Skip to main content
NCBI home page
Journal of Cancer Research and Clinical Oncology logoLink to Journal of Cancer Research and Clinical Oncology
. 2023 May 1;149(11):8711–8718. doi: 10.1007/s00432-023-04822-y

Impacts of potential anticancer agents based on pillar[5]arene for head and neck squamous cell carcinoma cells

Serkan Kuccukturk 1, Mehmet Ali Karaselek 2, Tugce Duran 3, Ahmed Nuri Kursunlu 4, Mustafa Ozmen 4,✉
PMCID: PMC11798307  PMID: 37126106

Abstract

Purpose

This study was conducted to investigate impacts of potential anticancer (associated with apoptosis and caspase pathways) of two newly synthesized derivatives of pillar[5]arene, named as d-Q-P5 and p-Q-P5, on Squamous cell carcinomas of the head and neck (HNSCC) cells.

Materials and methods

The MTT method was used to determine the IC50 doses of the derivatives on HNSCC cells, and the changes in gene expression were analyzed by real-time polymerase chain reaction (qPCR). The apoptosis change was confirmed by flow cytometry analysis.

Results

The results showed that the d-Q-P5 and p-Q-P5 effectively inhibited the proliferation of the cells by upregulating proapoptotic genes (Bax, Bad, p53, Bak, and Apaf-1) and genes involved in the caspase pathway (Casp2, Casp3, and Casp9), while downregulating the antiapoptotic gene (Bcl-2).

Conclusions

This study is the first to demonstrate the potential anticancer effects of these two agents on HNSCC cells by positively regulating apoptosis gene expression.

Keywords: Head and neck squamous cell carcinoma, Pillar[5]arene, Apoptosis, Caspase

Introduction

Cancer has become an important public health problem with its incidence increasing every year. One of these cancers is squamous cell carcinoma of the head and neck (HNSCC), which consists of a group of tumors originating from the epithelium of the oral cavity and pharynx (Solomon et al. 2018). HNSCCs are the sixth most common cancer worldwide, and their incidence is estimated to rise by 30% with about 1.08 million new cases per year by 2030 (Ferlay et al. 2019; Johnson et al. 2020), with varying prevalence across different regions (Bray et al. 2018). In Southeast Asia and Australia, the high prevalence of HNSCCs is associated with exposure to carcinogenic products (Hashibe et al. 2007), while in the USA and Western Europe, the increasing incidence is linked to human papillomavirus (HPV) infections (Mehanna et al. 2013; Michaud et al. 2014). The International Agency for Research on Cancer (IARC) of the World Health Organization (WHO) has identified various risk factors in the development of HNSCCs, including tobacco and tobacco products, alcohol consumption, environmental pollution, and HPV (Human Papilloma virus) and EBV (Epstein-Barr virus) infections (Thun et al. 2010). The molecular characterization of cancer cells, such as HNSCC, has led to the development of better treatment options including chemotherapy, immunotherapy, and cancer vaccines (Sarode et al. 2022; Wang et al. 2021). However, progress in treating HPV-negative HNSCC has been limited over the past decade. As a result, it is necessary to investigate new candidate agents for treating HNSCC. Although several treatment options exist for localized HNSCCs, such as surgery, radiotherapy, chemotherapy, immunotherapy, and radiotherapy plus immunotherapy (Bonner et al. 2006; De Felice and Bossi 2022; de Sousa and Ferrarotto 2021; Johnson et al. 2020), the increasing incidence of HNSCCs underscores the need for new therapeutic agents.

Cancer drug research in recent years is targeted research and is aimed at eliminating specific cancer cells. It is thought that one of these candidates has pillar[n]arenes derivatives. Pillar[n]arenes have emerged as a new and important class of macrocyclic compounds since their discovery in 2008, with potential applications in pharmacology, biochemistry, and medicine (Bastug et al. 2020; Kursunlu et al. 2019, 2020; Ogoshi et al. 2008). It is known that the functionalization of macrocyclic compounds with organic groups with pharmacological functions plays a very important role in the anticancer activity of these substances (Gunes et al. 2020). Quinolines and their derivatives are known to exhibit various biological activities, including antimalarial, analgesic, antibacterial, anti-inflammatory, anticancer, antineoplastic, antifungal, and anthelmintic activity. These compounds are found in several natural products and are used as building blocks in general synthesis, as well as in agrochemical applications (Kursunlu et al. 2017). Therefore, in this study, we synthesized quinoline-derived pillar[5]arene molecules. Previous research has examined the cytotoxic impact on the apoptotic process of various forms of pillar[5]arene on cancer cell lines such as LnCap, Caco-2, MDA-MB-231, and HepG2 (Gunes et al. 2020; Liman et al. 2022). However, no studies have yet been conducted on the effects of pillar[5]arene derivatives on HNSCC cell lines. Therefore, it is essential to investigate these compounds as potential new anticancer agents. The goal of this study is to explore the effects of two synthesized potential anticancer agents, d-Q-P5 and p-Q-P5 pillar[5]arene derivatives, on the processes of apoptosis and caspase pathways in HNSCC cancer cell lines by examining changes in gene expression.

Materials and methods

Chemicals

The compounds 1,4-bis(2-bromoethoxy)benzene and 1-(3-chloropropoxy)-4-methoxybenzene, along with the macrocyclic reagents Br-P5 and Cl-P5, were prepared using a previously described synthesis protocol (Kursunlu et al. 2017; Liman et al. 2022). The resulting macrocycles d-Q-P5 and p-Q-P5 were then synthesized, and stored solutions dissolving in dimethyl sulfoxide (DMSO) for further experimentation.

The synthesis of d-Q-P5 and p-Q-P5

The compounds were synthesized with a known procedure (Karaselek et al. 2023). The synthesis steps of d-Q-P5 and p-Q-P5 macrocyclic compounds have been shown in Fig. 1. In 1H-NMR of target compounds, the proton peaks of d-Q-P5 and p-Q-P5 agents appeared in the expected ppm values. The aromatic region protons on the main skeleton of the molecules and quinoline units appeared around 6.99–8.55 ppm while five protons of bridge-CH2 fragments were observed at 3.85–3.80 ppm. These results were also supported with the 13C-NMR spectra of the compounds.

Fig. 1.

Fig. 1

Open in a new tab

The synthesis route of d-Q-P5 and p-Q-P5 agents

Cell culture

The HNSCC cancer cell lines were procured from the American Type Culture Collection (ATCC, Rockville, Maryland 20,852, USA). These cell lines were cultivated in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, Gibco, Thermo Fisher) and 1% penicillin/streptomycin antibiotic solution (Sigma-Aldrich, St. Louis) at 37 °C and 5% CO2. The HNSCC cancer cell lines were treated with solutions of d-Q-P5 and p-Q-P5 at determined concentrations (15.62, 31.25, 62.5, 125, 250, and 500 µM) for 24, 48, and 72 h. In the control group where d-Q-P5 and p-Q-P5 were not administered, at least five wells were used for each dose.

Cytotoxicity assay

The MTT assay was carry out to measure the cytotoxicity of d-Q-P5 and p-Q-P5 in the HNSCC cell lines at different fixed times (24 h, 48 h, and 72 h). The proportion of live (viable) was determined using an absorbance value of 480 nm in 1 × PBS. The IC50 values for d-Q-P5 and p-Q-P5 were calculated after the initial 24 h measurement. Thermo Scientific equipment was used for the measurements.

Isolation of RNA and cDNA synthesis

QIAzol (Qiagen, India) was used to extract total RNA from cells and then the cDNA synthesis was carried out using the Revertaid First Strand cDNA Synthesis Kit according to established procedures.

Quantitative real-time polymerase chain (qPCR) analysis

Using the qPCR method, the effects of the synthesized macrocycles, d-Q-P5 or p-Q-P5, on the apoptosis and caspase pathway were assessed by changes in gene expression. Specific primers for genes involved in this pathway, including Bad, Bak, Bax, Bcl-XL, Bcl-2, p53, Casp2, Casp3A, Casp6, Casp9, Casp12 and Apaf-1, were designed using IDT PrimerQuest (Table 1).

Table 1.

Primers of genes used in qPCR analysis

Gene Primer pairwise (5′–3′)
Bax F: CCCGAGAGGTCTTTTTCCGAG
R: CCAGCCCATGATGGTTCTGAT
Bad F: CCCAGAGTTTGAGCCGAGTG
R: CCCATCCCTTCGTCGTCCT
Bak F: CATCAACCGACGCTATGACTC
R: GTCAGGCCATGCTGGTAGAC
p53 F: CAGCACATGACGGAGGTTGT
R: TCATCCAAATACTCCACACGC
Bcl-2 F: GGTGGGGTCATGTGTGTGG
R: CGGTTCAGGTACTCAGTCATCC
Bcl-XL F: GAGCTGGTGGTTGACTTTCTC
R: TCCATCTCCGATTCAGTCCCT
Apaf-1 F: AAGGTGGAGTACCACAGAGG
R: TCCATGTATGGTGACCCAT
Casp2 F: AGC TGT TGT TGA GCG AAT TGT
R: AGC AAG TTG AGG AGT TCC ACA
Casp3A F: CATGGAAGCGAATCAATGGACT
R: CTGTACCAGACCGAGATGTCA
Casp9 F: CTCAGACCAGAGATTCGCAAAC
R: GCATTTCCCCTCAAACTCTCAA
Casp12 F: AACAACCGTAACTGCCAGAGT
R: CTGCACCGGCTTTTCCACT
Casp6 F: GAGGAGGGCAAGGTGTCTGG
R: GTTTTCTTCCCCACCTGCCG
GAPDH F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCAT
Open in a new tab

*Primers were designed using IDT PrimerQuest

The qPCR reaction was carried out using the HibriGen 2X SYBR Green Master Mix. For each gene, a reaction was prepared at 10 µL containing 5 µL of the SYBR green mix, 5 pmol of primary pairwise, and 2 µL of cDNA. Initial activation from the PCR steps was set at 95 °C for 10 s in denaturation, then each step of 40 cycles followed by denaturation of 95 °C for 15 s, annealing for 30 s at 57 °C.

Apoptosis analysis by flow cytometry

The impact of apoptosis with d-Q-P5 or p-Q-P5 in HNSCC cells was evaluated using the APC Annexin V Apoptosis Detection Kit with Propidium Iodide (PI) from BioLegend Inc., San Diego. After determining the appropriate application time and dose, the cells were washed out of cold cell staining buffer at 1 × 106 cells/mL, and the resulting pellet was suspended in 100 µL of Annexin V binding buffer. APC Annexin V/PI was added (vol 1:2) to the suspension and the cells were incubated for 15–20 min/25 °C in a room without light. After the incubation, 400 µL of Annexin V conjugate/binding buffer was added to each sample. The cell count was performed using a Becton–Dickinson Canto II flow cytometry device and by the FACSDiva software v 6.1.3.

Statistical analysis

The reference gene, GAPDH, was utilized for normalization in this study. To determine relative gene expression, the comparative Livak’s ΔΔCT method was employed (Livak and Schmittgen 2001). Cancerous (treated with p-Q-P5 and d-Q-P5) and control group comparisons were made using the student's t-test in the Statistical Package for Social Sciences software, version 21 (IBM SPSS Corp.; Armonk, NY, USA). ΔCt values were utilized in the analyses after normalization, and p < 0.05 value was considered as the statistical significance. Volcano plots were generated using VolcaNoseR (Goedhart and Luijsterburg 2020).

Results

Cytotoxicity analysis

To evaluate the impact of d-Q-P5 and p-Q-P5 on HNSCC cell line proliferation, an MTT assay was performed. The IC50 values for d-Q-P5 and p-Q-P5 were identified as 500 μM and 62.5 μM, respectively, for a 24-h period, based on the MTT cell viability analysis (as shown in Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

MTT analysis results of p-Q-P5 (a) and d-Q-P5 (b)

qPCR results of apoptotic and caspase pathway analysis

The mRNA expressions of all the genes were evaluated with analysis results of qPCR in the HNSCC cell lines after treatment with d-Q-P5 and p-Q-P5. The qPCR data are presented in Fig. 3. Expression results of qPCR showed that treatment with p-Q-P5 increased the proapoptotic genes such as Bax, Bad, Bak, p53, and Apaf-1 by 1.42-fold, 5.41-fold, 3.90-fold, 7.04-fold, and 3.04-fold, respectively, while decreasing the antiapoptotic gene Bcl-2 by 1.88-fold when compared to the non-treated group. Although the increase in Bax and Bcl-XL genes was not significant (p > 0.05), the increase in Bad, Bak, p53, Apaf-1, or the decrease in Bcl-2 was significant (p < 0.05).

Fig. 3.

Fig. 3

Open in a new tab

Changes in the expression of genes involved in apoptosis and caspase pathway after p-Q-P5 application in HNSCC cells compared to the control group (*p < 0.05)

When comparing the expression of caspase pathways between the p-Q-P5-treated and non-treated groups, it was found that p-Q-P5 treatment increased the expressions of Casp2 (3.85-fold), Casp3A (1.23-fold), and Casp9 (3.16-fold), while causing a decrease in the Casp6 (1.38-fold) and Casp12 (1.02-fold). The increase in caspases was significant (p < 0.05), but the decrease in Casp6 and Casp12 was not significant (p > 0.05) as shown in Fig. 3.

In the comparison of apoptotic gene expression between the d-Q-P5-treated and non-treated groups, the d-Q-P5-treated group showed increased Bad (1.78-fold), Bak (2.01-fold), Bcl-XL (2.63-fold), and p53 (1.18-fold) while it caused a decrease in Apaf-1 (2.66-fold), Bax (1.58-fold), and Bcl-2 (1.54-fold) gene expressions. The increase in gene expressions was significant (p < 0.05), except for Bcl-XL, while the decrease in gene expression was significant (p < 0.05), except for Apaf-1, Bcl-2, and Bax (p > 0.05).

When comparing the caspase pathways in the d-Q-P5-treated group and the non-treated group, the d-Q-P5-treated showed an increase in Casp2 (2.67-fold), Casp3A (2.32-fold), Casp9 (1.82-fold), and Casp6 (1.05-fold) gene expressions, while causing a decrease in Casp12 (1.01-fold) gene expression. The increase in Casp2, Casp3A, and Casp9 gene expressions was significant (p < 0.05), while the increase in Casp6 and the decrease in Casp12 gene expressions were not significant (p > 0.05) (as shown in Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Changes in the expression of genes involved in apoptosis and caspase pathway after d-Q-P5 application in HNSCC cells compared to the control group (*p < 0.05)

Apoptosis analysis

The impact on the apoptotic process of d-Q-P5 and p-Q-P5 on HNSCC cell lines was assessed using Annexin V/PI flow cytometry. The cells that entered early apoptosis were described as Annexin V + , and the cells that entered late apoptosis were described as Annexin V + and PI + cells. In addition to apoptotic cells, necrotic cells were described as the PI + group. It was gained from the flow cytometry results that the rate of early apoptosis was 8.9% and 10.2%, the rate of late apoptosis was 0.1% and 2.1%, and the rate of necrotic cells was 0.1% and 1.9% for each control group of d-QP5 and p-QP5, respectively (Fig. 5). In contrast, in the group treated with p-Q-P5 at a concentration of 62.5 µM, the rate of early apoptosis was 66.7%, the rate of late apoptosis was 22.1%, and the rate of necrotic cells was 2.5%. In the group treated with d-Q-P5 at a concentration of 62.5 µM, the rate of early apoptosis was 47.6%, the rate of late apoptosis was 29.9%, and the rate of necrotic cells was 1.1% (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

Flow cytometry apoptosis image after derivates of pillar[5]arene application (A control group for p-Q-P5, B control group for d-Q-P5, C p-Q-P5 treated group, D d-Q-P5 treated group)

Discussion

In this study, we examined two forms of pillar[5]arene, a novel molecule, to determine their effects on gene expressions involved in apoptosis and caspase pathways in HNSCC cell lines. Our findings suggest that the synthesized macrocycles have the potential to be developed into next-generation anticancer drugs by promoting apoptosis and caspase pathway.

Pillar[5]arenes are a type of macrocyclic molecule that has gained attention in supramolecular chemistry due to their unique chemical properties (Cragg and Sharma 2012; Fahmy et al. 2021; Guo et al. 2018; Ogoshi et al. 2008; Wang et al. 2022). Recent studies have suggested that they may also have potential as anticancer agents, although research in this area is still limited. One water-soluble form of pillar[5]arene-glutamamide has been found to have minimal impact on cell viability in both normal and cancer cells (Guo et al. 2017), while another study has reported that pillar[5]arene selectively targets cancer cell membranes, leading to their destruction (Chang et al. 2019). Our own research team conducted a study to investigate the cytotoxic and apoptotic process of two different types of pillar[5]arene (asym-P5 and sym-P5) on various cancers (hepatocellular carcinoma, adenocarcinoma, colon carcinoma, and prostate cancer). In that study, it was reported that the ratio of apoptotic cells increased significantly along with the decrease of the cell viability in all cell lines and a dose-dependent manner (Liman et al. 2022). In another study conducted by our study team investigating the anticancer effects of pillar[5]arene on MCF-7 human breast cancer cells, it was reported that it had an anticancer effect by increasing the expression of genes in the pathway of apoptosis (Gunes et al. 2020). Guo et al. reported that the hydrazide-pillar[5]arene complex inhibited the proliferation of hepatoma carcinoma cells. In addition, in the same study, it was shown that the undesirable effects of using hydrazide alone were reduced when used as a hydrazide-pillar[5]arene complex. In that study, it has been shown that pillar[5]arene is a versatile molecule that can be used with other agents in addition to its anticancer effect (Guo et al. 2021). Although there are studies on pillar[5]arene on many cell lines in the literature, there is no study on the HNSCC cancer cell lines. Our study is the first study in this field and revealed the anticancer effect of d-Q-P5 and p-Q-P5 in the HNSCC cancer cell line. The anticancer effects of p-Q-P5 were evaluated by MTT analysis (Liman et al. 2022). IC50 values for asym-P5 in HepG2, MDA-MB-231, Caco-2, LnCap, and HEK293 cell lines were 22.4, 21.57, 23.42, 38.01, and 26.57 μM, respectively. IC50 values for sym-P5 in HepG2, MDA-MB-231, Caco-2, LnCap, and HEK293 cell lines were 266.94, 156.41, 181.55, 214.04, and 191.65 respectively (Liman et al. 2022). In our study, the IC50 dose was determined as 62.5 μM for p-Q-P5 and 500 μM for d-Q-P5 at 24 h. Although the IC50 dose of p-Q-P5 was similar to other studies in the literature, the IC50 dose for d-Q-P5 was higher. Since the new drug, p-Q-P5 has a lower IC50 dose; it is more preferred for HNSCC than the IC50 dose of phenformin in the HNSCC cancer cell line was found as 1.5 mM and 3 µg/mL in different studies (Kaomongkolgit et al. 2011; Seo et al. 2019).

Both p-Q-P5 and d-Q-P5 showed an excellent anticancer effect on HNSCC cancer cell lines by increasing gene expression. The apoptosis occurs either by the cell’s intrinsic or extrinsic pathway. Cytochrome c released from mitochondria is an important intrinsic component and the Bcl-2 protein family has vital importance in this process. In addition, the tumor suppressor protein p53 causes the activation of proapoptotic genes like Bax in cells with DNA damage. Cytochrome-c, which forms a complex with Apaf-1 in the cytosol, cleaves the initiator caspase-9. Then, the executioner caspases 3, 6, and 7 which induce cell death are activated (Wuest et al. 2019). In our study, the expression of Bad, Bak, Bax, p53, Apaf-1, Casp2, Casp3, and Casp9 was upregulated in the p-Q-P5 group compared to the control group, whereas Bcl-2, Caps6, and Casp12 expressions were downregulated. In the group to which d-Q-P5 is added, Bad, p53, Bak, Casp2, Casp3, Caps6, and Casp9 gene expressions were upregulated, while Bcl-2, Apaf-1, and Casp12 were downregulated. It was conspicuous that the derivatives of pillar[5]arene can induce apoptosis by stimulating caspase activation with proapoptotic gene expressions in the HNSCC cancer cell line. However, since the fold increase in these gene expressions was higher in the p-Q-P5 group and it has a lower IC50 dose, the p-Q-P5 may be considered a better anticancer agent.

Conclusion

The aim of this study was to investigate the impacts of potential anticancer of two different pillar[5]arene molecules, d-Q-P5 and p-Q-P5, in HNSCC cancer cells. The results showed that these derivatives could induce apoptosis and inhibit tumor growth by upregulating the genes in the apoptosis pathway. These findings suggest that d-Q-P5 and p-Q-P5 have the potential to be used as anticancer agents for HNSCC. Nevertheless, further research is necessary to define the mechanisms and effectiveness of these compounds in treating cancer.

Author contributions

SK and TD contributed to anticancer activity experiments. MAK contributed to apoptosis experiments, methodology, writing—review & editing. ANK contributed to synthesis, methodology, writing—review & editing. MO contributed to characterization, methodology, writing—review & editing. The final version of the manuscript was read and approved by all the authors.

Funding

The study was supported by Necmettin Erbakan University (Project Number: 221218015).

Availability of data and materials

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Conflict of interest

The authors declare that they have no conflicts of interest or competing interests.

Ethical approval

Not applicable.

Research involving human and animal participant

The study was performed on commercially available cell lines, not on living organisms.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Bastug E, Kursunlu AN, Guler E (2020) A fluorescent clever macrocycle: Deca-bodipy bearing a pillar [5]arene and its selective binding of asparagine in half-aqueous medium. J Lumin 225:117343 [Google Scholar]
  2. Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, Cohen RB, Jones CU, Sur R, Raben D, Jassem J et al (2006) Radiotherapy plus cetuximab for squamous-cell carcinoma of the head and neck. N Engl J Med 354(6):567–578 [DOI] [PubMed] [Google Scholar]
  3. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68(6):394–424 [DOI] [PubMed] [Google Scholar]
  4. Chang Y, Chen JY, Yang J, Lin T, Zeng L, Xu JF, Hou JL, Zhang X (2019) Targeting the cell membrane by charge-reversal amphiphilic pillar[5]arene for the selective killing of cancer cells. ACS Appl Mater Interfaces 11(42):38497–38502 [DOI] [PubMed] [Google Scholar]
  5. Cragg PJ, Sharma K (2012) Pillar[5]arenes: fascinating cyclophanes with a bright future. Chem Soc Rev 41(2):597–607 [DOI] [PubMed] [Google Scholar]
  6. De Felice F, Bossi P (2022) Pembrolizumab with or without chemotherapy in recurrent or metastatic head and neck squamous cell carcinoma: Hypothesis coming from the subgroup analysis. Oral Oncol 137:106275 [DOI] [PubMed] [Google Scholar]
  7. de Sousa LG, Ferrarotto R (2021) Pembrolizumab in the first-line treatment of advanced head and neck cancer. Expert Rev Anticancer Ther 21(12):1321–1331 [DOI] [PubMed] [Google Scholar]
  8. Fahmy SA, Ramzy A, Saleh BM, El-Said Azzazy HM (2021) Stimuli-responsive amphiphilic pillar[n]arene nanovesicles for targeted delivery of cancer drugs. ACS Omega 6(40):25876–25883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ferlay J, Colombet M, Soerjomataram I, Mathers C, Parkin DM, Piñeros M, Znaor A, Bray F (2019) Estimating the global cancer incidence and mortality in 2018: GLOBOCAN sources and methods. Int J Cancer 144(8):1941–1953 [DOI] [PubMed] [Google Scholar]
  10. Goedhart J, Luijsterburg MS (2020) VolcaNoseR is a web app for creating, exploring, labeling and sharing volcano plots. Sci Rep 10(1):20560 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gunes CE, Karaselek MA, Kursunlu AN, Ozmen M, Kurar E (2020) Synthesis and evaluation of anticancer effect of a novel molecule based-on pillar[5]arene including multi quinoline units. Med Chem Res 29(6):1077–1083 [Google Scholar]
  12. Guo S, Liang T, Song Y, Cheng M, Hu XY, Zhu JJ, Wang L (2017) Supramolecular polymersomes constructed from water-soluble pillar[5]arene and cationic poly(glutamamide)s and their applications in targeted anticancer drug delivery. Polym Chem 8(37):5718–5725 [Google Scholar]
  13. Guo F, Sun Y, Xi B, Diao G (2018) Recent progress in the research on the host-guest chemistry of pillar[n]arenes. Supramol Chem 30(2):81–92 [Google Scholar]
  14. Guo F, Xia T, Xiao P, Wang Q, Deng Z, Zhang W, Diao G (2021) A supramolecular complex of hydrazide-pillar[5]arene and bisdemethoxycurcumin with potential anti-cancer activity. Bioorg Chem 110:104764 [DOI] [PubMed] [Google Scholar]
  15. Hashibe M, Brennan P, Benhamou S, Castellsague X, Chen C, Curado MP, Maso LD, Daudt AW, Fabianova E, Wünsch-Filho V et al (2007) Alcohol drinking in never users of tobacco, cigarette smoking in never drinkers, and the risk of head and neck cancer: pooled analysis in the International head and neck cancer epidemiology consortium. J Natl Cancer Inst 99(10):777–789 [DOI] [PubMed] [Google Scholar]
  16. Johnson DE, Burtness B, Leemans CR, Lui VWY, Bauman JE, Grandis JR (2020) Head and neck squamous cell carcinoma. Nat Rev Dis Primers 6(1):92 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kaomongkolgit R, Chaisomboon N, Pavasant P (2011) Apoptotic effect of alpha-mangostin on head and neck squamous carcinoma cells. Arch Oral Biol 56(5):483–490 [DOI] [PubMed] [Google Scholar]
  18. Karaselek MA, Kuccukturk S, Duran T, Kursunlu AN, Ozmen M, Bozdag C, Alkan S, Varman A, Yildirim MA, Kucukkartallar T et al (2023) Effective anticancer agents based-on two Pillar[5]arene derivatives for pancreas cancer cell lines: synthesis, apoptotic effect, caspase pathway. Invest New Drugs. 10.1007/s10637-023-01343-w [DOI] [PubMed] [Google Scholar]
  19. Kursunlu AN, Acikbas Y, Ozmen M, Erdogan M, Capan R (2017) Preparation of pillar[5]arene-quinoline Langmuir-Blodgett thin films for detection of volatile organic compounds with host–guest principles. Analyst 142(19):3689–3698 [DOI] [PubMed] [Google Scholar]
  20. Kursunlu AN, Acikbas Y, Ozmen M, Erdogan M, Capan R (2019) Haloalkanes and aromatic hydrocarbons sensing using Langmuir-Blodgett thin film of pillar[5]arene-biphenylcarboxylic acid. Colloids Surf Physicochem Eng Asp 565:108–117 [Google Scholar]
  21. Kursunlu AN, Acikbas Y, Ozmen M, Erdogan M, Capan R (2020) Fabrication of LB thin film of pillar[5]arene-2-amino-3-hydroxypyridine for the sensing of vapors. Mater Lett 267:127538 [Google Scholar]
  22. Liman R, Kursunlu AN, Ozmen M, Arslan S, Mutlu D, Istifli ES, Acikbas Y (2022) Synthesis of water soluble symmetric and asymmetric pillar[5]arene derivatives: cytotoxicity, apoptosis and molecular docking studies. J Mol Struct 1265:133482 [Google Scholar]
  23. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25(4):402–408 [DOI] [PubMed] [Google Scholar]
  24. Mehanna H, Beech T, Nicholson T, El-Hariry I, McConkey C, Paleri V, Roberts S (2013) Prevalence of human papillomavirus in oropharyngeal and nonoropharyngeal head and neck cancer—systematic review and meta-analysis of trends by time and region. Head Neck 35(5):747–755 [DOI] [PubMed] [Google Scholar]
  25. Michaud DS, Langevin SM, Eliot M, Nelson HH, Pawlita M, McClean MD, Kelsey KT (2014) High-risk HPV types and head and neck cancer. Int J Cancer 135(7):1653–1661 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Ogoshi T, Kanai S, Fujinami S, Yamagishi TA, Nakamoto Y (2008) para-bridged symmetrical pillar[5]arenes: their Lewis acid catalyzed synthesis and host–guest property. J Am Chem Soc 130(15):5022–5023 [DOI] [PubMed] [Google Scholar]
  27. Sarode GS, Kumari N, Gophane R, Ghone U, Sharma N, Sarode SC (2022) Trends and prospects in oral cancer vaccine. Oral Oncol 133:106051 [DOI] [PubMed] [Google Scholar]
  28. Seo YS, Kim TH, Lim H, Oh JS, You JS, Lee GJ, Yu SK, Kim DK, Kim HJ, Kim CS et al (2019) Phenformin induces caspase-dependent apoptosis of FaDu head and neck squamous cell carcinoma cells. Anticancer Res 39(7):3499 [DOI] [PubMed] [Google Scholar]
  29. Solomon BJ, Young RJ, Rischin D (2018) Head and neck squamous cell carcinoma: genomics and emerging biomarkers for immunomodulatory cancer treatments. Semin Cancer Biol 52(Pt 2):228–240 [DOI] [PubMed] [Google Scholar]
  30. Thun MJ, DeLancey JO, Center MM, Jemal A, Ward EM (2010) The global burden of cancer: priorities for prevention. Carcinogenesis 31(1):100–110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang X, Wu S, Liu F, Ke D, Wang X, Pan D, Xu W, Zhou L, He W (2021) An immunogenic cell death-related classification predicts prognosis and response to immunotherapy in head and neck squamous cell carcinoma. Front Immunol 12:781466 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wang Y, Wang D, Wang J, Wang C, Wang J, Ding Y, Yao Y (2022) Pillar[5]arene-derived covalent organic materials with pre-encoded molecular recognition for targeted and synergistic cancer photo- and chemotherapy. ChemComm 58(11):1689–1692 [DOI] [PubMed] [Google Scholar]
  33. Wuest M, Perreault A, Richter S, Knight JC, Wuest F (2019) Targeting phosphatidylserine for radionuclide-based molecular imaging of apoptosis. Apoptosis 24(3):221–244 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Articles from Journal of Cancer Research and Clinical Oncology are provided here courtesy of Springer

RESOURCES