Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2025 Feb 4;15:4167. doi: 10.1038/s41598-025-87225-y

Comparison evaluation of bacterial DNA extraction methods for improved molecular diagnostic accuracy of sepsis-causing pathogens in clinical whole blood samples

Byungjoon Na 1,#, Junghun Park 2,#, Sojin Park 1, Eunseon Park 1, Jimin Jang 1, Yu-Hee Kim 2,3, Jinyeop Lee 1,, Hae-Sun Chung 2,4,
PMCID: PMC11794844  PMID: 39905084

Abstract

Sepsis, a leading cause of mortality, requires rapid and accurate pathogen identification to ensure effective treatment. Current diagnostic methods such as blood cultures are time-consuming, whereas molecular diagnostic techniques represent a promising alternative for faster pathogen detection. Therefore, the aim of this study was to evaluate different DNA extraction methods for the improved detection of infectious pathogens in the bloodstream. Specifically, we compared one column-based DNA extraction method (QIAamp DNA Blood Mini Kit) with two magnetic bead-based DNA extraction methods (K-SL DNA Extraction Kit and GraBon™ system). Real-time PCR was performed using specific primers to assess the efficiency of each method. The K-SL DNA Extraction Kit and GraBon™ system exhibited higher accuracy rates of 77.5% (22/40) and 76.5% (21/40), respectively, compared to the QIAamp DNA Blood Mini Kit, which had an accuracy rate 65.0% (12/40) for Escherichia coli detection, whereas the GraBon™ system demonstrated higher accuracy rate of 77.5% (22/40) than the other two methods, which had an accuracy rates of 67.5% (14/40) for Staphylococcus aureus detection. All methods displayed high specificity for negative samples (100%). These findings highlight the superior performance of magnetic bead-based methods, particularly when automated, for extracting bacterial DNA from whole blood samples. Such methods may enable the more rapid and accurate diagnosis of bloodstream infections, potentially improving patient outcomes.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-87225-y.

Keywords: Sepsis, DNA extraction, Molecular diagnostic technique, Magnetic bead, Whole blood

Subject terms: Biotechnology, Bacteria, Clinical microbiology

Introduction

Sepsis is a leading cause of mortality1, whose successful treatment necessitates rapid and accurate identification of the causative pathogen. However, the prevalence of microorganisms involved in sepsis varies by region, with many pathogens responsible for bloodstream infections (BSI), including Staphylococcus aureus, coagulase-negative staphylococci, Escherichia coli, Klebsiella spp., and Acinetobacter spp2,3.

BSI is primarily diagnosed through a combination of patient factors, such as body temperature, pulse rate, respiratory rate, blood pressure, basic blood tests, and blood culture tests4. Blood cultures can confirm the causative pathogen; however, obtaining the final results often takes several days. Recent advances in molecular diagnostic methods, such as real-time multiplex PCR, have enabled the rapid and accurate detection of various BSI pathogens, and these methods now being introduced in clinical laboratories5. Molecular diagnostic tests have a substantially shorter turnaround time than blood cultures and achieve high sensitivity and specificity, making them a promising diagnostic tool for BSI. In particular, the ability to directly detect pathogens in blood samples is crucial for rapid diagnosis2,3.

Blood samples contain numerous PCR inhibitors (such as human DNA and hemoglobin), which can lead to various complications in the molecular diagnostic results6. Thus, the selection of an effective DNA concentration method and an efficient extraction platform that can isolate and purify DNA with high yield and purity is important for improving the results of molecular diagnostics710. DNA extraction methods can be broadly categorized into boiling, column extraction, and magnetic bead purification, each of which has its own advantages and limitations depending on the sample type and experimental objectives11. Many commercial DNA extraction kits and automated devices have been developed to detect pathogens in different types of sample. Column-based extraction methods such as the QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany) are widely used and often serve as benchmarks in research because of their high sensitivity12. Other notable products include the AccuPrep Genomic DNA Extraction Kit (Bioneer, Daejeon, South Korea), a Korean product capable of rapidly extracting genomic DNA from various samples including whole blood (WB), and the GeneJET Whole Blood Genomic DNA Purification Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA), which is popular internationally13,14. Recently, magnetic bead-based extraction methods have gained attention owing to their ease of automation and their ability to yield high-purity DNA. Based on this technology, KingoBio, Inc. developed the K-SL DNA Extraction Kit (KingoBio, Inc., Seoul, South Korea) for bacterial DNA extraction from WB, incorporating bacterial isolation technology to enhance the extraction efficiency. Subsequently, KingoBio, Inc. developed GraBon™ (KingoBio, Inc., Seoul, South Korea), an automated platform that takes the process to the next level, utilizing the same reagents as the K-SL DNA Extraction Kit but employing robotic handling to increase throughput and consistency15.

While molecular diagnostic techniques for BSI have advanced, there is limited research comparing magnetic bead-based extraction technologies, including those with bacterial isolation capabilities, to established column-based methods. This study aims to compare the molecular diagnostic accuracy of the K-SL Extraction Kit and GraBon™ with the QIAamp DNA Blood Mini kit, examining their potential advantages and clinical applicability.

Results

We determined the diagnostic sensitivity, specificity, and accuracy of each DNA extraction method for both E. coli and S. aureus in WB samples. For E. coli, the K-SL DNA Extraction Kit and GraBon™ demonstrated higher accuracy than the QIAamp DNA Blood Mini Kit (Table 1). The K-SL DNA Extraction Kit exhibited the highest accuracy at 77.5%, followed closely by GraBon™ at 76.5%, whereas the QIAamp DNA Blood Mini Kit showed lower accuracy of 65.0%. Statistical analysis demonstrated significant differences in accuracy between the two methods and that of the QIAamp DNA Blood Mini Kit (p = 0.031 and p = 0.022, respectively; Table 2).

Table 1.

Detection sensitivity, specificity, and accuracy of QIAamp DNA blood Mini kit, K-SL DNA extraction kit, and GraBon™ methods for Escherichia coli and Staphylococcus aureus.

Pathogen Method Sensitivity (%)
(95% CI)
Specificity (%)
(95% CI)
Accuracy (Positive/Total)
E. coli QIAamp DNA Blood Mini Kit 30 (16.56–46.53) 100 (91.19–100.0) 65.0% (12/40)
K-SL DNA Extraction Kit 55 (38.49–70.74) 100 (91.19–100.0) 77.5% (22/40)
GraBon™ 52 (36.13–68.49) 100 (91.19–100.0) 76.5% (21/40)
S. aureus QIAamp DNA Blood Mini Kit 35 (20.63–51.68) 100 (91.19–100.0) 67.5% (14/40)
K-SL DNA Extraction Kit 35 (20.63–51.68) 100 (91.19–100.0) 67.5% (14/40)
GraBon™ 55 (38.49–70.74) 100 (91.19–100.0) 77.5% (22/40)

Table 2.

Comparison of pathogen detection results among QIAamp, K-SL, and GraBon™ bacterial DNA extraction methods.

Pathogen Method Results K-SL DNA Extraction Kit p value* GraBon™ p value*
Positive Negative Sum Positive Negative Sum
E. coli QIAamp DNA Blood Mini Kit Positive 8 4 12 0.031 10 2 12 0.022
Negative 14 14 28 11 17 28
Sum 22 18 40 21 19 40
S. aureus QIAamp DNA Blood Mini Kit Positive 8 6 14 > 0.999 11 3 14 0.057
Negative 6 20 26 11 15 26
Sum 14 26 40 22 18 40

*p values were calculated using McNemar’s test for discrepant results.

For S. aureus, GraBon™ outperformed the other methods with an accuracy of 77.5%, whereas the K-SL DNA Extraction Kit and QIAamp DNA Blood Mini Kit both achieved an accuracy of 67.5% (Table 1). However, the differences in S. aureus detection accuracy among the three methods were not statistically significant (Table 2).

To assess the specificity, we evaluated 20 negative blood culture samples and 20 samples from routine health checkups. All three extraction methods consistently yielded negative results for bacterial detection in these samples, indicating 100% specificity for all tested methods (Supplementary Table 1).

Discussion

In this study, we evaluated three DNA extraction methods (QIAamp DNA Blood Mini Kit, K-SL DNA Extraction Kit, and GraBon™) according to their detection performance for E. coli and S. aureus in WB. The results demonstrated significant differences in performance, particularly regarding the ability to extract bacterial DNA from WB.

Both the K-SL DNA Extraction Kit and GraBon™ demonstrated significantly higher accuracy than the QIAamp DNA Blood Mini Kit for E. coli. This can be explained by differences in the bacterial lysis procedure between the methods. The K-SL DNA Extraction Kit and GraBon™ employ magnetic beads to isolate bacteria from the WB before lysis, providing a cleaner sample for DNA extraction. In contrast, the QIAamp DNA Blood Mini Kit performs bacterial lysis directly within the WB; thus, bacteria, blood proteins, enzymes, and other components are processed together, resulting in lower sensitivity and accuracy710.

In the case of S. aureus, the superior performance of GraBon™, which was not statistically significant, may be explained by the structural differences between Gram-positive and Gram-negative bacteria. Gram-positive S. aureus possesses a thicker peptidoglycan cell wall which shows greater resistance to lysis than Gram-negative E. coli. This structural characteristic requires a powerful lysis method to efficiently extract DNA from S. aureus16. To address this, the GraBon system uses a unique lysis method based on a motor-driven rotating plastic tip for vigorous vortexing. This provided more effective disruption of the S. aureus cell wall. In contrast, the K-SL DNA Extraction Kit uses a gentle tube-mixing lysis method. The more aggressive lysis technique of the GraBon™ method contributes to its enhanced efficiency in extracting DNA from S. aureus.

GraBon™ can process 500 µL of sample and elute in 100 µL, effectively concentrating the DNA. In contrast, the K-SL DNA Extraction Kit and QIAamp DNA Blood Mini Kit handle 200 µL samples, eluting 100 µL and 200 µL respectively. This difference allows GraBon™ to achieve higher sensitivity. The ability to concentrate DNA from a larger initial sample volume (500 µL) to a smaller elution volume (100 µL) significantly improves the detection of low bacterial loads, which is crucial for clinical applications such as sepsis diagnosis. This concentration effect potentially leads to improved sensitivity in downstream applications like qPCR, which is critical for accurate pathogen detection.

Our study has several notable limitations. Primarily, the use of residual complete blood count (CBC) samples often results in insufficient blood volume for comprehensive testing across all three extraction methods. This limitation may have compromised the statistical power of our analyses, which was particularly evident in the S. aureus detection results. That is, although we observed differences in S. aureus detection performance among the methods, these differences did not reach statistical significance. Furthermore, our focus on only one species each of Gram-positive and Gram-negative bacteria may not fully represent the diverse spectrum of bacterial pathogens encountered in clinical settings. These limitations underscore the need for future studies with larger sample sizes and a more diverse range of bacterial species to provide a more comprehensive evaluation of extraction methods in clinical microbiology.

Despite these limitations, this study provides valuable insights into the performance of different DNA extraction methods for bacterial detection in WB samples. The findings highlight the advantages of magnetic bead-based methods, particularly when automated. The K-SL DNA Extraction Kit and GraBon™ showed superior performance for E. coli and S. aureus detection, emphasizing the importance of appropriate method selection in molecular diagnostics. These results have important implications for clinical microbiology, particularly for rapid and accurate BSI detection in WB samples.

Methods

Samples

A total of 120 WB samples were collected from January to December 2023 for this study. For samples in which S. aureus or E. coli were detected in blood cultures, additional residual samples from CBC tests collected on the same day were obtained. The sample set included 40 residual CBC samples of S. aureus and 40 residual CBC samples of E. coli. The sample set also included 20 CBC samples confirmed negative after blood culture and 20 samples from routine health checkups that were assumed to be free of bacterial contamination.

Bacterial DNA extraction was performed on all collected samples using three different methods: the QIAamp DNA Blood Mini Kit, the K-SL Extraction Kit, and GraBon™ system. All tests were conducted with approval from the Institutional Review Board of Ewha Womans University Seoul Hospital and Ewha Womans University Mokdong Hospital (IRB 2022-12-051 and 2023-05-005). The study was performed in accordance with relevant guidelines and regulations set by the same Institutional Review Board. Due to the use of residual samples and the absence of patient personal information, the IRB waived the requirement for informed consent. Throughout the study, patient confidentiality was maintained, and all samples were de-identified before analysis.

Bacterial DNA extraction methods

In this study, we compared three DNA extraction protocols for the detection S. aureus or E. coli in WB samples (Table 3). The following protocols were used.

Table 3.

Description of bacterial DNA extraction methods used for the detection of S. aureus and E. coli.

QIAamp DNA Blood Mini Kit K-SL DNA Extraction Kit GraBon™

Sample volume

(whole blood)

200 µL 200 µL 500 µL
Method Manual Manual Automatic
DNA isolation method Silica spin-column binding (centrifugation) Magnetic beads + magnet rack Magnetic beads binding + magnetic bar
Elution volume 200 µL 100 µL 100 µL
Concentration Factor 1 x 2 x 5 x

The QIAamp DNA Blood Mini Kit is a manual bacterial DNA extraction kit designed for use with WB samples. In brief, 200 µL of WB was mixed with protease and a lysis buffer. After incubation at 56 °C for 10 min, ethanol was added to the cell lysates. The mixture was then transferred to a spin column and centrifuged. The column was washed twice with two wash buffers to remove contaminants. Finally, the purified DNA was eluted with 200 µL of elution buffer.

