Cost-reduction strategy to culture patient derived bladder tumor organoids

Abstract

Organoids as self-organized structure derived from stem cells can recapitulate the function of an organ in miniature form which have developed great potential for clinical translation, drug screening and personalized medicine. Nevertheless, the majority of patient-derived organoids (PDOs) are currently being cultured in the basement membrane matrices (BMMs), which are constrained by xenogeneic origin, batch-to-batch variability, cost, and complexity. Besides, organoid culture relies on biochemical signals provided by various growth factors in the composition of medium. We propose sodium alginate hydrogel scaffold in addition to the fibroblast conditioned medium (FCM)-enriched culture medium that is inexpensive and easily amenable to clinical applications for the culture of bladder cancer PDOs. PDOs grown in sodium alginate and FCM based medium have proliferation potential, growth rate, and gene expression that are similar to PDOs cultured in BME. According to the results, sodium alginate has substantial mechanical properties and reduces variance in early passage bladder tumor organoid cultures collected from patients. Furthermore, using FCM based medium as an alternative solution to eliminate some essential growth factors can be considered, especially for low-resource situation and develop cost effective tumor organoids.

Introduction

A unique three-dimensional (3D) culture structure with the ability to mimic the development and regeneration of organs is called an organoid. Organoids develop from the self-organization of stem cells to eventually form structures that resemble in vivo organs¹ Patient-generated tumor organoids (PDOs) are multicellular entities formed from tumor tissue that include intra- and interpatient tumor variability. PDO models mimic the histopathologic and gene expression pattern of parental tissue; and these features make them interesting for anticancer drug screening and cancer therapies².

Effective in-vitro organoid generation depends on recapitulating three main features: physical properties of the environment surrounding the cells; soluble cues in culture medium; and the type of starting cells. Thus, biomaterials (environment) and medium (tissue-specific combination of growth factors) are essential to create a rich and suitable microenvironment that mimics the extracellular matrix⁴. Currently, basement membrane derived matrices (BMMs) (commercially available as Cultrex BME and Matrigel), are gold standard scaffolds for organoid culture which are sourced from basement membrane of mouse sarcoma cells^3,4.

Both of these extracellular matrixes are hydrogels (type of soft material that absorbs large amounts of water to shape a 3D fiber network⁵) composed of primary components, including laminin, collagen IV, heparin sulfate proteoglycan perlecan and entactin⁶. Hydrogels are not only an inert scaffold, but also provide the biological and chemical conditions necessary for the proliferation and differentiation of cells⁷.

For instance, laminin-1 has several anchorage sites where many cell types, including stem cells, may adhere, and peptides generated from laminin can aid in angiogenesis, differentiation, and metastasis. BME and matrigel encompass tumor-derived proteins like fibroblast growth factors (FGFs), transforming growth factor beta (TGF-β), and matrix metalloproteinases (MMPs) which strongly contribute to the organoid formation. These properties together make them effective scaffolds for the development and culture of organoids and tumor organoids⁸.

However, BMMs are not flawless which have some disadvantages, variations from batch to batch, residual xenogeneic compounds, and risk of viral contamination^9,10 were reported and have led to a lack of reproducibility in 3D based culture experiments¹¹.

On the other hand, BMMs suffer from poorly defined ingredients. To date, approximately 2000 proteins were identified in these BMMs, and proteomic studies continue to identify new proteins in these biomaterials that were not previously reported⁸.

Although the mixture of proteins helps the cells migrate and form a 3D structure, it is crucial, especially in the first 24 h after cell seeding, to enrich the culture medium with various growth factors, these growth factors, such as R-Spondin, Wnt3a, FGF2 (fibroblast growth factor-2), FGF10, Noggin, Forskolin, A83 (TGFβ inhibitor) and epidermal growth factor (EGF) have critical functions in promoting cell signaling, survival, proliferation and differentiation, which are essential for maintaining the complex, in vivo-like properties of patient-derived tumor organoids¹². However, their high cost, estimated at $646 per 50 ml of medium, can be a significant barrier, particularly for researchers in low-resource countries¹³.

As an alternative, we explored the use of sodium alginate (SA), a biomimetic scaffold with viscoelastic properties and fibroblast conditioned medium (FCM) to establish patient derived bladder cancer organoids compared to standard protocol. FCM originates from fibroblast cell culture that naturally release 337 proteins¹⁴. There are various techniques for the co-culture of cells in 3D, which enable different interactions among the cell types. Unlike direct co-culture, indirect co-culture utilizes a conditioned media and/or a physical barrier, such as a semi-permeable membrane, separating the cell types. Communication occurs through the secretion of signaling molecules, known as secretomes, which can either favorably or unfavorably affect cell behavior¹⁶. Recently and in context of different cancer organoid culture, cancer-associated fibroblasts (CAFs) as a major component of TME (tumor microenvironment), have been co-cultured with organoid in terms of their important role in cancer progression, ECM remodeling, metastasis, and therapy resistance which is an example of direct co-culture to develop more realistic model¹⁵.

We described using sodium alginate as a tissue-mimetic scaffold with viscoelastic behavior. Sodium Alginate is a cost effective and naturally derived from brown algae with controllable gelation after adding calcium chloride as a cross-linker¹⁶. Several studies were carried out on organoid culture for the intestinal¹⁹, lung, and brain using this FDA-approved hydrogel in conjunction with other scaffolds (collagen and GelMA⁶) or alone^20,21. Different studies showed the variation of potential in using alginate as a supportive scaffold for long-term culture^17,18, although the alginate has specific potentials, such as hydrophilicity (which limit protein absorption), and lack of cell adhesive properties, but as low cost and available matrix, it seems considerable potential to support tumor organoid culture^17,19,20.

We present the possibility of using sodium alginate scaffolds, in combination of FCM-enriched media, as a cost-effective technique to facilitate the establishment of patient-derived bladder tumor organoid cultures, particularly for early-stage drug screening. For this purpose, we first evaluate potential of sodium alginate in compare with standard BME matrices and then we tested medium formulated with FCM to replace some expensive growth factors. Finally, two strategies were combined to show the possibility of innovative method in order to generate cost-benefit patient derived bladder tumor organoids and to reduce limitation in precision cancer medicine and running the clinical trials to be less affected by animal based and high cost source of BME.

Materials and methods

Sample collection

Human bladder cancer tissue from 10 patients were obtained from patients undergoing TURBT at Hospitals (Erasmus MC in Netherland and Emam Khomeini Hospital in Iran) (Table 1).

Table 1.

Patients characteristic.

Sex	Age	Pathological classification	Invasiveness	Pre cancer treatment
F:2 M:8	Average: 62.2 Range (40–79)	CIS: 2 PTa: 3 PT1:1 PT2:0 PT3:3 PT4:1 Low grade: 6 High grade: 4	NMIBC:6 MIBC:4	Non : 2 TURBT: 5 Mitomycin instillation: 0 BCG instillation:2 Neoadj. Chemotherapy:1

CIS: Carcinoma in situ; NMIBC: Non muscle invasive bladder cancer; MIBC: Muscle invasive bladder cancer; Non: noncancerous patients; TURBT: Transurethral resection of bladder tumor; Mitomycin instillation: the treatment involves instillations of liquid chemotherapy; BCG: Bacillus Calmette–Guerin; Neoadj. Chemotherapy: It is a type of induction therapy.

During surgery, tumor tissue samples were collected into a falcon containing Advanced DMEM/F12 culture medium (Gibco) supplemented with Glutamine, Hepes and Primocin (invivo gen) (:Advanced DMEM/F12⁺⁺⁺), placed on ice, and transported directly to the laboratory. Tissue samples were employed to establish primary tumor organoid culture.

PDOs (patient derived organoids) were generated from specimens obtained from patients that underwent either TURBT, BCG instillation or Neoadjuvant chemotherapy who representing the spectrum of Bladder Urothelial Carcinoma (BLCa), ranging from low-grade, non-invasive BLCa to high-grade invasive tumors, including both NMIBC (Non-muscle invasive bladder cancer) and MIBC (Muscle invasive bladder cancer). The study protocol was approved by the Ethics Committee of Tehran University of Medical Sciences prior to screening of patients (IR.TUMS.TIPS.REC.1402.139), and the Informed consent was obtained from all subjects and/or their legal guardian(s). Table 1; Fig. 1 shows the patients characteristic enrolled in this study. All methods were performed in accordance with the relevant guidelines and regulations.

Fig. 1.

Schematic presentation of patients characteristic enrolled in this study. CIS: Carcinoma in situ; NMIBC: Non muscle invasive bladder cancer; MIBC: Muscle invasive bladder cancer; Non: noncancerous patients; TURBT: Transurethral resection of bladder tumor; Mitomycin instillation: the treatment involves instillations of liquid chemotherapy; BCG: Bacillus Calmette–Guerin; Neoadj. Chemotherapy: It is a type of induction therapy.

Hydrogel alginate preparation

3% Sodium Alginate (SA) hydrogel (ZFZ Co. Iran) was prepared by using Advanced DMEM/F12⁺⁺⁺ as solvent. The combination stirred on a magnetic stirrer under the hood for about one hour at room temperature or until the solid phase dissolved.

Fibroblast cell isolation, characterization and conditioned medium collection

Human tissue samples from foreskin were obtained from three consenting healthy donor (n = 3), after receiving maternal consent. The samples were incubated in Dispase II (2.4 units/ml) (Gibco) for 16 h at 40˚C and then the epidermis was peeled off the dermis and discarded, and the dermis was washed and digested by using collagenase II (1%) (Gibco) at 37 °C for 40 min. The cells were then re-suspended in F12: DMEM (Gibco) medium supplemented with 10% fetal bovine serum (FBS; Gibco), 1% pen/strep antibiotic solution (Biosera). The medium was replaced every 2–3 days until the monolayer cells were 70–80% confluent, the cells were sub-cultured by using 0/025% trypsin/EDTA (Gibco), until passage 3 (P3)²¹. The cells were characterized by flow-cytometry to detect the expression of specific fibroblast cell surface markers, CD73 and CD29²². The culture medium from 60 to 80% confluent fibroblasts (P3) (Figure of confluent cells doesn’t represent) was replaced with AdDMEM/F12+++ (advanced Dulbecco’s Modified Eagle Medium contain Hepes, L-glutamine and Primocin) and incubated for 48–72 h, the medium then collected and filtered using a 30-kDa Amicon Ultra-15 centrifugal filter (Sigma-Aldrich) to concentrate the proteins (FGF7 ≈ 19 kDa, FGF2 ≈ 18 kDa and FGF10 ≈ 19.3 kDa) as described before²³.

Establishment and maintenance of bladder tumor organoids

Tissue dissociation

The tumor tissue were washed in human organoid washing medium cold Ad DMEM/F12⁺⁺⁺, and put in a petri dish to cut it in smaller pieces with a surgical blade; minced tissues were washed in 1 mL of washing medium and centrifuge at 350 g for 5 min. After removal of the medium, tissues were then incubated in 1 mL of 1:10 dilution of collagenase1A (Sigma Aldrich) prepared in Earle’s Balanced Salt Solution (EBSS) (Gibco) at 37 °C for 30 min (meanwhile, the tissues were dissociated mechanically by pipetting). Incubated tissue with collagenase filtered 70 μm cell strainer, and filled up with Ad DMEM/F12⁺⁺⁺ for inactivation collagenase and centrifuged again at 350 g for 5 min, this washing step was repeated twice. After removing the AdDMEM/F12⁺⁺⁺, cell pellet was combined with alginate (Alg) solution (1:3) and dropped into the 40mM calcium chloride (40 mM), incubated for 8–10 min to be solidify and formed drop. The calcium chloride were replaced with bladder expansion medium which is Ad DMEM/F12⁺⁺⁺ supplemented with 10mM of the ROCK inhibitor Y-27,632 (Sigma-Aldrich), B27 50X (Thermo Fisher), NAC (N-acetylcysteine) 500 mM (Sigma Aldrich), NIC (Nicotinamide) 1 M (Sigma Aldrich), WNT homemade conditioned medium, R-Spondin-1 homemade conditioned medium (both gifted from Biochemistry department, EMC) and A83 (20mM) (Tocris). Standard medium contains FGF7 (Peprotech) 25 ng/ml, FGF10 (Peprotech) 100 ng/ml and FGF2 (Peprotech) 12.5 ng/ml. In case of FCM-based medium, FGF7, 10 and 2 was replaced with 40 ml of FCM (describe in “Viability and size assessment”). Approximate amount of FGF2, 7 and 10 in 40 ml of home-made FCM medium prepared for bladder medium organoids were 8.07 ng/ml, 13.89 ng/ml, 8.79 ng/ml, respectively. The medium was filtered through 0.2 μm filter. The medium was changed every 2–3 days (Tables 2 and 3). As control, same amount of the cell pellet after centrifuge, was dropped into the BME (Basement Membrane Extract) and the rest for each patients embedded into 3% sodium alginate.

Cells resulted from disassociation, plated in non-adherent plate into the BME and supplied with growth factor listed in Table 2 as control group, from each sample, half of the cell suspension was entrapped into sodium alginate (SA) (Fig. 2B) and maintained with same supplements²⁴.

Fig. 2.

Tumor organoids characterization cultured in Sodium Alginate (SA) in comparison with BME as control. A Tumor organoids from patient #2 isolated from tissue and cultured in SA in compare with BME (Ctrl) (scale bar: 100 µm). B Different morphologies of drops made by SA (float) and BME (dome). C Tumor organoids isolated and cultured in BME (P0) and sub-cultured in SA (P1), organoids from patient #3 cultured in BME (lower row, ctrl group) (scale bar: 100 µm), right panel shows three different abandon morphologies of bladder tumor organoids. D SEM microscopy to show the porosity of SA scaffold after preparation and before adding culture medium ,10 days after culture, arrow shows the tumor organoid (Scale bar: 200 µm). E Size measurement by Image J in different days^3,7,10, and¹⁴, BME as Ctrl. F Viability assessment of tumor organoids in different days^3,7,10, and¹⁴, BME as Ctrl. G Culture efficiency and passage number of tumor organoids cultured in SA vs. BME (Ctrl). H Bio-banking potentials of tumor organoids cultured in SA vs. BME (Ctrl). I RT-PCR analysis for eight genes on tumor organoids cultured from tissue after 14 days in SA in compare with BME (as Ctrl), delta CT data normalized to Cyclophilin.

Expansion and maintenance

Every 7–10 days according to the organoid density and size, to disrupt the alginate drop we used 500 µl of phosphate-buffered saline (PBS) and incubated in room temperature for 10 min, afterwards, the 1 µg/ml dispase (Gibco) was added to each well in tissue culture plate, and the digestion process was conducted enzymatically and mechanically, digested organoids were combined with Alg/ AdDMEM/ F12⁺⁺⁺ to make the new drops. The general split ratio is 1:2–3, depending on growth rate²⁵.

Viability and size assessment

AlamarBlue viability assay (Invitrogen DAL1025) was carried out in this study which is based on the fluorescence reading of resorufin converted into cell enzymes from resazurin and allows measurement of the signal from tumor organoids²⁶. Wells with organoids were randomly selected (in triplicates) after 3, 7 and 14 days. First, The reagent were diluted with BOM medium to make 10% Alamar blue, incubated for 4 h in the incubator and then reading was performed according to the manufacturer’s instructions. Absorbance readings were taken at wavelengths 570 and 600 nm. The results were normalized to control (Matrix or scaffold). Cell imaging (Labomed, USA) was performed after each Alamar Blue assay. Each condition was repeated at least three times and readings were done in duplicate. Images was analyzed by using Image J software. Diameter of tumor organoids were measured in three image of each patients and in each group, data was represented as mean ± SD.

Total RNA isolation and quantitative RT-PCR (RT-qPCR)

Total RNA was isolated from tumor organoids using TRIzol (ThermoFisher) on 10–14 days after culturing in both conditions (standard culture and cultured with alginate), and residual genomic DNA was digested with DNase I (Life Technologies). The cDNA was synthesized using Superscript II reverse transcriptase (Life Technologies) by using random primers. RT-quantitative PCRs (RT-qPCRs) were performed on a CFX Connect real-time PCR detection system thermocycler (Bio-Rad) using GoTaq qPCR master mix (Promega) (3 min at 95 °C, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s). Melting-curve analysis was performed to assess specificity of RT-qPCR products. Primers used for real-time PCR are listed in Table 4. Relative gene expression data were calculated using the ΔCT method²⁷. Cyclophilin was used as housekeeping gene for the analysis.

Table 4.

List of primers used for RT-PCR.

Gene	Forward	Reverse
Uroplakin IIIA	CGGAGGCATGATCGTCATC	CAGCAAAACCCACAAGTAGAAAGA
CD44	CCTCTCATTACCCACACACG	CAGTAACTCCAAAGGACCCA
CK5	CAAGGTTGATGCACTGATGG	TCAGCGATGATGCTAAG
CK20	CAGACACACGGTGAACTATGG	GATCAGCTTCCACTGTTAGACG
CK14	TTCTGAACGAGATGCGTGAC	GCAGCTCAATCTCCAGGTTC
GATA3A	ACCACAACCACACTCTGGAGGA	TCGGTTTCTGGTCTGGATGCCT
LGR5	TGATGACCATTGCCTACA	GTAAGGTTTATTAAAGAGAAG
FOX1A	TACACACCTTGGTAGTACGCC	GCAATACTCGCCTTACGGCT
Cyclophilin	GGCAAATGCTGGACCCAACACA	TGCTGGTCTTGCCATTCCTGGA

Immunofluorescence of tumor organoids

Tumor organoids in all conditions were fixed by applying freshly prepared 4% paraformaldehyde (PFA) (Sigma Aldrich) in PBS buffer at room temperature for 30 min, followed by 3 times washing by washing solution (0.5% FBS in PBS). Then, the organoid was treated with 0.1 M glycine for 30 min at room temperature. In order to do permeabilization step, 300 µL of 0.5% triton in PBS was added to the falcon containing organoids and incubated for 30 min at room temperature. After 3 times washing by PBSTD washing solution (PBS + 0.3% triton + 1% DMSO + 0.5% FBS), goat serum (0.5%) diluted in PBS (1X) was used as blocking reagent to decrease the non-specific-binding, as most of the secondary antibodies are produced on goat. First antibodies listed in Table 5 incubated overnight at 4 °C in an orbital shaker, the day after followed by at least 3 times washing by PBSTD washing solution, appropriate secondary antibodies (listed in Table 5) were incubated for 2 h at room temperature in an orbital shaker. Followed by at least 3 times washing by using washing solution (0.5% FBS in PBS), mounting solution containing DAPI (Abcam) was applied on organoid and covered by cover slip. The samples were visualized by using Leica Stellaris 5 LIA confocal microscopy.

Table 5.

List of antibodies used for confocal imaging.

Primary antibody	Lot number	Secondary antibody	Lot number
Cytokeratin 20 (Mouse anti human)	41,305,934	Alexa Fluor 488 goat α-mouse	2,066,710
KI67 (Rat anti human)	151,202	Alexa Fluor 555 goat α-rat	2,089,884

Scaffold and FCM characterization (SEM, FTIR and ELISA)

Scaffold characterization by SEM (scanning electron microscopy)

To show the structure and morphology of calcium alginate with and without tumor organoid, we conducted SEM (Scanning Electron Microscopy) imaging by MIRA3 TESCAN²⁸. For sample containing tumor organoids, drops were collected in the falcon tube and fixed by using glutaraldehyde 4% (Sigma Aldrich), after 3 times washing with PBS, dehydration process was conducted by using the following concentrations of ethanol series (10 min for each level): 60%, 70%, 80%, 90%, 100%. Sample without organoids frozen at -80 °C overnight and lyophilized by freeze-dryer (Pishtaz engineering, FD6, Iran) for 18 h. Before imaging, all the samples were coated by gold as conductive material.

FCM characterization by FTIR

FTIR was applied on the sample collected from fibroblast cultured in passage 3, the collected media stored at -80 °C and medium subjected into Fourier Transform Infrared Spectroscopy (FTIR) (Bruker, Germany) in comparison with FCM prepared commercially (Cellprogen^®, USA) as control in 400–4000 cm⁻¹ wavelength.

FCM characterization by ELISA

In order to assess the specific amount of growth factors (FGF2, 7 and 10), we applied the ELISA on the commercial FCM (Cellprogen^®, USA) as control and in compare with home-made FCM. Before run the ELISA, we conducted spectrophotometry (WPA Biowave II, UK) on the different dilution (dilution made by adding AdDMEM⁺⁺⁺) of commercial FCM (Cellprogen^®, USA) to be adjust in terms of total protein concentration in compare with home-made FCM, UV absorbance was read for each diluted samples at 280 nm.

Then, 50% of commercial FCM and home-made FCM were used to measure indicated GFs (FGF2, 7 and 10) by ELISA (FGF10: Universal Biological RK09223; FGF7: MyBiosource MBS2020770 and FGF2: MyBioSource MBS2097899).

The sample were centrifuged at 3000 rpm (Hettich, Germany), 40 µl of the supernatant and 50 µl of the standards were poured into separate wells in triplicate, then 50 µl of Streptavidin HRP and corresponded antibodies were added to the sample’s well based on the company protocol. The plates were incubated for 1 h at 37 °C, then wells were washed four times with washing solution. Then 50 µl of chromogen A and chromogen B solutions were added to each well, respectively. Plate was shacked (Behdad, Iran) gently and incubate for 10 min in the dark room at 37 °C. The stop solution was added to all wells until the blue color turned to yellow. Absorbance was read at 450 nm by ELISA reader (Biotek, USA).

Software and statistics

Data are displayed as median if applicable. Individual groups were tested using the 2way ANOVA analytical test for correlation between continuous data. Graphs were plotted using GraphPad Prism v.8.4.0. Statistical analyses were conducted using GraphPad Prism v.9.4.1. P values < 0.05 were considered statistically significant.

Result

Tumor organoid cultured in sodium alginate scaffold

Scale up the organoids to use in personalized medicine and regenerative medicine faced to challenges by xeo-based material and high cost. To overcome the constraint, we devised a technique whereby sodium alginate at a specified proportion facilitates the development of bladder tumor organoids. We first evaluated bladder tumor organoid growth in sodium alginate compared to the conventional BME, an Engelbreth-Holm-Swarm (EHS) cell-derived ECM, referred to here as control.

To stablish the patient derived bladder cancer organoid, we collected the samples from 10 patients, average age of patients in the whole sample were 62.2 years (range: 40–79). This study 80% of patients were men and 20% woman, 60% patients had NMIBC, and 40% showed high-grade histopathological features (Table 1; Fig. 1 (Schematic)).

PDOs from tissue disassociation were observed in BME after 3 days, but minimum in 7 days in alginate group. Figure 2A depicts tumor bladder organoids grown in sodium alginate (upper row) and BME (lower row) as control in different days, organoids showed better bio banking potential (Fig. 2H), and higher passage number (Fig. 2G) when the culture expanded initially in BME and subsequently sub-cultured into alginate after reaching high confluence. While, Fig. 2C revealed the tumor organoids generated from tissue sample and cultured into the SA, right after isolation.

The variation in mechanical properties of sodium alginate was achieved by changing cross link concentration, 60% of BME was lost in 14 days of culture while 3% SA was more and less stable in size of drops after 14 days of culture which indicate more stability of SA under shear-induced stress, thus SA can physically provide support spherical organoid generation, floating droplet of SA provides more efficient 3D culture condition (Fig. 2B) in compare with BME dome which should stack to the bottom of culture plate and needs polymerization for 40 min in incubator after making the drops.

Required porosity which is essential for mechanotransduction, cells assembly²⁹, migration, flow and transport the nutrient and metabolic waste³⁰ were shown by SEM electron microscopy. The porosity analysis by Image-J software showed that the average of pore sizes for 3% (w/v) alginate scaffolds on three different SEM images (magnification 200 µm) were ˷25 µm. SEM also showed different morphology of scaffold before adding medium and after 10 days in culture (Fig. 2D).

The bio-inert composition of SA indicates that it lacks protein epitopes or other structures typically identified as foreign by the immune system. As a scaffold, this characteristic serves as a double-edged sword; while the SA may be safe, but the absence of protein receptors on its surface result in a diminished success rate for 3D cultures derived from isolated tissues. For instance, the proteins like integrin, mediate the interaction between cells and the extracellular matrix (ECM), playing a crucial role in various processes, such as adhesion, migration, differentiation, and survival. Integrin binding to ECM components not only mediates attachment, but also initiates intracellular signaling pathways (e.g., focal adhesion kinase (FAK) signaling, MAPK pathway) that promote cell survival. These signals improve the cells’ capacity to proliferate in the scaffold’s three-dimensional environment while shielding them from apoptosis, or programmed cell death²³. Tumor bladder organoids had three different spherical morphologies which were variable from patient to patient: basal (mostly solid spherical), luminal (hollow cyst), and grape like (low cohesive) subtypes in both conditions (BME and SA). Most of the bladder cancer organoids in alginate were solid spherical and grape like shape, although the number of hollow cyst and solid spherical organoids were increased in BME culture (Fig. 2C).

Viability and size are two crucial factor in organoid culture; Size plays a key role to determine the maturation, complexity, and functionality of organoids. More substantial organoids more accurately mimic the tissue from which they originate, while smaller organoids may be constrained in their capacity to reproduce tissue-specific activities²⁴. High viability ensures the effective long-term cultivation of organoids. It required for sustained experimental timelines, enabling the study of long-term drug effects.

Viability evaluation in 3, 7 and 14 days after culture on the organoids generated from tissue in both condition analyzed by two-way ANOVA analysis and revealed significant difference between BME as control group compared to sodium alginate group in day 3 (P value: 0.0387) and day 7 (P value: 0.0398), although the viability for both groups were more than 100% in 14 days after culture (P Value: 0.0012) (Fig. 2G), but the difference between SA group with control wasn’t statistically significant (Fig. 2F).

As demonstrated in Fig. 2, graph E, the size of tumor organoids on day 3 was comparable in both groups. SA group showed considerably greater size on days 7 (P = 0.0020) and 10 (P = 0.0009) compared to day 3, indicating its ability to sustain growth in SA scaffold. However, there was no significant difference in diameters between PDOs grown in SA and BME (p > 0.01). In the BME group, the size was significantly increased on days 7 (P value ≤ 0.0001) and 10 (P value ≤ 0.0001) compared to day 3, following the same trend. This suggests that, despite the similar growth trend in both groups, the PDO cultured in SA had a smaller size than the control group, a difference that was not statistically significant.

RNA analysis by RTPCR of organoids from SA and control group (BME) was conducted to assess the similarity in gene expression between PDOs grown in SA in compare with BME³⁴. Cultured organoids replicate a substantial portion of the cellular diversity of bladder tissue, including the diverse functionalities of luminal and basal cells (see “Methods”). Except GATA3, all genes were higher expressed and highly significant (P value ≤ 0.0001) in BME group as control in compare with sodium alginate group (P Value: 0.2029) (Fig. 2.I), which might show sodium alginate could preserve origin tissue diversity but potentially lead bladder organoid cultures toward a basal phenotype³¹.

Basal like cancer express higher level of CD44 and cytokeratins (CK5, 6, and 14)³², these biomarkers (CD44, CK5, 6 and 14) are enriched in normal epithelial stem cells and cancer-associated stem cells derived from epithelial lineage tumors. The bladder’s epithelial lining consists of three layers: the apical layer (umbrella cells) expressing UPK3A, the intermediate layer (polygonal cells) expressing CK7, and the basal layer (cuboidal cells) expressing CK5. Additionally, CK20, FOXA1, and GATA3 are expressed at greater levels in the luminal subtype. RT-PCR findings demonstrated the expression of many basal and luminal markers in the produced organoids, indicating sufficient variability in SA to accurately reflect essential characteristics of human bladder tumor tissue.

Moreover, as shown in Fig. 3.A, structure was characterized by immunofluorescent staining. The suprabasal/umbrella cells express the luminal marker CK20, and dysregulation is a contributing factor in the majority of non-invasive tumors. CK20 staining pattern is considered a marker of cell differentiation and maturation^38,39. UPK3A is expressed in the luminal membrane of umbrella cells, forming an asymmetric unit membrane (AUM) involved in bladder flexibility and barrier function³³. Furthermore, KI67 in the nucleus, and CK20 and UPK3A in the outer rim of organoids, suggesting an organized structure. Similarly, the cell nuclei were positive for Ki67 staining, indicating that actively dividing cells are present after ~ 2 weeks of culture³⁴ (Fig. 3A). In conclusion, these data illustrate that SA can effectively replicate the structure and heterogeneity of a three-dimensional structure. In conclusion, this data indicates that 3% sodium alginate, when combined with calcium chloride, has the potential to serve as an alternative to the standard scaffold used to culture organoids, particularly bladder tumor organoids. This could potentially reduce the cost of tumor organoid culture and reduce the constraints of xeno-based BBMs in the context of large-scale applications.

Fig. 3.

Confocal microscopy images of bladder tumor organoids in different conditions. A Confocal microscopy to show the protein expression of specific bladder marker (CK20 in green), nucleolus with DAPI in blue and proliferation marker (KI67) in red for tumor organoids cultured in sodium alginate in compare with organoids cultured in BME in day 14. B Confocal microscopy to show the protein expression of specific bladder marker (UPKIIIA in green), nucleolus with DAPI in blue and proliferation marker (KI67) in red for tumor organoids cultured in BME scaffold and maintained with two different medium (FCM based VS standard medium).

Tumor organoid cultured in FCM based medium

Subsequently, to eliminate challenges in expansion bladder tumor organoids culture, we tried to resubstitute some of the many growth factors needed as expansion medium. In order to evaluate this hypothesis, we investigated the feasibility of incorporating fibroblast-secreted factors into the bladder organoid expansion medium culture. We attempted to use homemade FCM instead of three growth factors (FGF2, FGF7, and FGF10) described as standard protocol of bladder organoids culture^29,40. Applying conditioned medium along with organoids (conditioned medium transfer) categorized as indirect co-culture system, which resulted in higher complexity³⁵, here we used this approach to serve as an innovative method to decrease culture medium costing more than $2600.

To evaluate this hypothesis, bladder organoid culture media added with FCM was assessed for the production and characterization of a bladder tumor organoid model, in comparison to medium supplied with commercial growth factors. Two different medium compositions, medium named standard medium (Table 2), prepared based on the protocol obtained from Erasmus Medical Center, urology department and in FCM medium (fibroblast conditioned medium), the fibroblast growth factor 2, 7 and 10 replaced with optimum amount of FCM (Table 3) were prepared.

Table 2.

List of organoid culture medium reagents (Standard medium).

Reagents	Stock	Final concentration
B27	50x	2%
A83	20 mM	5 µM
FGF2 (only for standard medium)	125 µg/mL	12.5 ng/ml
FGF7 (only for standard medium)	250 µg/mL	25 ng/ml
FGF10 (only for standard medium)	0.5 mg/mL	100 ng/ml
N-acetylcysteine	500 mM	1.25 mM
Nicotinamide	1 M	10 mM
EGF	1 mg/ml	40 ng/ml
Primocin	–	1 ml in 500 ml of AdDMEM
Advanced DMEM/F12	–	Substituted: Glutamide 5 mL Hepes 5 mL Primocin 2 mL
Hydrogel Alginate	–	3%
calcium chloride	–	40 Mm
Collagenase 1 A	10 mg/ml	1 mg/mL
Dispase	–	1.90 U/mg
EBSS	–	–
Glutamine	–	1%
R-spondin Conditioned medium	–	2.5%
Rock Inhibitor/ Y-27,632	10 mM	1 µM
Wnt3a Conitioned medium	–	2.5%
Hepes	–	1%
DMEM high glucose	–	–
Pen/strep	–	1%
FBS	–	10%
Top up with Advanced DMEM/F12	–	To 40 ml

Table 3.

List of organoid culture medium reagent (FCM based medium).

Reagents	Stock	Final concentration
B27	50x	2%
A83	20 mM	5 µM
N-acetylcysteine	500 mM	1.25 mM
Nicotinamide	1 M	10 mM
EGF	1 mg/ml	40 ng/ml
Primocin	–	1 ml in 500 ml of AdDMEM
Advanced DMEM/F12	–	Substituted: Glutamide 5 mL Hepes 5 mL Primocin 2 mL
Hydrogel Alginate	–	3%
calcium chloride	–	40 Mm
Collagenase 1 A	10 mg/ml	1 mg/mL
Dispase	–	1.90 U/mg
EBSS	–	–
Glutamine	–	1%
R-spondin Conditioned medium	–	2.5%
Rock Inhibitor/ Y-27,632	10 mM	1 µM
Wnt3a Conitioned medium	–	2.5%
Hepes	–	1%
DMEM high glucose	–	–
Pen/strep	–	1%
FBS	–	10%
Top up with Fibroblast condition medium (FCM)	–	To 40 ml

To prepare medium with FCM composition, we isolated and cultured human dermal fibroblast (HDF), strongly adherent HDF cells shows the typical spindle-shape appearance, after 3 passages, flow cytometry analysis conducted to confirm characterization of fibroblast cells by evaluation of surface marker CD29 and CD73. Follow-up analysis using the FlowJo software showed expression 99.8 and 96.7%, respectively. Fibroblast cells in 70–80% confluency (Fig. 4C) were cultured and supernatant was collected after 3 days’ incubation, the supernatant then analyzed using FTIR and ELISA in compare with commercial FCM (Cellprogen^®, USA) as control. In this experiment, we used commercial FCM as control to compare the quality of fibroblast cell culture output with the standardized commercial FCM.

Fig. 4.

Analysis of tumor organoids maintained with home-made fibroblast conditioned medium (FCM. medium) in compare with organoids cultured in standard medium (Std. medium) prepared with commercial growth factors. A Tumor organoids from patient #06 cultured in BME (obtained from tissue) and maintained with Std. medium. B Same patient’s derived organoids maintained with FCM. Medium. C Flow cytometry analysis for CD73 and CD29 for fibroblast cells in passage 3, D Fourier Transform Infrared Spectroscopy (FTIR) analysis for home-made FCM (red line) and 25% commercial FCM (CellProgen© ) as ctrl (black line). E ELISA analysis to determine amount of FGF2, 7 and 10 in home-made FCM and comparison with diluted commercial FCM as ctrl. F RT-PCR analysis for eight genes on tumor organoids that maintained with standard medium VS home-made FCM base d medium, delta CT data normalized to Cyclophilin.

Regarding the quality of FCM collected from fibroblast cells to enrich the culture medium, FTIR and ELISA tests were conducted compared to commercial FCM as control. We were able to determine that the chemical compositions of the two FCM samples were comparable by analyzing the infrared absorption band intensity and substance concentration. Furthermore, we proceeded to analyze FGF2, FGF7, and FGF10 using ELISA, confirming and quantifying their presence in our homemade FCM to formulate the final composition of medium.

FTIR result showed in Fig. 4D, which black means control (commercial FCM) with peak related to the carbon-iodine bond in 565 cm⁻¹. The peak appearing in the region of 1088 is related to C-O stretching bond. A strong peak appearing in the region of 1639 is related to the stretching vibrations of C = C acyclic alkenes. The peak associated with the 2079 region is associated with N = C = S stretching vibrations, while the peak occurring in the 3459 region is associated with N-H amines of the second type. In contrast, the red graph illustrated the examination of the homemade FCM. The band (peak) corresponding to the carbon-iodine bond was detected in the 560 area, which is near the peak noted in the Ctrl group. C-N stretching bond was observed in the 1119 area. C-O peak of vinyl ether is related to symmetric and asymmetric stretching vibrations of 1043 and 1187 respectively, and the presence of a strong peak appearing in the region of 1639 is related to C = C stretching vibrations, which confirms this structure. The peak corresponding to the region 1461 is related to C-H aliphatic groups. The peak corresponding to region 2083 is related to N = C = S stretching vibrations, and the peak appearing in the region of 3448 is related to N-H amine of the second type. Comparing two peaks showed similarity in trend and most of peaks, although the home-made FCM (red line) has several additional peaks, which can be in terms of the sample purification and concentration.

The exact amounts of the three primary missing growth factors (FGF2, FGF7, and FGF10) in homemade FCM and in compare with commercial FCM have been further characterized by ELISA. In addition, this experiment was required to optimize the volume of homemade FCM in order to make bladder organoid media. Experiment was repeated for three times in triplicate, 347.4 pg/ml for FGF7, 201.9 pg/ml for FGF2 and 219.8 pg/ml for FGF10 obtained for homemade FCM and the difference was highly significant (P value ≤ 0.0001) for FGF7 (Fig. 4E). The standard curve was calculated for each growth factor and the R² = 0.9874, R² = 0.9901 and R² = 0.9936 for FGF7, FGF2 and FGF10, respectively (data not shown).

Consequently, the formulated medium was employed to culture the tumor organoids in comparison to the same patients’ organoids that were supplemented with standard medium containing commercial growth factors. Bright field microscopy was employed to observe the results in Fig. 4. After 14 days of embedding in BME, A and B exhibited comparable morphology in both mediums, exhibiting both solid spherical and luminal morphology.

Thus, culture efficiency of two different conditions (organoids supplemented with FCM based medium and standard medium contains commercial growth factor as control) have been assessed by passage number (Fig. 5A), and bio banking potential (Fig. 5B). The results reveal that tumor organoids remained viable after freezing, demonstrating significant promise for biobanking compared to the control group. Although the organoids cultured in standard medium showed highest 12 times (and 10 times in FCM based medium) passages but the difference between two groups were not statistically significant.

Fig. 5.

Combined strategy to show the SA scaffold and FCM based medium to culture bladder tumor derived organoids. A Culture efficiency and passage number of tumor organoids cultured in SA and FCM medium in compare with BME and Std medium as Ctrl. B Bio-banking potentials of tumor organoids cultured in SA vs. BME (C) Size measurement and growth rate comparison for tumor organoids cultured in SA and maintained with home-made FCM. Medium in compare with BME and Std medium^{3,7 and 10}. D & E RT-PCR analysis for tumor organoids cultured in SA that maintained home-made FCM base d medium, BME and Std medium as Ctr, delta CT data normalized to Cyclophilin. F Confocal microscopy to show the protein expression of specific bladder marker (UPKIIIA in green), nucleolus with DAPI in blue and proliferation marker (KI67) in red for tumor organoids cultured in sodium alginate and maintained with FCM based medium.

PDOs formed from both conditions expressed stemness markers, such as LGR5, CD44, CK5, and CK14³⁶. The pattern of gene expression showed the potential of FCM to preserve heterogeneity in PDOs (Fig. 4F).

The architecture, diameter, and molecular markers of patient-derived human bladder tumor tissue demonstrated accurate cellular assembly (Fig. 3B). Staining for KI67 (red fluorescence), a marker for proliferating cells, and CK20 (green fluorescence), indicative of the basal layer of the luminal subtype, exhibited correct localization and positive expression in both conditions.

Subsequently, we challenged our approach to serve as an innovative method to reduce the cost of organoid culture along with scale down the limitation of organoids in large scale studies, we combined two proposed changes in scaffold (sodium alginate matrix) and medium (FCM based medium) all together in compare with standard protocol which proposed applying BBMs derived matrix and highly pure commercial growth factors.

Further investigation showed that the combination of these two strategies can produce a reliable model. Given these data, shown in Fig. 5D & E in comparison to BME, the gene profile by RT-PCR of organoids embedded in sodium alginate and maintained with FCM-based medium was compared to organoids cultured in SA and maintained with standard medium.

The result indicated very similar expression in presence of SA and by using homemade FCM compared to standard medium, with no significant difference in expression, although the tumor organoid cultured in SA and maintained by homemade FCM showed slight variation but not significant, only CK14 as a marker of cancer-associated stem cells from basal like cells in standard medium was significantly higher than homemade FCM based medium (P value: 0.0307) which is may due precise downstream activation of commercial growth factor required for stem cell lineage (Fig. 5E). The presence of CK14 in bladder tumor organoids may highlight a subpopulation of tumor cells that resemble basal progenitor cells or cancer stem cells³¹. Doubling time (lower 5 times) and biobanking potential (21%) of tumor organoids cultured in SA and FCM-based medium also assessed and showed in Fig. 5A and B. Dimeter analysis (Fig. 5C) in different days showed PDOs grown in homemade FCM and commercial sourced growth factors had similar appearance and size.

Confocal microscopy of tumor organoids cultured in SA and sustained with FCM-based medium demonstrated consistent expression of CK20 and KI67 (Fig. 5F) and precise tumor organoid formation compared to organoids cultured in BME and maintained with standard medium³⁴.

Discussion

We developed a cost-reduction strategy to culture patient derived bladder tumor organoids through optimization and characterization of culture medium using alternative for some of the growth factors as long as applying sodium alginate in defined concentration against BME as gold standard.

While mechanical properties of sodium alginate can be varied in different concentration and different cross-linker and even time of crosslinking, in most of our work, we matched the stiffness of 3% sodium alginate to gold standard to be useable for organoid passaging and culture maintenance. Furthermore, sodium alginate has a highly porous network, essential for mechanotransduction, nutrient transport and cell-cell communication. Compared to BME (and other physically cross-linked gels), 3% sodium alginate had the clear benefit of being easy to prepare, having a specified concentration, and chemically crosslinking, which improved the organoid culture’s physical characteristics⁴⁶. The sodium alginate was mechanically stable during 14 days’ culture, supported stem cell marker expression, and further early differentiation to develop and mimic bladder tissue structure. While several hydrogels were developed, none have been validated for culture of bladder PDOs with characterization we showed here^18,19,37,38.

Notably, sodium alginate used here indicated an advantage for clinical application due to compatibility with FDA regulatory without xenogenic components which is supporting the morphological subtypes, size, and viability during culture that is commonly observed in BME.

The capacity for cell–matrix interactions in biomaterials facilitates the provision of a dynamic niche and directs stem cells in organoid culture³¹. The expression levels of bladder tissue markers were comparable between sodium alginate and BME; however, the expression of tissue-specific markers was markedly greater in BME-retained organoids. It should be noted that sodium alginate may maintain cell heterogeneity, as evidenced at both gene and protein levels. We demonstrated that 3% sodium alginate facilitates the initiation of bladder cancer patient-derived organoid (PDO) culture, corroborating findings from other studies that identify sodium alginate as a viable substitute for Matrigel/BME in the successful cultivation of human intestinal organoids (HIOs)¹⁷, lung organoids¹⁹, and spinal cord organoids³⁵, even at elevated passage numbers. However, the finding of our study indicated that sodium alginate may not be a suitable choice for long-term cultures of patient derived bladder tumor organoids. Overcoming this restriction³⁹ might be possible by sodium alginate functionalized with the arginyl glycyl aspartic acid (RGD) peptide and RGD-enriched alginate. Better physical support for stem cell proliferation and later organoid development comes from adhesion domains on the alginate scaffold created by RGD or laminin-111 sites. One of the main reasons for more successful organoid culture in MMPs is the presence of RGD sites in the components of BBMs, such as laminin^39,40. This interesting and potential solution will offer the basis of a separate study.

Organoid cultured in sodium alginate were less spherical/cystic morphology, this spheroid being associated with an immature phenotype, and a high proliferation rate in other types of organoids such as intestine⁴¹.

We have further showed the application of dermal fibroblast conditioned medium to culture patient derived bladder organoid. We propose that using tumor organoid formulated with defined amount of FCM will prompt the application of organoid in high throughput screening which needs large scale and cost-effective culture condition^42,43.

Importantly, we found no differences in tumor organoid growth rate, diameter, or viability, or even in the location of tissue-specific gene expression and markers within the organoids in media prepared using either commercially available growth factors or homemade FCM⁴⁴. We further show the ability of media formulated containing FCM to tolerate freezing procedure and bio banking of organoids.

In the absence of 3 types of FGFs, human bladder organoids underwent growth arrest after 10 population doublings which indicate that removal of mentioned GFs from the culture medium limited their growth potential for long term culture.

Indeed, in our experiment we finally combined two proposed alternative strategies to replace matrix and commercial growth factors with together to show the potential of development conjunction protocol may lead well-defined cost effective organoid culture system without xeno based impurities. Here, we showed that PDO characteristics are preserved in sodium alginate with FCM-based media for four passes, making it appropriate for the development of personalized cancer treatments, early-stage drug screening, and start culture. We note that starting culture with BME in P0 followed by sub-cultured in sodium alginate can improve potential of doubling and bio-banking.

In summary, two mentioned strategies as detailed in the current study provide a rational framework for the development of patient derived bladder tumor organoids. While researcher critically recognized the fact that there are limits to all organoid models^45,46, there is growing interest in the test of alternative substitutes to build more accessible and reproducible as long as physiologically relevant three-dimensional structures⁴⁷.

Conclusion

In general, we present in this report a 3D organoid system that supports tumor bladder organoids culture and grow with the potential for the applications in disease modeling, early stage drug screening, clinical translation and regenerative medicine. Hydrogels with adjustable features, along with techniques from indirect co-culture systems, such as transferring conditioned media into organoid cultures, may provide a way to mitigate various limitations in the costly cultivation of organoids. The culture of bladder organoids in sodium alginate scaffold and medium enriched with FCM in our investigation is the first to be characterized, lasting 14 days. This preclinical model has the potential to serve as a promising instrument for translational implementation and preclinical modeling, scale-up study and high throughput drug screening in cancer research.

Abbreviations

PDO

Patient derived organoid

ECM

Extracellular matrix

BMMs

Basement membrane matrices

FCM

Fibroblast conditioned medium

3D

Three-dimensional

FGFs

Fibroblast growth factors

MMPs

Matrix metalloproteinases

TGF-β

Transforming growth factor beta

EGF

Epidermal growth factor

PBS

Phosphate-buffered saline

PFA

Paraformaldehyde

Alg

Alginate

NAC

N-acetylcysteine

NIC

Nicotinamide

BME

Basement membrane extract

FBS

Fetal bovine serum

SEM

Scanning electron microscopy

FTIR

Fourier transform infrared spectroscopy

BLCa

Bladder urothelial carcinoma

NMIBC

Non-muscle invasive bladder cancer

MIBC

Muscle invasive bladder cancer

SA

Sodium alginate

PEG

Polyethylene glycol

PVA

Polyvinyl alcohol

PolyHEMA

Poly (hydroxyethyl methacrylate)

PCL

Polycaprolactone

RGD

Arginyl glycyl aspartic acid

HIO

Human intestinal organoid

AUM

Asymmetric unit membrane

Author contributions

Mahsa Mollapour Sisakht: Writing – original draft, Project administration, Methodology, Investigation, Data curation, Formal analysis, Conceptualization. Fatemeh Gholizadeh: Writing – original draft, Methodology, Investigation. Shirin Hekmatirad: Writing – original draft, Methodology, Investigation. Tokameh Mahmoudi: Conceptualization, Writing – review & editing, Saeed Montazeri: Methodology, Investigation. Laleh Sharifi: Methodology, Investigation. Hamed Daemi: Methodology, Investigation, Conceptualization. Shahla Romal: Methodology, Investigation. Mohammad Hosein Yazdi: Writing – review & editing, Validation. Ahmad Reza Shahverdi: Writing – review & editing, Validation, Data curation. Mohammad Ali Faramarzi: Writing – review & editing, Validation and Data curation. Amir Ali Hamidieh: Writing – review & editing, Visualization, Validation, Methodology, and Conceptualization.

Data availability

The data used to support the findings of this study are included within the manuscript. Additional microscopy data reported in this paper will be shared by the lead contact upon request. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. Further information and requests for resources and reagents should be directed to the lead contact, Dr. Mahsa Mollapour Sisakht (mmollapour@farabi.tums.ac.ir).

Declarations

Competing interests

The authors declare no competing interests.