL-10, IL-13, and IFN-γ; P < 0.001 for IL-5; P < 0.05 for IL-17A) (Fig. 3A-F). Additionally, the expression levels of IL-6, IL-1β, IL-25, and IL-33 were significantly higher in the NP group than in the CON group (P < 0.0001 for IL-25; P < 0.001 for IL-6; P < 0.01 for IL-1β and IL-33), as well as the NP + Ino group (P < 0.0001 for IL-25; P < 0.001 for IL-6; P < 0.01 for IL-1β and IL-33) and the NP + Dex group (P < 0.0001 for IL-25; P < 0.001 for IL-6 and IL-33; P < 0.01 for IL-1β) (Fig. 3G-J). The expression of C-C motif chemokine ligand (CCL)1, CCL2, and chemokine (C-X-C motif) ligand 2 was also significantly higher in the NP group than in the CON group (P < 0.0001 for all), NP + Ino group (P < 0.0001 for all), and NP + Dex group (P < 0.0001 for all) (Fig. 3K-M). These findings indicate that inotodiol treatment can suppress the expression of T2 cytokines, chemokines, and pro-inflammatory and inflammatory cytokines in ECRS mice.

Fig. 3. Comparison of the mRNA expression of cytokines and chemokines in the nasal mucosa between experimental groups. (A–F) The expression levels of IL-4, IL-5, IL-10, IL-13, IL-17A, and IFN-γ were significantly higher in the NP group than in the CON, NP + Ino, and NP + Dex groups. (G–J) Similarly, the expression of IL-6, IL-1β, IL-25, and IL-33 was significantly elevated in the NP group compared to the CON, NP + Ino, and NP + Dex groups. (K–M) The expression of chemokines, including CCL1, CCL2, and CXCL2, was also significantly higher in the NP group than in the CON, NP + Ino, and NP + Dex groups.

IL, interleukin; CON, control group; NP, nasal polyp with solvent treatment group; NP + Ino, nasal polyp with inotodiol treatment group; NP + Dex, nasal polyp with dexamethasone treatment group; IFN, interferon; CCL, C-C motif chemokine ligand; CXCL2, chemokine (C-X-C motif) ligand 2.

^*P < 0.05, ^†P < 0.01, ^‡P < 0.001, ^§P < 0.0001.

Inotodiol treatment attenuates mucosal inflammation in the nasal cavity of ECRS mice

The number of polyps, epithelial thickening, and eosinophil counts were compared between the groups using H&E staining. The number of polyps in the nasal cavity was significantly lower in the NP + Dex group (P < 0.05) and the CON group (P < 0.01) than in the NP group (Fig. 4A and B). However, no significant difference was observed between the NP and NP + Ino groups. Epithelial thickness was significantly reduced in the NP + Ino (P < 0.0001) and NP + Dex (P < 0.0001) groups compared to the NP group (Fig. 4C and D). The eosinophil infiltration in the nasal mucosa was also significantly lower in the NP + Ino (P < 0.01) and NP + Dex (P < 0.01) groups than in the NP group (Fig. 4E and F). Additionally, the number of goblet cells was significantly reduced in the NP + Ino (P < 0.0001) and NP + Dex (P < 0.0001) groups compared to the NP group (Fig. 4G and H). These results demonstrate that inotodiol treatment can effectively suppress mucosal inflammation in ECRS mice.

Fig. 4. Histopathologic analysis of the sinonasal mucosa across experimental groups. (A) Representative images of H&E staining, with polyp counts indicated by asterisks, in the sinonasal cavity for each group. (B) The number of polyps in the nasal cavity was significantly lower in the NP + Dex and CON groups than in the NP group. (C) Epithelial thickness was evaluated using H&E staining. (D) Epithelial thickness in the sinonasal mucosa was significantly reduced in the NP + Ino and NP + Dex groups compared to the NP group. (E) Eosinophil infiltration (arrowheads) in the sinonasal mucosa was assessed using Congo red staining. (F) The number of infiltrated eosinophils in the nasal mucosa was significantly lower in the NP + Ino and NP + Dex groups than in the NP group. (G) Goblet cells in the sinonasal epithelium were examined using periodic acid-Schiff staining. (H) The number of goblet cells was significantly reduced in the NP + Ino and NP + Dex groups compared to the NP group. (I) The morphology and degranulation of mast cells were evaluated using toluidine blue staining, revealing both degranulation and activation in the NP group. (J) Representative immunofluorescence images of mast cell tryptase in each group. (K) Tryptase expression was significantly higher in the NP group than in the NP + Ino and NP + Dex groups. Scale bar: 50 μm.

CON, control group; NP, nasal polyp with solvent treatment group; NP + Ino, nasal polyp with inotodiol treatment group; NP + Dex, nasal polyp with dexamethasone treatment group; H&E, hematoxylin and eosin.

^*P < 0.05, ^†P < 0.01, ^‡P < 0.0001.

Next, we examined mast cells in the nasal mucosa using toluidine blue staining. Mast cell degranulation was more pronounced in the NP group than in the other groups, although the total number of mast cells did not differ between the groups (Fig. 4I). Mast cell degranulation was further evaluated through immunofluorescence staining using tryptase which is released by activated mast cells. The expression of tryptase was significantly increased in the NP group compared to the NP + Ino group (P < 0.01) and the NP + Dex group (P < 0.001) (Fig. 4J and K). Overall, these findings indicate that inotodiol treatment may suppress mast cell degranulation and activation in ECRS mice.

Inotodiol treatment induces eosinophil apoptosis

The percentage of apoptotic cells was significantly increased in the PBMCs treated with 1 µM dexamethasone (Fig. 5A and B). However, the percentage of apoptotic cells did not significantly differ between the inotodiol-treated PBMCs and the CON group treated with medium alone (Fig. 5B). The lactate dehydrogenase assay demonstrated no cytotoxicity at the indicated concentrations of inotodiol or dexamethasone in PBMCs (Fig. 5C).

Fig. 5. Effects of inotodiol treatment on eosinophil apoptosis. (A) Apoptosis in PBMCs treated with inotodiol was measured via flow cytometric analysis using FITC annexin V staining. (B) The number of apoptotic cells was significantly higher only in the PBMCs treated with Dex. (C) Toxicity of the reagents was assessed based on LDH release in the supernatant; no significant differences in LDH release percentages were observed between the groups. (D) EoL-1 cells were stimulated with BA (1 mM) for 24 h, followed by inotodiol treatment (5 and 10 μg/mL) or Dex (1 μM) for an additional 24 h. Morphological changes in eosinophils were observed using H&E staining, revealing increased cytoplasmic blebbing and nuclear fragmentation in inotodiol- and Dex-treated eosinophils (arrowheads). (E) Proteome profiler analysis demonstrated that the expression of pro-apoptotic and apoptotic signaling pathway molecules, including cleaved caspase 3, was significantly increased in EoL-1 cells treated with inotodiol (10 µg/mL) compared to those treated with media alone. (F) Expression of cleaved caspase 3 in eosinophils was examined in the nasal mucosa of mice with eosinophilic chronic rhinosinusitis using a double immunofluorescence assay. (G) The number of double-positive cells (cleaved caspase 3 and Siglec-F) was significantly higher in the NP + Ino and NP + Dex groups than in the NP group. Scale bar: 25 μm.

CON, control group; Dex, dexamethasone; BA, butyric acid; NP, nasal polyp with solvent treatment group; NP + Ino, nasal polyp with inotodiol treatment group; NP + Dex, nasal polyp with dexamethasone treatment group; DAPI, 4′,6-diamidino-2-phenylindole; PBMC, peripheral blood mononuclear cell; LDH, lactate dehydrogenase.

^*P < 0.05, ^†P < 0.01, ^‡P < 0.001, ^§P < 0.0001.

Next, we evaluated the influence of inotodiol on eosinophil apoptosis using the human eosinophil cell line EoL-1. Cell morphology was examined after H&E staining, revealing increased cytoplasmic blebbing and nuclear fragmentation in eosinophils treated with inotodiol and dexamethasone (Fig. 5D). Furthermore, the expression of molecules related to pro-apoptotic or apoptotic signaling pathways, including cleaved caspase 3, was significantly higher in EoL-1 cells treated with inotodiol (10 µg/mL) than in those treated with media alone (Fig. 5E). Finally, we examined the expression of cleaved caspase 3 in eosinophils in the nasal mucosae of ECRS mice using a double immunofluorescence assay. The number of double-positive cells (cleaved caspase 3 and Siglec-F) was significantly higher in the NP + Ino (P < 0.01) and NP + Dex (P < 0.0001) groups than in the NP group (Fig. 5F and G).

Finally, we examined the apoptotic effects of inotodiol on DNPC cultures. After stimulation with SEB for 1 h, the cells were treated with inotodiol for 24 h. The number of apoptotic eosinophils was significantly higher in inotodiol-treated DNPCs than in those treated with media alone (Fig. 6A and B). Furthermore, we measured IL-13 production in DNPC cultures after SEB stimulation and found it to be significantly suppressed in the inotodiol-treated DNPCs harvested from ECRS patients (Fig. 6C).

Fig. 6. Inotodiol treatment induced eosinophil apoptosis and suppressed IL-13 production in DNPCs from ECRS patients. (A) Representative immunofluorescence staining of DNPC cultures from ECRS patients showing DAPI (blue), cleaved caspase 3 (green), MBP (red), and signal overlay (yellow). (B) The graph depicts the percentage of apoptotic eosinophils (cleaved caspase 3 + MBP) in the MBP-positive stained area of each culture, indicating a significant increase in apoptotic eosinophils in inotodiol-treated DNPCs compared to those treated with media alone from ECRS patients (n = 5). (C) The production of IL-13 in the DNPC lysate was significantly suppressed in INO-treated DNPCs harvested from ECRS patients compared to those from non-ECRS patients. Scale bar: 50 μm. The P value was calculated using Fisher’s least significant difference method.

MBP, major basic protein; DAPI, 4′,6-diamidino-2-phenylindole; CON, solvent treatment; SEB, staphylococcus enterotoxin B; INO, inotodiol; IL, interleukin; ECRS, eosinophilic chronic rhinosinusitis; NECRS, non-eosinophilic chronic rhinosinusitis; DNPC, dispersed nasal polyp cell.

^*P < 0.05, ^†P < 0.01.

These results indicate that inotodiol may induce the apoptosis of differentiated eosinophils and potentially suppress mucosal inflammation in ECRS mice.

DISCUSSION

We previously reported the therapeutic efficacy of inotodiol in a mouse model of allergic rhinitis.¹⁹ In that study, inotodiol not only inhibited allergic symptoms, the production of specific IgE antibodies, the infiltration of eosinophils, and the degranulation of mast cells, but also suppressed the expression of cytokines associated with Th immune responses in the mucosa. Furthermore, its effects were comparable to those of dexamethasone, leading us to conduct experiments on ECRS mice, which exhibit a similar T2 immune response. We confirmed the therapeutic effects in this mouse model of ECRS.

The release of β-tryptase from secretory granules is a hallmark of mast cell degranulation and activation.²³,²⁴ Tryptase not only stimulates the release of the granulocyte chemoattractant IL-8 and upregulates intercellular adhesion molecule 1 on epithelial cells, but it also induces IL-1β mRNA expression, potentially facilitating the recruitment of inflammatory cells at the sites of mast cell activation.²⁴,²⁵,²⁶ In the present study, we found that inotodiol treatment significantly reduced the levels of MCT in both the NLF (Fig. 2C) and the nasal mucosa (Fig. 4J and K). These results align with our previous findings that inotodiol treatment inhibits mast cell activation in mice with allergic rhinitis.¹⁹

The anti-allergic and anti-inflammatory effects of inotodiol have been well documented in various disease models.²⁵,²⁶,²⁷,²⁸ The complexity of these effects, which cannot be solely attributed to the effect of inotodiol on mast cell activation, suggests that it may influence multiple immune pathways relevant to the pathogenesis of ECRS. Inotodiol has been shown to inhibit the activation of nuclear factor kappa-light-chain-enhancer of activated B cells, thereby reducing the transcription of genes involved in inflammation.²⁹ Additionally, inotodiol treatment effectively decreases levels of nitric oxide, reactive oxygen species, cyclooxygenase-2, and cytokines such as IL-1β, IL-6, and tumor necrosis factor-α.³⁰ Although we did not examine the transcription factors directly, we believe that the expression of IL-6 and IL-1β in the nasal mucosa is inhibited by inotodiol treatment through a similar mechanism.

The safety profile of inotodiol has been validated in previous studies.²⁰,²⁷,³⁰ One study demonstrated that inotodiol does not inhibit antigen-specific B- or T-cell immune responses in OVA-sensitized mice.²⁷ In a more recent study, the administration of 95% purity inotodiol (20 mg/kg) daily for 13 weeks in mice revealed no abnormalities in organs or mortality.²⁰ Inotodiol treatment neither affects lipid metabolism, alter hematological or biochemical parameters nor exhibits liver toxicity.²⁰ Our study further showed that, while the indicated concentration of dexamethasone increased apoptosis in PBMCs of patients with CRSwNP, inotodiol treatment did not induce apoptosis within the concentration range of 5–10 μg/mL (Fig. 5A and B).

Eosinophils differ biologically from many other immune cells and malignant cell lines in that they require external stimuli—such as granulocyte-macrophage colony-stimulating factor, IL-5, or IL-13—for survival; without such stimuli, they undergo spontaneous apoptosis within days.³¹,³² In this study, the evidence indicated that eosinophil apoptosis was increased in the nasal mucosa of CRS mice treated with inotodiol compared to those not treated with inotodiol. However, given that numerous factors are involved in eosinophil apoptosis and eosinophil survival and apoptosis mechanisms in tissue samples, it would be challenging to demonstrate the anti-apoptotic effect of inotodiol on eosinophils in vivo.

Apoptosis is marked by the activation of intracellular caspases, DNA cleavage, nuclear condensation and fragmentation, and plasma membrane blebbing.³³ This process results in the phagocytosis of cell fragments without triggering an inflammatory response.³⁴ Due to the microbiological complexity of eosinophils, culturing them successfully can be challenging, as maintaining their survival, growth, and function requires specific conditions. After repeated culturing, we determined that 24 h of butyric acid treatment was optimal for inducing differentiation into eosinophils and observing apoptosis (Fig. 5D). Furthermore, we found that inotodiol treatment of eosinophils differentiated from EoL-1 cells induced morphological changes and elevated the expression of cleaved caspase 3 (Fig. 5D and E). We also compared the expression of apoptosis-related proteins before and after inotodiol treatment, observing increased levels of cleaved caspase 3, TRAILR2, Fas, Bax, and phosphorylated p53 post-treatment (Fig. 5E).

Since apoptosis is essential for the clearance of eosinophils from tissues, delayed eosinophil apoptosis contributes to eosinophilic inflammation. Consequently, the absolute count of apoptotic eosinophils in mucosal biopsy specimens is inversely related to symptom severity.³⁵ In the present study, we observed an increase in the number of apoptotic eosinophils in the ECRS mouse groups treated with inotodiol (NP + Ino) and dexamethasone (NP + Dex) (Fig. 5F). Although we did not assess the correlation, we confirmed that mucosal inflammation markers, such as polyp count, epithelial thickening, and goblet cell hyperplasia, were reduced in these groups (Fig. 4).

Although the effects of inotodiol were confirmed in animal models and EoL-1 cells, we were interested in its effect in cells obtained from CRS patients. Therefore, additional experiments were conducted using DNPCs. Following inotodiol treatment, the expression of apoptosis-related molecules in the eosinophils of DNPCs was found to increase significantly (Fig. 6A). In this study, inotodiol did not affect the survival of non-activated eosinophils, but appeared to induce apoptosis in activated eosinophils. Since DNPCs may not accurately reflect eosinophil activity due to their instability in vitro, we believe that clinical trials involving actual patients would be necessary for observing the therapeutic effect of inotodiol in ECRS.

There are some limitations in this study. First, the ECRS animal model used does not fully capture the entire spectrum of ECRS disease. Future research should therefore include a variety of animal models to gain a more comprehensive understanding of ECRS. Secondly, studies involving eosinophils isolated directly from blood or tissues are needed, rather than relying solely on cell lines. Specifically, single-cell analysis focusing on gene expression changes in activated viable eosinophils within a controlled environment would offer valuable insights into the pathogenesis of ECRS. Thirdly, it is essential to investigate gene expression changes not only in eosinophils, but also in other cell types found in NPs, such as epithelial cells, innate lymphoid cells, and T cells. Finally, it is essential to develop safe preparations for human use and conduct clinical trials on actual patients, rather than on DNPCs.

In conclusion, the results of this study suggest that inotodiol could have a promising therapeutic potential for ECRS. Inotodiol appears to act at multiple levels of the immune response, suppressing T2 cytokines, mast cell activity, and eosinophilic inflammation, and it demonstrated good tolerability. Further studies are warranted to fully explore the therapeutic potential of inotodiol and its applicability in managing ECRS in humans.