The K-SL DNA Extraction Kit is a manual kit that isolates bacterial DNA using magnetic beads and a magnetic rack. In brief, 200 µL of WB was mixed with GraBeads™ to capture bacterial cells. The GraBeads™ -bound bacteria were then separated from the supernatant using a magnetic rack. Lysis buffer was added to disrupt the bacterial cells and release the DNA. A binding buffer was added to facilitate the attachment of DNA to the magnetic beads. Multiple washing steps were performed on the beads with bound DNA to remove impurities. Finally, purified DNA was eluted from the beads with 100 µL of elution buffer.

GraBon™ automates the K-SL DNA Extraction Kit process and can handle up to four samples simultaneously, utilizing a pre-filled well plate containing all required buffers. In brief, 500 µL of WB was initially mixed with GraBeads™ to capture bacteria. The system employs magnetic rods covered with plastic tips that move both vertically and horizontally to transfer GraBeads™ -bound bacteria through different wells. In the lysis buffer, the plastic tips rotate, creating vortices in the solution to enhance bacterial cell disruption. The magnetic rods then move the DNA-bound magnetic beads through the subsequent wells for automated washing to remove impurities. Finally, the beads were transferred to the elution well, where purified DNA was eluted in 100 µL of elution buffer.

Real-time PCR assay

For real-time PCR analysis, we employed 2 µL of the eluate obtained from each of the three extraction methods. Specific primers for S. aureus and E. coli were used to identify the DNA, and the results were compared with those from blood culture samples to confirm the presence of each bacterial species. Primers were designed using PrimerQuest, and the sequences of each primer are listed in Table 4.

Table 4.

Nucleotide sequences of primers for real-time PCR amplification.

Bacteria
(gene, amplicon size)
Primer orientation Sequence (5’-3’) Reference
S. aureus (nuc, 207 bp) F ACACCTGAAACAAAGCATCC 17
R TAGCCAAGCCTTGACGAACT
E. coli (eaeA, 150 bp) F GGCGGATTAGACTTCGGCTA 18
R CGTTTTGGCACTATTTGCCC

The real-time PCR reaction mixture had a total volume of 20 µL, comprising 2 µL of sample DNA, 10 µL of iQ SYBR Green Supermix, 7 µL of distilled water, and 50 pmol of each specific primer. The amplification conditions were set for 40 cycles of 15 s at 95 °C, 30 s at 56 °C, and 30 s at 72 °C. Real-time PCR was performed in duplicate for both samples and controls using the QuantStudio 1 system (Applied Biosystems). RNase- and DNase-free water were used as non-template controls. The presence of target bacteria was confirmed by analyzing the melting temperatures, which are 80 °C and 88 °C for S. aureus and E. coli, respectively.

Statistical analysis

The sensitivity, specificity, and accuracy of the three methods (QIAamp DNA Blood Mini Kit, K-SL DNA Extraction Kit, and GraBon™) were analyzed at 95% confidence intervals using MedCalc. The sample size for each pathogen (E. coli and S. aureus) was n = 40. Positive and negative detection rates were compared using McNemar’s test, which is appropriate for binary paired data. Comparisons of interest were: QIAamp DNA Blood Mini Kit vs. K-SL DNA Extraction Kit and QIAamp DNA Blood Mini Kit vs. GraBon™ for both E. coli and S. aureus. Data suitability was assessed, confirming no additional assumptions, such as normality, were required. Commercial software (MedCalc 23.0.5; MedCalc Software, Mariakerke, Belgium; SPSS 29.0; IBM Corp., Armonk, NY, USA) was used for the statistical analysis. All statistical tests were two-tailed, with an alpha level set at 0.05 for determining significance.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (18.3KB, docx)

Acknowledgements

This work was supported by the TIPS Program (No. S3198545) funded by the Ministry of SMEs and Startups (MSS, Korea) in 2021.

Author contributions

Conceptualization, B.N., J.P., J.L. and H-S.C.; Methodology, B.N., Y-H.K., E.P., J.L. and H-S.C.; Validation, B.N., J.L. and H-S.C.; Formal analysis, B.N., J.P. and S.P.; Investigation, J.P. and S.P.; Resources, J.P., J.J., J.L. and H-S.C.; Data curation, J.P. and S.P.; Writing – original draft, B.N., J.P, E.P., J.L. and H-S.C.; Writing – review & editing, Y-H.K., J.L. and H-S.C.; Project administration, J.L. and H-S.C.; Funding acquisition, J.L. and H-S.C.; Supervision, J.L. and H-S.C. All authors reviewed and approved the manuscript.

Data availability

The datasets generated during the current study are available from the corresponding author upon request.

Declarations

Competing interests

This research was funded by KingoBio, Inc. and is a collaboration between KingoBio, Inc. and the Ewha Education and Research Center for Infection. B.N, S.P, E.P, J.J are employees of KingoBio, Inc., and J.L is the CEO of KingoBio, Inc. H-S Chung received research funding from KingoBio, Inc. This study was conducted in compliance with ethical guidelines under the supervision of Hospital-based Business Innovation Center and Ewha Institute of Convergence Medicine at Ewha Womans University Mogdong Hospital, and all authors ensured transparency and impartiality throughout the research process.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Byungjoon Na and Junghun Park contributed equally to this work.

Contributor Information

Jinyeop Lee, Email: jyleeceo@kingobio.co.kr.

Hae-Sun Chung, Email: sunny0521.chung@ewha.ac.kr.

References

  • 1.Vincent, J. L., Opal, S. M., Marshall, J. C. & Tracey, K. J. Sepsis definitions: time for change. Lancet381, 774–775 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Sinha, M. et al. Emerging technologies for molecular diagnosis of sepsis. Clin. Microbiol. Rev.31, 101128cmr00089–101128cmr00017 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Peri, A. M., Harris, P. N. & Paterson, D. L. Culture-independent detection systems for bloodstream infection. Clin. Microbiol. Infect.28, 195–201 (2022). [DOI] [PubMed] [Google Scholar]
  • 4.Peters, R. P. H. Innovations in the diagnosis of bloodstream infection: A bench-bedside interaction. (2007).
  • 5.Van De Groep, K. et al. Development and first evaluation of a novel multiplex real-time PCR on whole blood samples for rapid pathogen identification in critically ill patients with sepsis. Eur. J. Clin. Microbiol. Infect. Dis.37, 1333–1344 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Reinicke, M. et al. From shadows to spotlight: enhancing bacterial DNA detection in blood samples through cutting-Edge Molecular Pre-amplification. Antibiotics13, 161 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Dalla-Costa, L. M. et al. Comparison of DNA extraction methods used to detect bacterial and yeast DNA from spiked whole blood by real-time PCR. J. Microbiol. Methods140, 61–66 (2017). [DOI] [PubMed] [Google Scholar]
  • 8.Loonen, A. J. et al. Comparison of pathogen DNA isolation methods from large volumes of whole blood to improve molecular diagnosis of bloodstream infections. PloS One8, e72349 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.McCann, C. D. & Jordan, J. A. Evaluation of MolYsis™ Complete5 DNA extraction method for detecting Staphylococcus aureus DNA from whole blood in a sepsis model using PCR/pyrosequencing. J. Microbiol. Methods99, 1–7 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Podnecky, N. L. et al. Comparison of DNA extraction kits for detection of Burkholderia pseudomallei in spiked human whole blood using real-time PCR. PLoS One8, e58032 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Barbosa, C., Nogueira, S., Gadanho, M. & Chaves, S. in Molecular microbial diagnostic methods 135–154. (Elsevier, 2016).
  • 12.Warton, K., Graham, L. J., Yuwono, N. & Samimi, G. Comparison of 4 commercial kits for the extraction of circulating DNA from plasma. Cancer Genet.228, 143–150 (2018). [DOI] [PubMed] [Google Scholar]
  • 13.Mi, Y. & Vanderpuye, O. Comparison of different DNA extraction methods for forensic samples. J. Nat. Sci. Res.3, 32–38 (2013). [Google Scholar]
  • 14.Nikezić, A. et al. Comparative analysis of human DNA extraction methods and mitochondrial DNA HV1 and HV2 haplogroup determination. Kragujevac J. Sci. 73–83 (2020).
  • 15.Abafogi, A. T. et al. Automated sepsis detection with Vancomycin-and allantoin-polydopamine magnetic nanoparticles. Sci. Rep.14, 3693 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mai-Prochnow, A., Clauson, M., Hong, J. & Murphy, A. B. Gram positive and Gram negative bacteria differ in their sensitivity to cold plasma. Sci. Rep.6, 38610 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kim, Y., Lee, J. & Park, S. A 3D-printed millifluidic platform enabling bacterial preconcentration and DNA purification for molecular detection of pathogens in blood. Micromachines9, 472 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bibbal, D. et al. Intimin gene (eae) subtype-based real-time PCR strategy for specific detection of Shiga toxin-producing Escherichia coli serotypes O157: H7, O26: H11, O103: H2, O111: H8, and O145: H28 in cattle feces. Appl. Environ. Microbiol.80, 1177–1184 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (18.3KB, docx)

Data Availability Statement

The datasets generated during the current study are available from the corresponding author upon request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES