Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2025 Feb 6;20(2):e0315938. doi: 10.1371/journal.pone.0315938

Prevalence and antibiotic resistance of Escherichia coli in urban and peri-urban garden ecosystems in Bangladesh

Pritom Kumar Pramanik 1,#, M Nazmul Hoque 2,#, Md Liton Rana 1, Md Saiful Islam 1, Md Ashek Ullah 1, Fahim Haque Neloy 1, Srinivasan Ramasamy 3, Pepijn Schreinemachers 4, Ricardo Oliva 3, Md Tanvir Rahman 1,*
Editor: Bilal Aslam5
PMCID: PMC11801607  PMID: 39913417

Abstract

In the past decade, there has been a notable rise in foodborne outbreaks, prominently featuring Escherichia coli as a primary pathogen. This bacterium, known for its prevalence in foodborne illnesses and as a reservoir of antimicrobial resistance, was isolated from raw vegetables, soil, and water samples collected from rooftop and surface gardens in urban (Dhaka North City Corporation; DNCC and Dhaka South City Corporation; DSCC) and peri-urban (Gazipur City Corporation; GCC) areas of Bangladesh. In this study, 145 samples including vegetables (n = 88), water (n = 27) and soils (n = 30) from DNCC (n = 85), DSCC (n = 30), and GCC (n = 30) were analyzed to assess the prevalence of E. coli using culture, biochemical tests, and PCR targeting the malB gene. E. coli was detected in 85 samples, indicating an overall prevalence of 58.62% (95% CI: 50.48–66.31). In urban areas (DNCC and DSCC), the prevalence rates were 44.70% and 80.0%, respectively, with surface gardens showing higher contamination rates (70.83%) than rooftop gardens (46.57%). In the peri-urban GCC, overall prevalence of E. coli was 76.7%, with rooftop gardens more contaminated (93.33%) than surface gardens (60.0%). Antibiogram profiling of 54 randomly selected isolates revealed 100% resistance to ampicillin, with varying resistance to ciprofloxacin (25.92%), tetracycline (14.81%), cotrimoxazole (14.81%), imipenem (9.25%), and fosfomycin (1.0%). Notably, all isolates were susceptible to ceftazidime, gentamicin, chloramphenicol, nitrofurantoin, and cefotaxime. Multidrug resistance (MDR) was found in 14.81% of isolates. The blaTEM gene was present in 81.48% of the isolates, while the tetA gene was detected in 3.70%. These findings underscore the urgent global health concern posed by the significant presence of E. coli in fresh vegetables, highlighting the need for improved safety measures and monitoring to prevent the spread of antimicrobial resistance through the food chain.

Introduction

Vegetables are regarded as vital components of balanced diets due to the phytochemicals, vitamins, minerals, and dietary fiber they provide. Vegetables in the daily diet have been associated in a significant way with improved gastrointestinal health, enhanced vision, a decreased risk of cardiovascular disease, stroke, chronic diseases including diabetes, and certain types of cancer [1,2]. It is believed that certain phytochemicals found in vegetables reduce the risk of chronic disease by preventing free radical damage, influencing metabolic activation and detoxification of carcinogens or even regulating processes that alter the progress of tumor cells [3]. The various vegetables could provide defense against chronic diseases to human beings [4]. Recent research indicates a negative association between vegetable consumption and mortality rates, particularly in cardiovascular disease and cancer [5,6]. However, findings have varied. Some studies suggest a lower mortality risk with increased vegetable intake, yet a British study found no significant mortality differences between vegetarians and non-vegetarians [7,8]. Unbalanced diets, marked by insufficient intake of complex carbohydrates, dietary fiber, and vegetables, account for approximately 2.7 million deaths each year [9] and are among the top 10 risk factors for mortality [4].

While fresh vegetables provide many health benefits, they can also pose potential risks [10]. In recent years, fresh fruits and vegetables have been associated with various outbreaks of transmissible diseases around the world. Efforts are underway to tackle these food safety challenges [11]. Occasionally, raw salad vegetables are consumed without washing, peeling, or applying any heat treatment. This exposes consumers to potential risks of foodborne illnesses [12]. Vegetable contamination can occur at any stage, both before and after harvesting. Using untreated effluent and manure as fertilizers in vegetable cultivation contributes to this contamination [13,14]. Furthermore, a variety of potential contamination sources exist, including debris, animal and human waste products, and the use of contaminated transportation and handling processes. Harvesting and processing equipment can also introduce contaminants. Each of these stages, from the field to the consumer, poses risks for introducing harmful substances into the food supply [15,16]. Earlier studies reported that consumption of a variety of contaminated vegetables and fruits has been linked to outbreaks of viruses, bacteria, and parasites [16,17]. Fecal microorganisms have the potential to endure prolonged periods in soils and manure and water and therefore, they serve as an accessible source of contamination [18,19]. Antimicrobial resistance has become a noteworthy economic and public health worry [20]. Recently, antibiotic resistance in E. coli and Salmonella spp. has been reported globally [21,22]. E. coli keeps getting progressively more difficult to treat as resistance to most first-line antimicrobials has evolved [22]. Furthermore, resistant E. coli tends to transfer genes encoding resistance to antibiotics to other strains of E. coli and bacteria residing in the gastrointestinal tract, thereby developing resistance from external organisms [23,24]. Resistance to ampicillin, a semi-synthetic-lactam antibiotic commonly used to treat E. coli infections in humans and livestock, has recently increased [25]. The prevalence of multidrug resistance E. coli in humans and animals is rising worldwide [20,21,26]. The increasing resistance of E. coli to beta-lactam antibiotics is leading to severe troubles among the general population [27]. E. coli may also develop resistance to various classes of commonly prescribed antibiotics, including trimethoprim-sulfamethoxazole, aminoglycosides, and fluoroquinolones [28]. Such resistance would result in higher mortality and morbidity rates, prolonged hospital stays, elevated treatment expenditures, and disintegration of healthcare facilities. Two plasmid-mediated beta-lactam enzymes, extended-spectrum beta-lactamases (ESBLs) and AmpC beta-lactamases (AmpC), trigger resistance to beta-lactam antibiotics, resulting in a grave effect on the global health sector [28]. Plasmid-mediated AmpC (CMY-2) is a major threat to public health that appears frequently in Enterobacteriaceae, especially E. coli, in humans and animals [29].

The malB gene is involved in the maltose and maltodextrin transport system in bacteria, particularly in E. coli [30]. The malB operon encodes components essential for the transport and metabolism of maltose and maltodextrins, which are polysaccharides derived from starch. This operon is part of the ATP-binding cassette (ABC) transporter family and includes genes like malE, malF, and malG, which encode for the maltose-binding protein (MalE) and the membrane components (MalF and MalG) that form the maltose transporter complex [30,31].

The presence of multidrug resistance E. coli in vegetables is a serious global concern [19]. Despite extensive research on E. coli in commercially sourced vegetables [32,33], there is a significant knowledge gap regarding its presence in vegetables from home gardens, which are cultivated organically without pesticides or herbicides. Currently, there is a lack of data on E. coli in rooftop and surface gardening practices in Bangladesh. This study aims to isolate and identify E. coli from various vegetables, soil, and water samples from rooftops and surface gardens. We also assessed the resistance profiles of the E. coli isolates and identified the genes responsible for beta-lactams and tetracycline resistance.

2. Materials and methods

2.1 Sample information

This study was carried out at the Bacteriology Laboratory, Department of Microbiology and Hygiene, Bangladesh Agricultural University, Mymensingh, Bangladesh, from September 2022 to March 2023. Vegetables, water, and soil samples (S1 Table) were collected from urban locations including Dhaka North City Corporation (DNCC, 23°52’55.5"N, 90°24’14.9"E; total population: 5,979,537, total areas: 19,700 hectares) and Dhaka South City Corporation (DSCC, 23°43’27.0"N, 90°28’51.0" E; total population: 4,299,345, total area: 10,920 hectares), as well as the peri-urban area of Gazipur City Corporation (GCC, 25°35’37.1"N, 83°34’53.4"E; total population: 1,129,145, total area: 32,923 hectares) within the Dhaka division of Bangladesh (S1 Fig) [34]. These areas are approximately 15–20 km apart from each other and feature tropical wet and dry climates. A total of 145 samples including 85 from DNCC (rooftop garden = 43, surface garden = 42), 30 from DSCC (rooftop garden = 15, surface garden = 15) and 30 from GCC (rooftop garden = 15, surface garden = 15) were collected. Further classification of the samples included most commonly grown 88 vegetables namely Coriander (Coriandrum sativum), Red amaranth (Amaranthus cruentus), Radish leaves (Raphanus sativus), Green chilies (Capsicum frutescens), Tomato (Solanum lycopersicum), Malabar spinach (Basella alba)), 27 water samples (Deep tubewell, stored water), and soils (n = 30).

2.2 Isolation and identification of E. coli

Isolation and identification of E. coli were performed by culturing on Eosin Methylene Blue (EMB) agar plates (HiMedia, India) followed by Gram staining. A single loopful of overnight culture grown in nutrient broth was streaked onto EMB agar (HiMedia, India) and incubated aerobically overnight at 37°C [35,36]. Phenotypic identification of the isolates (N = 85) was performed based on the colony morphology and Gram-staining (Gram -ve, formation of green metallic sheen on EMB), and biochemical tests such catalase, indole, methyl red, Voges-Proskauer (VP), oxidase, urease and triple sugar iron tests [21]. The isolates were molecularly confirmed as E. coli using species-specific polymerase chain reaction (PCR) amplification of the malB gene (S2 Fig) [21,37]. The malB gene specific primers are presented in Table 1. Genomic DNA from overnight culture by boiled DNA extraction method using commercial DNA extraction kit, QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany). Quality and quantity of the extracted DNA were measured using a NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). DNA extracts with A260/280 and A260/230 ratios of ∼ 1.80 and 2.00 to 2.20, respectively, were considered as high-purity DNA samples [38] and stored at -20°C prior to PCR amplification [37,39]. Amplification of targeted DNA was carried out in a 20 μL reaction mixture, which included 3 μL nuclease-free water, 10 μL 2X master mixture (Promega, Madison, WI, USA), 1 μL each of forward and reverse primers, and 5 μL DNA template. PCR-positive controls consisted of E. coli genomic DNA previously confirmed for the target genes [37]. PCR-negative controls utilized non-template controls with PBS instead of genomic DNA. The amplified PCR products were then subjected to electrophoresis on a 1.5% agarose gel and visualized using an ultraviolet transilluminator (Biometra, Gottingen, Germany). A 100 bp DNA ladder (Promega, Madison, WI, USA) was used to validate the expected sizes of the amplified PCR products [37,40]. Finally, 85 isolates were confirmed as E. coli through species-specific PCR.

Table 1. List of primers used in this study.

Name of Primers Targeted gene Primer sequences (5´-3´)
 Amplicon size (bp) References
malB (F) malB 5´GACCTCGGTTTAGTTCACAGA3´ 585 [30]
malB (R) 5´ CACACGCTGACGCTGACCA3´
tetA (F) tetA 5´ GGTTCACTCGAACGACGTCA3´ 577 [41]
tetA (R) 5´ CTGTCCGACAAGTTGCATGA3´
blaTEM (F) blaTEM 5´ CATTTCCGTGTCGCCCTTAT3´ 793
blaTEM (R) 5´ TCCATAGTTGCCTGACTCCC3´
Open in a new tab

2.3 Antimicrobial susceptibility assay

The antimicrobial susceptibility profiles of 54 randomly selected E. coli isolates (out of 85 confirmed isolates) were assessed using the disk diffusion test (DDT), in accordance with the guidelines outlined in the Clinical Laboratory Standards Institute (CLSI) 2023 (M100 33rd Edition) [42]. Eleven antibiotics from nine commonly practiced antibiotic classes in Bangladesh were employed. These were ciprofloxacin (CIP, 5 μg), gentamicin (GEN, 10 μg), tetracycline (TET, 30 μg), ceftriaxone (CTR, 30 μg), ampicillin (AMP, 25 μg), ceftazidime (CAZ, 5 μg), chloramphenicol (C, 30 μg), imipenem (IMP, 10 μg), fosfomycin (FOS, 50 μg), nitrofurantoin (NIT, 300 μg), and cotrimoxazole (COT, 25 μg). The isolated colonies were taken into 4–5 mL of nutrient broth for performing DDT. After preparing the broth cultures, isolates were incubated for 4–5 hrs at 37°C, and the turbidity of bacterial suspensions was adjusted with the 0.5 McFarland unit (HiMedia, India). After that, the dried surface of a Muller Hilton (MH) agar plate was inoculated by spreading the broth suspension on the surface with sterile cotton swabs. Finally, the antibiotic disks were applied on the surface of the agar plates, and left for overnight (>16 hrs.) incubation at 37°C. The isolates were categorized as susceptible, intermediate, and resistant according to CLSI guidelines [42]. Multidrug resistance (MDR) patterns, defined as resistance to ≥ 3 antibiotics, were identified using the protocol outlined by Saha et al. and Sultana et al. [43,44]. The Multiple Antibiotic Resistance (MAR) index was calculated by dividing the number of antibiotics to which an isolate was resistant by the total number of antibiotics tested [45]. E. coli strain ATCC25922 was used as the negative control in the antimicrobial susceptibility tests.

2.4 Molecular detection of antibiotic-resistant genes in E. coli

To detect antibiotic-resistant genes in the E. coli isolates (n = 54), simplex PCR assays were conducted for beta-lactamase genes (e.g., blaTEM) (S3A Fig) and tetracycline resistance genes (e.g., tetA) (S3B Fig) using specific primers (Table 1). For both genes, PCR was conducted with a final volume of 20 μL. The PCR conditions for the tetA gene involved an initial denaturation at 95°C for 5 min, followed by 32 cycles of denaturation at 95°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 1 min. A final extension step was carried out at 72°C for 10 min. For the blaTEM gene, the thermal profile included an initial denaturation at 95°C for 1 min, followed by 34 cycles of denaturation at 95°C for 1 min, annealing at 56°C for 1 min, and extension at 72°C for 1 min, with a final extension at 72°C for 7 min [40]. Although a positive control was not included for the resistance genes, a non-template control (NTC), which contained no DNA, was used to ensure the absence of contamination.

2.5 Statistical analysis

Data were entered into Microsoft Excel 2020® (Microsoft Corp., Redmond, WA, USA) and analyzed using SPSS version 25 (IBM Corp., Armonk, NY, USA) and GraphPad Prism version 8.4.3 (GraphPad Software, Inc.). The Pearson’s chi-square test was conducted to compare the occurrence of E. coli across different sample categories (e.g., DNCC, DSCC, and GCC). Prevalence percentages were calculated by dividing the number of positive samples in each category by the total number of samples tested within that category [46,47]. The prevalence formula was applied for determining occurrence percentage of E. coli. The AMR patterns, resistance, intermediate and sensitivity, and MAR index were calculated using the CLSI (2023) guideline using the cut-off as provided in the brochure of the manufacturer (Liofilchem®, Italy). Additionally, an identical test was done to determine whether the presence of resistance genes caused variations in phenotypic antibiotic resistance. For the test, p < 0.05 was considered statistically significant.

Results

3.1 Overall prevalence of E. coli

In this study, 145 samples were collected from DNCC, DSCC, and GCC and subjected to analysis. The identification process involved culturing the samples, performing biochemical tests, and conducting PCR targeting the malB gene (S2 Fig). Out of the total samples, 85 isolates were confirmed as E. coli. This resulted in an overall prevalence of E. coli in the studied samples of 58.62% (95% CI: 50.48–66.31) (S2 Table). This prevalence indicates that more than half of the samples contained E. coli, reflecting its significant presence in the studied areas.

3.2 Prevalence of E. coli in urban (DNCC and DSCC) areas of Bangladesh

In DNCC, a total of 85 samples, including vegetables, water, and soil, were collected from rooftop (n = 43) and surface (n = 42) gardens. The overall prevalence of E. coli in these samples was 44.70% (95% CI, 34.59–55.28) (Fig 1A, S3 Table). However, the prevalence of E. coli was lower in rooftop gardens, at 20.93% (95% CI: 11.42–35.20), compared to surface gardens, which had a higher occurrence of 69.04% (95% CI: 53.97–80.92) (Fig 1B, S4 Table). In the rooftop samples of DNCC, E. coli was detected in vegetables and soil with frequencies of 28.0% (95% CI: 14.28–47.57) and 25% (95% CI: 4.44–59.07), respectively. Water samples from the rooftop gardens were found to be free of E. coli (Fig 1C, S5 Table). In contrast, surface samples showed E. coli prevalence rates of 86.95% (95% CI: 67.87–95.46) in vegetables, 12.5% (95% CI: 0.64–47.08) in water, and 72.73% (95% CI: 43.43–90.25) in soil (Fig 1C, S6 Table).

Fig 1. Prevalence of E. coli based on study areas (DNCC, DSCC, and GCC), locations (rooftop and surface gardens), and sample types (vegetables, water and soils).

Fig 1

Open in a new tab

Similarly, from DSCC, 30 samples were collected, including rooftop gardens (n = 15) and surface gardens (n = 15), with an 80.0% prevalence found (95% CI, 62.69–90.49) (Fig 1A, S3 Table). Consistent with DNCC, the prevalence of E. coli was lower in rooftop gardens (73.33%, 95% CI, 48.05–89.10) compared to surface gardens (86.67%, 95% CI, 62.12–97.63) (Fig 1B, S4 Table). In rooftop gardens of DSCC, E. coli was found in 70% of vegetable samples (95% CI, 39.67–89.22), 50% of water samples (95% CI, 2.56–97.43), and 100% of soil samples (95% CI, 43.85–100) (Fig 1C, S5 Table). Conversely, in surface gardens of DSCC, E. coli prevalence was highest in vegetables (100%, 95% CI, 72.24–100), followed by soil (66.67%, 95% CI, 11.84–98.29) and water samples (50%, 95% CI, 2.56–97.43) (Fig 1C, S6 Table).

3.3 Prevalence of E. coli in peri-urban (GCC) areas of Bangladesh

In the peri-urban area of GCC, a total of 30 samples (15 from rooftop gardens and 15 from surface gardens) were collected and analyzed, with an overall E. coli prevalence of 76.7% (95% CI, 59.07–44.20) (Fig 1A, S3 Table). In contrast to the urban areas (DNCC and DSCC), E. coli prevalence was higher in rooftop gardens (93.33%, 95% CI, 70.18–99.65) compared to surface gardens (60.0%, 95% CI, 35.74–80.17) in the peri-urban area of GCC (Fig 1B, S4 Table). Specifically, E. coli was found in 100% of vegetable (95% CI, 72.24–100) and soil (95% CI, 17.76–100) samples from rooftop gardens, while water samples had a prevalence of 66.7% (95% CI, 11.84–98.29) (Fig 1C, S5 Table). In contrast, water samples from surface gardens were free of E. coli. However, E. coli was detected in 70.0% of vegetable (95% CI, 39.68–89.22) and 66.7% of soil (95% CI, 11.84–98.29) samples from the same gardens (Fig 1C, S6 Table).

3.4 Antibiogram profile of E. coli

The overall antibiogram profile of isolated E. coli is presented in Fig 2. Out of the 85 isolates, a random selection of 54 was subjected to antibiogram testing. Resistance was observed across all isolates to ampicillin (AMP; 100%), with varying resistance rates noted for ciprofloxacin (CIP; 25.92%), tetracycline (TET; 14.81%), cotrimoxazole (COT; 14.81%), imipenem (IMP; 9.25%), and fosfomycin (FOS; 1%) (Fig 2). Additionally, these isolates showed intermediate resistance to ciprofloxacin (CIP; 74.0%), imipenem (IMP; 37.0%), and fosfomycin (FOS; 33.0%). Fortunately, the tested E. coli isolates were 100% susceptible to gentamicin (GEN), ceftazidime (CAZ), chloramphenicol (C), nitrofurantoin (NIT), and ceftriaxone (CTR). They were also susceptible to tetracycline (TET; 79.6%), cotrimoxazole (COT; 79.6%), fosfomycin (FOS; 64.8%), and imipenem (IMP; 53.7%) (Fig 2). However, bivariate analysis of the tested antibiotics revealed a strong positive and significant correlation between resistance to tetracycline and cotrimoxazole (p = 0.002, ρ = 0.413) (Table 2).

Fig 2. Overall resistance rates of the 54 E. coli isolates to 11 antibiotics.

Fig 2

Open in a new tab

The percentage of R (Resistant, olive), I (Intermediate resistant, orange), and S (Susceptible, green) profiles are indicated for each antibiotic inside the bar chart. CIP: Ciprofloxacin, GEN: Gentamicin, CAZ: Ceftazidime, TET; Tetracycline, IMP; Imipenem, COT; Cotrimoxazole, FOS; Fosfomycin, AMP; Ampicillin, C; Chloramphenicol, NIT; Nitrofurantoin and CTR: Ceftriaxone.

Table 2. Pearson correlation coefficient to assess the pairs of any of two resistant antibiotics used in E. coli.

Antibiotics TET CIP COT FOS IMP
TET Pearson Correlation 1
Sig. (2-tailed)
AMP Pearson Correlation -0.057
Sig. (2-tailed) 0.681
CIP Pearson Correlation 0.229 1
Sig. (2-tailed) 0.096
COT Pearson Correlation 0.413** 0.229 1
Sig. (2-tailed) 0.002 0.096
FOS Pearson Correlation -0.057 -0.081 -0.057 1
Sig. (2-tailed) 0.681 0.559 0.681
IMP Pearson Correlation 0.226 0.103 0.226 -0.044 1
Sig. (2-tailed) 0.1 0.46 0.1 0.753
Open in a new tab

** Correlation is significant at the 0.01 level (2-tailed). TET: Tetracycline, CIP: Ciprofloxacin, COT: cotrimoxazole, FOS: Fosfomycin, IMP: Imipenem.

3.5 Phenotypic resistance patterns of the multidrug resistance E. coli isolates

Table 3 presents the phenotypic multidrug resistance (MDR) patterns of the E. coli isolates. Among the 54 isolates, 48.14% (95% CI: 35.39–61.14) exhibited MDR. In total, 10 distinct antibiotic resistance patterns were identified. The most prevalent pattern was pattern no. 1 (AMP, TET, CIP, COT, IMP), observed in 14.81% of isolates, followed by pattern no. 2(AMP, TET, COT) in 12.96% of the isolates. Patterns no. 3, 4, 5, 6, and 7, which include combinations like (AMP, TET, CIP), (AMP, CIP, COT), (AMP, COT), (AMP, TET), and (AMP, IMP) showed a prevalence of 11.11%. The least prevalent pattern was pattern no. 8 (AMP, FOS), 9 (AMP, CIP), and 10 (AMP), observed in 5.55% of the isolates. The multiple antibiotic resistance (MAR) indices were found to vary between 0.09 and 0.45 (Table 3).

Table 3. Resistance patterns of multidrug resistant (MDR) E. coli isolates.

Pattern No. Resistance patterns No. of antibiotics (classes) No. of MDR Isolates MDR
(%)		 MAR index
1 AMP, TET, CIP, COT, IMP 5(5) 7 48.14 0.45
2 AMP, TET, COT 3(3) 7
0.27
3 AMP, TET, CIP 3(3) 6
4 AMP, CIP, COT 3(3) 6
5 AMP, COT 2(2) 7
0.18
6 AMP, TET 2(2) 6
7 AMP, IMP 2(2) 6
8 AMP, FOS 2(2) 3
9 AMP, CIP 2(2) 3
10 AMP 1(1) 3 0.09
Open in a new tab

TET: Tetracycline, AMP: Ampicillin, CIP: Ciprofloxacin, COT: Cotrimoxazole, FOS: Fosfomycin, IMP: Imipenem.

3.6 Genotypic resistance patterns of E. coli isolates

The presence of two AMR genes (e.g., blaTEM and tetA) in all E. coli isolates was assessed by PCR (Fig 3). Among the 54 randomly selected E. coli isolates, all 54 (100.0%) exhibited phenotypic resistance to ampicillin. In contrast, only 8 isolates (14.81%) demonstrated phenotypic resistance to tetracycline. In the E. coli isolates that exhibited resistance to ampicillin, the blaTEM gene was detected in 81.48% (95% CI: 69.16–89.61, 44 out of 54 isolates). In those resistant to tetracycline, the tetA gene was present in 25.0% (95% CI: 4.44–59.07, 2 out of 8 isolates) (Fig 3).

Fig 3. Heatmap illustrating the distribution of resistance genes (blaTEM and tetA) in E. coli isolates, with the X-axis representing the resistance genes and the Y-axis displaying the isolates.

Fig 3

Open in a new tab

In the heatmap, the red color denotes resistant isolates, while the green color indicates sensitive isolates.

Discussion

Foodborne illnesses have increasingly become a significant concern across communities globally [48,49]. This rise in foodborne illnesses is attributed to variations in distribution patterns, manufacturing processes, and consumer behaviors [11]. This study on the prevalence and antibiotic resistance profiles of E. coli in urban (DNCC and DSCC) and peri-urban (GCC) rooftop and surface gardens explored the frequency of this pathogen in these environments and its resistance to various antibiotics. We also assessed how often E. coli is found in rooftop versus surface gardens and examined the antibiotic resistance patterns of isolated strains and the presence of specific resistance genes. In this study, the overall prevalence of E. coli was found to be 58.62%, indicating a significant presence of this pathogen in the surveyed urban and peri-urban gardens. In a similar study, Nipa et al. reported a 40.62% prevalence of E. coli in fresh salad vegetables, which is lower compared to the prevalence observed in the current study [50]. Raw vegetables are particularly vulnerable to contamination by pathogenic bacteria like E. coli, which can either be dispersed on the plant surface or embedded as microcolonies within plant tissues [51]. In developing countries like Bangladesh, the incidence of foodborne illnesses linked to contaminated vegetables is notably high [52,53]. The lack of research and surveillance often results in many outbreaks going unreported, with only a limited number documented in scientific literature.

The study provides a detailed examination of E. coli prevalence in urban gardens, revealing distinct patterns between rooftop and surface gardens in DNCC and DSCC. In DNCC, the overall E. coli prevalence was 44.70%, with rooftop gardens exhibiting a lower prevalence (20.93%) compared to surface gardens (69.04%). Specifically, E. coli was present in 28.0% of rooftop vegetable samples and 25% of rooftop soil samples, while no E. coli was detected in rooftop water samples. Conversely, surface gardens had a significantly higher prevalence of E. coli in vegetables (86.95%), with lower levels in water (12.5%) and a substantial prevalence in soil (72.73%). The findings from DSCC corroborate these trends, showing an overall E. coli prevalence of 80.0%. Rooftop gardens in DSCC had a prevalence of 73.33%, whereas surface gardens had a higher prevalence of 86.67%. In rooftop gardens, E. coli was found in 70% of vegetable samples, 50% of water samples, and 100% of soil samples. In surface gardens, the pathogen was detected in 100% of vegetable samples, 66.67% of soil samples, and 50% of water samples. However, in the peri-urban area of GCC, a total of 30 samples from rooftop and surface gardens revealed a high overall E. coli prevalence. Rooftop gardens had a higher prevalence compared to surface gardens. Specifically, E. coli was found in 100% of vegetable and soil samples from rooftop gardens and in 66.7% of water samples. In surface gardens, E. coli was present in 70.0% of vegetable samples and 66.7% of soil samples but was absent from water samples. These results indicate that rooftop gardens experience more extensive contamination, particularly in vegetables and soil, highlighting the need for enhanced sanitation and management practices in both garden types to address E. coli contamination [11,24]. Agricultural practices in rooftop and surface gardens in urban and peri-urban areas of Bangladesh, such as using manure-based fertilizers, irrigating with possibly contaminated water, and applying pesticides or antibiotics, may introduce and propagate MDR bacteria. This contamination can transfer to plants and soil, posing public health risks when these vegetables are consumed. Although this study analyzed a limited sample size, it marks, to the best of our knowledge, the first investigation of antimicrobial resistance in urban and peri-urban garden systems in Bangladesh, highlighting a critical area for further research and monitoring.

While the presence of E. coli in these urban settings has been shown not to be a good indicator of pathogens, we assume that E. coli is prevalent in urban and rooftop gardens due to factors like contaminated water sources, exposure to animal waste, insufficient hygiene practices, and soil quality issues [54]. These conditions create ideal environments for bacterial contamination, impacting food safety. The elevated E. coli prevalence in surface gardens may stem from differences in soil type, irrigation, fertilization, and exposure to human or animal activity, which vary significantly from rooftop gardens [55,56]. The role of soil as a primary reservoir for E. coli suggests its capacity to sustain and spread the bacterium to plants and ultimately to humans [57,58]. Additionally, the use of unsanitized organic fertilizers or compost in surface gardens can introduce bacteria, while rooftop gardens exhibited no contamination in water samples, implying more controlled inputs. Lower prevalence in water compared to vegetables may indicate dilution effects or sampling differences, while high soil prevalence reinforces soil’s potential as an E. coli reservoir [58]. This underscores the public health significance of soil in urban and rooftop gardens, where contaminated soil can directly impact food safety and increase the risk of E. coli-related infections.

The antibiogram of 54 E. coli isolates showed universal resistance to ampicillin (100.0%) and varying resistance rates to ciprofloxacin, tetracycline, cotrimoxazole, imipenem, and Fosfomycin (< 30.0%). Intermediate resistance was noted for ciprofloxacin (74%), imipenem (37%), and fosfomycin (33%). There were high susceptibility rates (100.0%) among the E. coli isolates to gentamicin, ceftazidime, chloramphenicol, nitrofurantoin, and ceftriaxone. Remarkably, a significant correlation was found between resistance to tetracycline and cotrimoxazole (p = 0.002, ρ = 0.413). In this study, 48.14% of the E. coli isolates showed multidrug resistance (MDR), with 10 distinct resistance patterns identified. The most common pattern involved ampicillin alone, while other patterns included combinations of ampicillin with various antibiotics. These results moderately contrast with those of Cao et al., who reported a 92.9% multidrug resistance rate among E. coli isolates from retail fresh vegetables in Shaanxi Province, China [59]. This study also noted variability in the MAR indices among the isolates. Antibiotic-resistant bacteria like E. coli can migrate from one location to another and from the environment to humans via the consumption of raw vegetables. This transmission pathway underscores the importance of monitoring and managing antibiotic resistance in agricultural and food safety practices [60]. Unlike our findings, which showed 14.81% of E. coli isolates resistant to tetracycline, two previous studies reported higher resistance rates of 80% and 43.06%, respectively [61,62]. Many studies have documented the presence of drug-resistant E. coli and other coliforms in vegetables [53,60,63]. This highlights a concerning trend in food safety, as the consumption of contaminated vegetables can facilitate the spread of antibiotic-resistant bacteria to humans. The fact that ampicillin is a clinical antibiotic makes this more disturbing and suggests the source of contamination may have been from human waste and thus corroborate the assumption that contamination is due to discharge from anthropogenic sources [53]. This result also agrees with a recent report of high tetracycline resistance observed among E. coli isolates [53]. Moreover, the detection of resistance phenotype was also supported by the detection of blaTEM and tetA genes in the E. coli isolates. All 54 isolates were resistant to ampicillin, with 81.48% carrying the blaTEM gene. However, only 14.81% showed resistance to tetracycline, and among these, 25.0% had the tetA gene. Statistical analysis indicated that while ampicillin-resistant isolates had similar frequencies of blaTEM and tetA genes, tetracycline-resistant isolates had a significantly (p = 0.035) higher prevalence of tetA compared to blaTEM, highlighting differences in phenotypic resistance. E. coli is a common component of the intestinal flora and is generally harmless. However, antibiotic resistance genes like blaTEM and tetA present in commensal E. coli can be transferred to pathogenic strains like E. coli O157 or Salmonella spp. [53,64]. This gene transfer can lead to serious health issues, complicating treatment and increasing the risk of severe infections [64]. In contrast to our findings, Kim and Woo (2014) characterized antimicrobial-resistant E. coli from organic vegetables and found a lower prevalence of blaTEM genes (3.6%) but a higher prevalence of tetA genes (10.7%) [63].

Industrialization has increased health awareness, leading people to prefer homegrown vegetables with minimal pesticides, fertilizers, and antibiotics. Consequently, antibiotic resistance remains moderate, with multidrug resistance (14.81%) in E. coli being a concern. Sustainable farming practices, regular hygiene, and farm management are essential to control resistance. Effective management is crucial to mitigate the risks posed by antibiotic-resistant E. coli in urban agriculture. While E. coli can be found in various environments, the lack of detailed information regarding gardening practices in the three areas limits the applicability of our findings for effective garden management. To enhance vegetable safety for human consumption, further research should focus on comparing soil quality, water sources, and preparation techniques. This would provide actionable insights for improving hygiene practices and mitigating contamination risks in both rooftop and surface gardens.

5. Conclusion

MDR E. coli poses a significant public health threat worldwide. The findings from the present study provide the prevalence of E. coli in vegetables, water and soil samples at the urban (DNCC and DSCC) and peri-urban (GCC) rooftop and surface gardens harboring blaTEM and tetA resistance genes. Detection was confirmed both phenotypically and genotypically via PCR, raising serious public health concerns. Fresh salad vegetables could be a potential source of drug-resistant E. coli. This study is the first in Bangladesh to report MDR E. coli from rooftop vegetables, soil, and water in urban (DNCC and DSCC) and peri-urban (GCC) rooftop and surface gardens of Bangladesh. Overall, these findings emphasize the importance of monitoring and managing E. coli contamination in urban and peri-urban gardens, especially in areas with high prevalence. Our findings underscore the importance of public awareness about hygiene practices and environmental controls to minimize contamination risks in both surface and rooftop gardens. Encouraging regular monitoring and thoroughly washing rooftop garden produce with safe, potable water is essential to safeguard public health and prevent potential foodborne illnesses. Regular training and awareness programs for gardeners about best practices can also enhance overall food safety and reduce public health risks.

Supporting information

S1 Table. Sampling information of the study.

(DOCX)

pone.0315938.s001.docx (23.8KB, docx)
S2 Table. Number of E. coli positive samples from the study areas.

(DOCX)

pone.0315938.s002.docx (23.7KB, docx)
S3 Table. Prevalence of E. coli in the study areas.

(DOCX)

pone.0315938.s003.docx (23.1KB, docx)
S4 Table. Prevalence of E. coli in the rooftop and surface gardens of the study areas.

(DOCX)

pone.0315938.s004.docx (23.8KB, docx)
S5 Table. Prevalence of E. coli in different samples of rooftop gardens.

(DOCX)

pone.0315938.s005.docx (23.9KB, docx)
S6 Table. Prevalence of E. coli in different samples of surface gardens.

(DOCX)

pone.0315938.s006.docx (24KB, docx)
S1 Fig. Study areas and sampling locations.

(a) Urban (Dhaka North City Corporation; DNCC and Dhaka South City Corporation; DSCC) and peri-urban (Gazipur City Corporation; GCC) areas of Bangladesh. (b) Rooftop gardens and (c) Surface gardens.

(JPG)

pone.0315938.s007.jpg (2.9MB, jpg)
S2 Fig. PCR amplification of malB gene of Escherichia coli.

Lane 1: 1 kb DNA Marker; Lane 2: Negative control; Lane 3: Positive control; and Lane 4–13: Representative E. coli isolates.

(JPG)

pone.0315938.s008.jpg (50.6KB, jpg)
S3 Fig

(a) PCR amplification of beta-lactamase-producing blaTEM gene in representative E. coli isolates. (b) PCR amplification of tetracycline resistance tetA gene in representative E. coli isolates.

(JPG)

pone.0315938.s009.jpg (84.9KB, jpg)

Acknowledgments

The authors would like to thank the authority who provided us with the samples from diverse environment to the support the research.

Data Availability

All relevant data are within the paper and its Supporting Information files. The minimal dataset necessary to replicate our study findings is publicly available in Supporting Information Files. Additional information regarding data and materials can be requested from the corresponding author.

Funding Statement

This work was conducted as part of the CGIAR Research Initiative on Resilient Cities Through Sustainable Urban and Peri-urban Agri-food Systems and is supported by contributors to the CGIAR Trust Fund (https://www.cgiar.org/funders).

References

  • 1.Hung H-C, Joshipura KJ, Jiang R, Hu FB, Hunter D, Smith-Warner SA, et al. Fruit and vegetable intake and risk of major chronic disease. Journal of the National Cancer Institute. 2004;96(21):1577–84. doi: 10.1093/jnci/djh296 [DOI] [PubMed] [Google Scholar]
  • 2.Boeing H, Bechthold A, Bub A, Ellinger S, Haller D, Kroke A, et al. Critical review: vegetables and fruit in the prevention of chronic diseases. European journal of nutrition. 2012;51:637–63. doi: 10.1007/s00394-012-0380-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hidaka A, Harrison TA, Cao Y, Sakoda LC, Barfield R, Giannakis M, et al. Intake of dietary fruit, vegetables, and fiber and risk of colorectal cancer according to molecular subtypes: a pooled analysis of 9 studies. Cancer research. 2020;80(20):4578–90. doi: 10.1158/0008-5472.CAN-20-0168 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.da Silva Dias JC, Imai S. Vegetables consumption and its benefits on diabetes. Journal of Nutritional Therapeutics. 2017;6(1):1–10. [Google Scholar]
  • 5.Agudo A, Cabrera L, Amiano P, Ardanaz E, Barricarte A, Berenguer T, et al. Fruit and vegetable intakes, dietary antioxidant nutrients, and total mortality in Spanish adults: findings from the Spanish cohort of the European Prospective Investigation into Cancer and Nutrition (EPIC-Spain). The American journal of clinical nutrition. 2007;85(6):1634–42. doi: 10.1093/ajcn/85.6.1634 [DOI] [PubMed] [Google Scholar]
  • 6.Trichopoulou A, Costacou T, Bamia C, Trichopoulos D. Adherence to a Mediterranean diet and survival in a Greek population. New England Journal of Medicine. 2003;348(26):2599–608. doi: 10.1056/NEJMoa025039 [DOI] [PubMed] [Google Scholar]
  • 7.Wang X, Ouyang Y, Liu J, Zhu M, Zhao G, Bao W, Hu FB. Fruit and vegetable consumption and mortality from all causes, cardiovascular disease, and cancer: systematic review and dose-response meta-analysis of prospective cohort studies. Bmj. 2014;349. doi: 10.1136/bmj.g4490 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Aune D, Giovannucci E, Boffetta P, Fadnes LT, Keum N, Norat T, et al. Fruit and vegetable intake and the risk of cardiovascular disease, total cancer and all-cause mortality—a systematic review and dose-response meta-analysis of prospective studies. International journal of epidemiology. 2017;46(3):1029–56. doi: 10.1093/ije/dyw319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cobiac LJ, Vos T, Veerman JL. Cost-effectiveness of interventions to promote fruit and vegetable consumption. PloS one. 2010;5(11):e14148. doi: 10.1371/journal.pone.0014148 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Weldezgina D, Muleta D. Bacteriological contaminants of some fresh vegetables irrigated with Awetu River in Jimma Town, Southwestern Ethiopia. Advances in Biology. 2016;2016(1):1526764. [Google Scholar]
  • 11.Denis N, Zhang H, Leroux A, Trudel R, Bietlot H. Prevalence and trends of bacterial contamination in fresh fruits and vegetables sold at retail in Canada. Food control. 2016;67:225–34. [Google Scholar]
  • 12.Harris H, Eke A, Chavarro J, Missmer S. Fruit and vegetable consumption and risk of endometriosis. Human Reproduction. 2018;33(4):715–27. doi: 10.1093/humrep/dey014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zhou H, Yang W-T, Zhou X, Liu L, Gu J-F, Wang W-L, et al. Accumulation of heavy metals in vegetable species planted in contaminated soils and the health risk assessment. International journal of environmental research and public health. 2016;13(3):289. doi: 10.3390/ijerph13030289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Botwe B, Ntow W, Drechsel P, Carboo D, Nartey VK, Gijzen H. Pesticide residues contamination of vegetables and their public health implications in Ghana. Journal of Environmental Issues and Agriculture in Developing Countries (JEIADC). 2023;3(2):10–8. [Google Scholar]
  • 15.Johannessen GS, Loncarevic S, Kruse H. Bacteriological analysis of fresh produce in Norway. International journal of food microbiology. 2002;77(3):199–204. doi: 10.1016/s0168-1605(02)00051-x [DOI] [PubMed] [Google Scholar]
  • 16.Alam MS, Feroz F, Rahman H, Das KK, Noor R. Microbiological contamination sources of freshly cultivated vegetables. Nutrition & Food Science. 2015;45(4):646–58. [Google Scholar]
  • 17.Garg V, Yadav P, Mor S, Singh B, Pulhani V. Heavy metals bioconcentration from soil to vegetables and assessment of health risk caused by their ingestion. Biological trace element research. 2014;157:256–65. doi: 10.1007/s12011-014-9892-z [DOI] [PubMed] [Google Scholar]
  • 18.Holvoet K, Sampers I, Seynnaeve M, Jacxsens L, Uyttendaele M. Agricultural and management practices and bacterial contamination in greenhouse versus open field lettuce production. International Journal of Environmental Research and Public Health. 2015;12(1):32–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Singh D, Patel N, Gadedjisso-Tossou A, Patra S, Singh N, Singh PK. Incidence of Escherichia coli in vegetable crops and soil profile drip irrigated with primarily treated municipal wastewater in a semi-arid peri urban area. Agriculture. 2020;10(7):291. [Google Scholar]
  • 20.Al Amin M, Hoque MN, Siddiki AZ, Saha S, Kamal MM. Antimicrobial resistance situation in animal health of Bangladesh. Veterinary world. 2020;13(12):2713. doi: 10.14202/vetworld.2020.2713-2727 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hoque MN, Faisal GM, Jerin S, Moyna Z, Islam MA, Talukder AK, et al. Unveiling distinct genetic features in multidrug-resistant Escherichia coli isolated from mammary tissue and gut of mastitis induced mice. Heliyon. 2024;10(5). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Priyanka Meena PR, Meghwanshi KK, Rana A, Singh AP. Leafy greens as a potential source of multidrug-resistant diarrhoeagenic Escherichia coli and Salmonella. Microbiology. 2021;167(6):001059. doi: 10.1099/mic.0.001059 [DOI] [PubMed] [Google Scholar]
  • 23.Hölzel CS, Tetens JL, Schwaiger K. Unraveling the role of vegetables in spreading antimicrobial-resistant bacteria: a need for quantitative risk assessment. Foodborne pathogens and disease. 2018;15(11):671–88. doi: 10.1089/fpd.2018.2501 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Mafiz AI, He Y, Zhang W, Zhang Y. Soil bacteria in urban community gardens have the potential to disseminate antimicrobial resistance through horizontal gene transfer. Frontiers in Microbiology. 2021;12:771707. doi: 10.3389/fmicb.2021.771707 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Li M, Liu Q, Teng Y, Ou L, Xi Y, Chen S, Duan G. The resistance mechanism of Escherichia coli induced by ampicillin in laboratory. Infection and drug resistance. 2019:2853–63. doi: 10.2147/IDR.S221212 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Saha O, Hoque MN, Islam OK, Rahaman MM, Sultana M, Hossain MA. Multidrug-resistant avian pathogenic Escherichia coli strains and association of their virulence genes in Bangladesh. Microorganisms. 2020;8(8):1135. doi: 10.3390/microorganisms8081135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Parker JK, Gu R, Estrera GA, Kirkpatrick B, Rose DT, Mavridou DA, et al. Carbapenem-resistant and ESBL-producing enterobacterales emerging in Central Texas. Infection and Drug Resistance. 2023:1249–61. doi: 10.2147/IDR.S403448 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Szmolka A, Nagy B. Multidrug resistant commensal Escherichia coli in animals and its impact for public health. Frontiers in microbiology. 2013;4:258. doi: 10.3389/fmicb.2013.00258 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Alcalá L, Alonso CA, Simón C, González-Esteban C, Orós J, Rezusta A, et al. Wild birds, frequent carriers of extended-spectrum β-lactamase (ESBL) producing Escherichia coli of CTX-M and SHV-12 types. Microbial ecology. 2016;72:861–9. [DOI] [PubMed] [Google Scholar]
  • 30.Bag MAS, Khan MSR, Sami MDH, Begum F, Islam MS, Rahman MM, et al. Virulence determinants and antimicrobial resistance of E. coli isolated from bovine clinical mastitis in some selected dairy farms of Bangladesh. Saudi journal of biological sciences. 2021;28(11):6317–23. doi: 10.1016/j.sjbs.2021.06.099 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Schwartz M. Location of the maltose A and B loci on the genetic map of Escherichia coli. Journal of Bacteriology. 1966;92(4):1083–9. doi: 10.1128/jb.92.4.1083-1089.1966 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Luna-Guevara JJ, Arenas-Hernandez MM, Martínez de la Peña C, Silva JL, Luna-Guevara ML. The role of pathogenic E. coli in fresh vegetables: Behavior, contamination factors, and preventive measures. International journal of microbiology. 2019;2019(1):2894328. doi: 10.1155/2019/2894328 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Delaquis P, Bach S, Dinu L-D. Behavior of Escherichia coli O157: H7 in leafy vegetables. Journal of food protection. 2007;70(8):1966–74. doi: 10.4315/0362-028x-70.8.1966 [DOI] [PubMed] [Google Scholar]
  • 34.Rana ML, Hoque MN, Rahman MS, Pramanik PK, Islam MS, Punom SA, et al. Soil bacteriome diversity and composition of rooftop and surface gardens in urban and peri-urban areas of Bangladesh. Environmental Monitoring and Assessment. 2024;196(8):729. doi: 10.1007/s10661-024-12850-5 [DOI] [PubMed] [Google Scholar]
  • 35.Hassan J, Bag MAS, Ali MW, Kabir A, Hoque MN, Hossain MM, et al. Diversity of Streptococcus spp. and genomic characteristics of Streptococcus uberis isolated from clinical mastitis of cattle in Bangladesh. Frontiers in Veterinary Science. 2023;10. doi: 10.3389/fvets.2023.1198393 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Hoque MN, Faisal GM, Das ZC, Sakif TI, Al Mahtab M, Hossain MA, Islam T. Genomic Features and Pathophysiological Impact of a Multidrug-Resistant Staphylococcus warneri Variant in Murine Mastitis. Microbes and Infection. 2023:105285. doi: 10.1016/j.micinf.2023.105285 [DOI] [PubMed] [Google Scholar]
  • 37.Ievy S, Hoque MN, Islam MS, Sobur MA, Ballah FM, Rahman MS, et al. Genomic characteristics, virulence, and antimicrobial resistance in avian pathogenic Escherichia coli MTR_BAU02 strain isolated from layer farm in Bangladesh. Journal of Global Antimicrobial Resistance. 2022;30:155–62. doi: 10.1016/j.jgar.2022.06.001 [DOI] [PubMed] [Google Scholar]
  • 38.Hoque MN, Istiaq A, Clement RA, Sultana M, Crandall KA, Siddiki AZ, Hossain MA. Metagenomic deep sequencing reveals association of microbiome signature with functional biases in bovine mastitis. Scientific reports. 2019;9(1):13536. doi: 10.1038/s41598-019-49468-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hoque MN, Istiaq A, Clement RA, Gibson KM, Saha O, Islam OK, et al. Insights into the resistome of bovine clinical mastitis microbiome, a key factor in disease complication. Frontiers in Microbiology. 2020;11:860. doi: 10.3389/fmicb.2020.00860 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Islam R, Ferdous FB, Hoque MN, Asif NA, Rana ML, Siddique MP, Rahman MT. Characterization of β-lactamase and virulence genes in Pseudomonas aeruginosa isolated from clinical, environmental and poultry sources in Bangladesh. Plos one. 2024;19(4):e0296542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Randall L, Clouting C, Horton R, Coldham N, Wu G, Clifton-Hadley F, et al. Prevalence of Escherichia coli carrying extended-spectrum β-lactamases (CTX-M and TEM-52) from broiler chickens and turkeys in Great Britain between 2006 and 2009. Journal of Antimicrobial Chemotherapy. 2011;66(1):86–95. [DOI] [PubMed] [Google Scholar]
  • 42.CLSI. Performance standards for antimicrobial susceptibility testing, 33rd Edition [cited 2023 20 May]. Available from: https://clsi.org/.
  • 43.Sultana KF, Saha O, Hoque MN, Sultana M, Hossain MA. Multilocus sequence typing of multidrug-resistant Salmonella strains circulating in poultry farms of Bangladesh. Brazilian Journal of Microbiology. 2021;52:2385–99. doi: 10.1007/s42770-021-00577-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Saha O, Rakhi NN, Hoque MN, Sultana M, Hossain MA. Genome-wide genetic marker analysis and genotyping of Escherichia fergusonii strain OTSVEF-60. Brazilian Journal of Microbiology. 2021;52:989–1004. doi: 10.1007/s42770-021-00441-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Ferdous FB, Islam MS, Ullah MA, Rana ML, Punom SA, Neloy FH, et al. Antimicrobial Resistance Profiles, Virulence Determinants, and Biofilm Formation in Enterococci Isolated from Rhesus Macaques (Macaca mulatta): A Potential Threat for Wildlife in Bangladesh? Animals. 2023;13(14):2268. doi: 10.3390/ani13142268 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hoque MN, Talukder AK, Saha O, Hasan MM, Sultana M, Rahman AA, Das ZC. Antibiogram and virulence profiling reveals multidrug resistant Staphylococcus aureus as the predominant aetiology of subclinical mastitis in riverine buffaloes. Veterinary Medicine and Science. 2022;8(6):2631–45. doi: 10.1002/vms3.942 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Hoque M, Das Z, Rahman A, Haider M, Islam M. Molecular characterization of Staphylococcus aureus strains in bovine mastitis milk in Bangladesh. International journal of veterinary science and medicine. 2018;6(1):53–60. doi: 10.1016/j.ijvsm.2018.03.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Todd E. Food-borne disease prevention and risk assessment. MDPI; 2020. p. 5129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Devleesschauwer B, Haagsma JA, Mangen M-JJ, Lake RJ, Havelaar AH. The global burden of foodborne disease. Food Safety Economics: Incentives for a Safer Food Supply. 2018:107–22. [Google Scholar]
  • 50.Nipa MN, Mazumdar RM, Hasan MM, Fakruddin M, Islam S, Bhuiyan HR, Iqbal A. Prevalence of multi drug resistant bacteria on raw salad vegetables sold in major markets of Chittagong city, Bangladesh. Middle-East Journal of Scientific Research. 2011;10(1):70–7. [Google Scholar]
  • 51.Skočková A, Karpíšková R, Koláčková I, Cupáková Š. Characteristics of Escherichia coli from raw vegetables at a retail market in the Czech Republic. International journal of food microbiology. 2013;167(2):196–201. doi: 10.1016/j.ijfoodmicro.2013.09.011 [DOI] [PubMed] [Google Scholar]
  • 52.Nithya A, Babu S. Prevalence of plant beneficial and human pathogenic bacteria isolated from salad vegetables in India. BMC microbiology. 2017;17:1–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Rahman F, Noor R. Prevalence of pathogenic bacteria in common salad vegetables of Dhaka Metropolis. Bangladesh Journal of Botany. 2012;41(2):159–62. [Google Scholar]
  • 54.Fischer G, Fischer-García FL. Heavy metal contamination of vegetables in urban and peri-urban areas. An overview. Revista Colombiana de Ciencias Hortícolas. 2023;17(2). [Google Scholar]
  • 55.Lowe RM, Munns K, Selinger LB, Kremenik L, Baines D, McAllister TA, Sharma R. Factors influencing the persistence of Escherichia coli O157: H7 lineages in feces from cattle fed grain versus grass hay diets. Canadian Journal of Microbiology. 2010;56(8):667–75. doi: 10.1139/w10-051 [DOI] [PubMed] [Google Scholar]
  • 56.Chidamba L. Microbial Quality of Rainwater Harvested from Rooftops, for Domestic use and Homestead Food Gardens: University of Pretoria (South Africa); 2015. [Google Scholar]
  • 57.Coulombe G, Catford A, Martinez-Perez A, Buenaventura E. Outbreaks of Escherichia coli O157: H7 infections linked to Romaine lettuce in Canada from 2008 to 2018: an analysis of food safety context. Journal of Food Protection. 2020;83(8):1444–62. doi: 10.4315/JFP-20-029 [DOI] [PubMed] [Google Scholar]
  • 58.Kgoale D, Gokul JK, Duvenage S, Du Plessis EM, Korsten L. Profiling bacterial communities of irrigation water and leafy green vegetables produced by small-scale farms and sold in informal settlements in South Africa. CABI Agriculture and Bioscience. 2023;4(1):36. [Google Scholar]
  • 59.Cao C, Zhao W, Lü Z, Mo Y, Hu W, Sun S, et al. Microbiological analysis and characterization of Salmonella and ciprofloxacin-resistant Escherichia coli isolates recovered from retail fresh vegetables in Shaanxi Province, China. International Journal of Food Microbiology. 2023;387:110053. doi: 10.1016/j.ijfoodmicro.2022.110053 [DOI] [PubMed] [Google Scholar]
  • 60.Li Y, Zhang M, Luo J, Chen J, Wang Q, Lu S, Ji H. Antimicrobial resistance of Escherichia coli isolated from retail foods in northern Xinjiang, China. Food science & nutrition. 2020;8(4):2035–51. doi: 10.1002/fsn3.1491 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Faour-Klingbeil D, Kuri V, Fadlallah S, Matar GM. Prevalence of antimicrobial-resistant Escherichia coli from raw vegetables in Lebanon. 2016. [DOI] [PubMed] [Google Scholar]
  • 62.Chigor CB, Ibangha I-AI, Nweze NO, Onuora VC, Ozochi CA, Titilawo Y, et al. Prevalence of integrons in multidrug-resistant Escherichia coli isolates from waters and vegetables in Nsukka and Enugu, Southeast Nigeria. Environmental Science and Pollution Research. 2022;29(40):60945–52. doi: 10.1007/s11356-022-20254-6 [DOI] [PubMed] [Google Scholar]
  • 63.Kim S, Woo G-J. Prevalence and characterization of antimicrobial-resistant Escherichia coli isolated from conventional and organic vegetables. Foodborne pathogens and disease. 2014;11(10):815–21. doi: 10.1089/fpd.2014.1771 [DOI] [PubMed] [Google Scholar]
  • 64.Boripun R, Saengsawang P, Intongead S, Narinthorn R, Wongtawan T, Nissapatorn V, et al. Molecular characterization and nucleotide substitution of antibiotic resistance genes in multidrug-resistant Escherichia coli isolated from environmental swine farms. Emerging Contaminants. 2023;9(4):100249. [Google Scholar]

Decision Letter 0

Bilal Aslam

21 Oct 2024

PONE-D-24-32199Prevalence and antibiotic resistance of Escherichia coli in urban and peri-urban garden ecosystems in BangladeshPLOS ONE

Dear Dr. Rahman,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Dec 05 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Bilal Aslam, PhD

Academic Editor

PLOS ONE

Journal requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.   In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 3. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the field site access and, if no permits were required, a brief statement explaining why. 4. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.  The American Journal Experts (AJE) (https://www.aje.com/) is one such service that has extensive experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. Please note that having the manuscript copyedited by AJE or any other editing services does not guarantee selection for peer review or acceptance for publication.  Upon resubmission, please provide the following: The name of the colleague or the details of the professional service that edited your manuscript A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file) A clean copy of the edited manuscript (uploaded as the new *manuscript* file)”. 5. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.  When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 6. Thank you for stating the following financial disclosure:  [This work was conducted as part of the CGIAR Research Initiative on Resilient Cities Through Sustainable Urban and Peri-urban Agri-food Systems and is supported by contributors to the CGIAR Trust Fund (https://www.cgiar.org/funders).].  Please state what role the funders took in the study.  If the funders had no role, please state: ""The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."" If this statement is not correct you must amend it as needed. Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf. 7. Please provide a complete Data Availability Statement in the submission form, ensuring you include all necessary access information or a reason for why you are unable to make your data freely accessible. If your research concerns only data provided within your submission, please write "All data are in the manuscript and/or supporting information files" as your Data Availability Statement.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Yes

Reviewer #4: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript entitled:’” Prevalence and antibiotic resistance of Escherichia coli in urban and peri-urban garden ecosystems in Bangladesh” is a nicely written well-designed study. AMR is a major health problem across the globe. Here the authors have focused MDR E. coli in various gardening systems in Bangladesh. Methodologies are reproducible along with detailed results and discussion. Vegetables grown in rooftop gardens could be potential sources for MDR E. coli. As the authors have mentioned it is the first such study in Bangladesh describing MDR E. coli in rooftop vegetables, soil, and water in urban and peri-urban rooftop and surface gardens of Bangladesh. I believe the findings of the study could be considered in developing guidelines for better rooftop garden management in Bangladesh for better public health linked to MDR E. coli.

Nevertheless, I have a few comments as follows:

Please write the function of malB gene used to detect E.coli.

Name the vegetables under methodology section, scientific name…

What was the basis of selecting those antibiotics for the sensitivity test?

Please mention the year of CLSI in the methodology section, 2022?2023/2024??

What could be is the explanation for observing more E. coli in the surface garden than rooftop garden? Is it expected??

Water samples from the rooftop gardens were found negative for E. coli, any speculation?

There are several tet family genes, why in this study only tetA gene primer was used for genotype.

Woo (2014)found a lower prevalence of blaTEM genes (3.6%) but a higher prevalence of tetA genes (10.7%), just the opposite of your study, what could be the reason??

Mention the major limitation of the study.

Reviewer #2: The manuscript entitled “Prevalence and antibiotic resistance of Escherichia coli in urban and peri-urban garden ecosystems in Bangladesh” describes the prevalence of Escherichia coli and its resistance status in raw vegetables, soil, and water samples collected from rooftop and surface gardens in urban and peri-urban areas of Bangladesh. From different reports, it is evident that family vegetable and fruit gardens on rooftops and surfaces are very common, particularly in city areas in Bangladesh. These gardens are a source of vegetables and a common area for family time. While gathering in gardens, family members, particularly children, sometimes eat vegetables and fruits without washing. However, the subject choice is appreciable as AMR in such a neglected area should be documented for policymakers.

However, a few revisions and corrections will improve its quality. To me, the background of the study requires adding the concept of rooftop and surface gardens in city areas and explaining why city people are growing family gardens on rooftops and surfaces. In addition, please explain what agricultural practices are used in those gardens that could induce AMR in garden components.

Line no. 118: Did the Authors use any sample size calculation formula? How did the Author finalize the 145 number of the sample? Any previous study in Bangladesh?

Line no. 121: In Bangladesh, people generally cook vegetables at high temperatures rather than the salad types of vegetables. Therefore, it is essential to know the names and types of vegetables. Please mention it. In addition, the risk is different for raw and cooked vegetables. What is the source of the water sample? It is better to write a short paragraph about sample types, sources, etc.

Line no. 123, 140: Please make “E. coli” italic and search the whole manuscript and supplementary file for similar errors.

Line no. 131: Please avoid (.) color in writing.

Line no. 140-141: Based on the statement, positive control was used in PCR amplification. Please check the Fig. S2 and revise the figure legend.

Line no. 161: Please mention the incubation period; generally, 16 hours is required to interpret the disc diffusion test.

Line no. 162: Please check the sentence – “multidrug resistance….”

Table 2: To me, in Pearson correlation analysis, when a variable is constant (100% or 0%), that variable is not computed. The prevalence of ampicillin resistance is 100%. Therefore, Pearson correlation for ampicillin is not possible. Please revise Table 2.

Table 3: Table 3 requires colossal revision. As per the statement, 54 isolates were randomly selected for the antimicrobial susceptibility test. Therefore, the number of isolates from different resistance patterns must be 54. However, it is only 17 from Table 3, column 4. Currently, among the 17 isolates, only eight are classified as MRD. Please add all 54 isolates in Table 3. Then, a different finding (maybe the pattern will be more, and the MDR percent will be changed) will be found. In addition, the heading of column 4 is “No. of MDR Isolates (%).” However, the patterns from rows 5 to 10 are not MDR by definition. Furthermore, the percentage in column 4 is incorrect, as they are not computed based on isolate number but antibiotic class. After the revision, there will be massive changes in results and discussion.

Line no. 263-264: This data is not found in the Table 4. Please check for similar errors in the whole manuscript.

Table 4: It is better to find the association of different tet genes in tetracycline resistance similarly to different bla genes for the beta-lactam antibiotics. However, this study does not have that design. Finding an association of tetA in some heterogeneous phenotypic resistance (ampicillin, ciprofloxacin, and others) is not useful and is the same for blaTEM. To establish such a relationship, please point them out in the discussion section with solid references.

Line no. 267 -270: This information is not helpful. Among the eight tetracycline-resistant isolates, seven had blaTEM, which is only 15.9%, based on Table 4, and the Authors are presenting it as a low percentage of blaTEM in tetracycline resistance. However, it could be a maximum of 8 isolates, as the number of tetracycline resistance is 8. Then how could it be 100% or close to 100%? It is not possible. Therefore, this comparison is worthless. I suggest not to keep this table.

Line no. 265: Please make the gene name style uniform.

Please check that the figure legends are missing and the figures are not self-explanatory.

Reviewer #3: 1.The affiliation for co-author number 3 and 4 from Taiwan and Thailand should be completed like others.

2. There were so many factors related to the difference between the rooftop and the surface gardens, thus, how different of soil, water and vegetable preparation among the 3 areas, Since this lack of the elementary information of these 3 areas of gardening for vegetable. Of course, that E. coli could be detected anywhere without any suspicious questions but the results seem not so benefit in term of garden management of vegetable for human consumption.

3. Please added the demographic information of DNCC, DSCC and GCC of how different of soil, water and vegetable growing in these 3 areas. Not just only details of 3 different location which show no meaning for E. coli isolation.

4. The result shown that E. coli from rooftop garden was lower than surface garden, however, reader still do not know how difference of gardening management of these two kinds of garden and pricing of 2 different gardening reported in urban and peri-urban areas.

5. How come only AMR genes of blaTEM and tetA were studied? How about the others? This is the limitation of genotypic study in this research work. Where is malB?

6. This study and the conclusion lacks of management issue after finding the E. coli contamination in Vegetable, of which the contamination normally found in fresh vegetable. Just only mentioned in line between 307-309 is too few.

7. Line 369-371: the recommendation should be more strictly applicable rather than only using potable water to clean the rooftop garden. Any other application for the surface garden should be done as well??

6. Why didn’t author mentioned about malB gene in the genotypic study? It didn’t mention at all so please add details inside.

Reviewer #4: 1. Authors are requested to update the reference list and cite with some recent articles.

2. Line 140. E. coli should be in Italic. Please check this throughout the manuscript.

3. Line 111 Cross-sectional studies of what?? Make it clear

4. What are the microflora of rhizospheric soils? Please identify the soil microflora of each sampling sites and including the findings in the revision.

5. Is there is any horizontal gene transfer between E. coli with plant associated bacteria?

6. Authors are requested to draw a scheme how E. coli adapts to plants defense molecules viz salicylic and jasmonic acid?. How plants induce selection for resistant E. coli?

7. Authors may also check the presence of AvrE, HopZ proteins in any plant system to understand how E. coli-plant interactions.

8. Picture quality and presentation is poor. Please increase the dpi atleast 300 dpi.

9. Why GCC and DSCC rooftop have prevalence of E. coli >70? Explain

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Professor Sukumar Saha

Reviewer #2: Yes: Md. Abdus Sobur

Reviewer #3: No

Reviewer #4: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2025 Feb 6;20(2):e0315938. doi: 10.1371/journal.pone.0315938.r002

Author response to Decision Letter 0

5 Nov 2024

Dear Editor,

Attached to this submission is our point-by-point responses to the comments raised by both editor and reviewers. We would like to take this opportunity to express our sincere thanks to the expert reviewers/editors who identified several areas in our manuscript that were needed corrections as well as modifications. We also would like to cordially thank you for allowing us the change to resubmit a revised version of the manuscript.

We have revised and updated the manuscript with some modifications as per reviewers’ suggestion. Please find all changes highlighted in RED color fonts in the revised manuscript. We also have provided a clean manuscript for your kind perusal.

Attachment

Submitted filename: renamed_a9e47.pdf

pone.0315938.s010.pdf (136.3KB, pdf)

Decision Letter 1

Bilal Aslam

4 Dec 2024

Prevalence and antibiotic resistance of Escherichia coli in urban and peri-urban garden ecosystems in Bangladesh

PONE-D-24-32199R1

Dear Dr. Rahman,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Bilal Aslam, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Bilal Aslam

19 Dec 2024

PONE-D-24-32199R1

PLOS ONE

Dear Dr. Rahman,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Bilal Aslam

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Table. Sampling information of the study.

    (DOCX)

    pone.0315938.s001.docx (23.8KB, docx)
    S2 Table. Number of E. coli positive samples from the study areas.

    (DOCX)

    pone.0315938.s002.docx (23.7KB, docx)
    S3 Table. Prevalence of E. coli in the study areas.

    (DOCX)

    pone.0315938.s003.docx (23.1KB, docx)
    S4 Table. Prevalence of E. coli in the rooftop and surface gardens of the study areas.

    (DOCX)

    pone.0315938.s004.docx (23.8KB, docx)
    S5 Table. Prevalence of E. coli in different samples of rooftop gardens.

    (DOCX)

    pone.0315938.s005.docx (23.9KB, docx)
    S6 Table. Prevalence of E. coli in different samples of surface gardens.

    (DOCX)

    pone.0315938.s006.docx (24KB, docx)
    S1 Fig. Study areas and sampling locations.

    (a) Urban (Dhaka North City Corporation; DNCC and Dhaka South City Corporation; DSCC) and peri-urban (Gazipur City Corporation; GCC) areas of Bangladesh. (b) Rooftop gardens and (c) Surface gardens.

    (JPG)

    pone.0315938.s007.jpg (2.9MB, jpg)
    S2 Fig. PCR amplification of malB gene of Escherichia coli.

    Lane 1: 1 kb DNA Marker; Lane 2: Negative control; Lane 3: Positive control; and Lane 4–13: Representative E. coli isolates.

    (JPG)

    pone.0315938.s008.jpg (50.6KB, jpg)
    S3 Fig

    (a) PCR amplification of beta-lactamase-producing blaTEM gene in representative E. coli isolates. (b) PCR amplification of tetracycline resistance tetA gene in representative E. coli isolates.

    (JPG)

    pone.0315938.s009.jpg (84.9KB, jpg)
    Attachment

    Submitted filename: renamed_a9e47.pdf

    pone.0315938.s010.pdf (136.3KB, pdf)

    Data Availability Statement

    All relevant data are within the paper and its Supporting Information files. The minimal dataset necessary to replicate our study findings is publicly available in Supporting Information Files. Additional information regarding data and materials can be requested from the corresponding author.

    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES