Human umbilical cord mesenchymal stem cells-derived exosomal microRNA-181a retards nasopharyngeal carcinoma development by mediating KDM5C

Abstract

Objective

It has been studied that mesenchymal stem cells (MSCs)-derived exosomes could suppress tumor growth in nasopharyngeal carcinoma (NPC) and microRNA-181a (miR-181a) could mediate drug resistance in NPC. Focused on this work, the mechanism of human umbilical cord MSCs (hUC-MSCs)-derived exosomal miR-181a was explored in NPC cell progression.

Methods

NPC tissues and normal tissues were obtained from patients, and miR-181a and KDM5C expression was examined. hUC-MSCs-derived exosomes were extracted, identified and co-cultured with NPC cells (C666-1 and SUNE1). C666-1 cell progression in vitro and/or tumor growth in vivo were examined after incubation with exosomes, miR-181a or lysine-specific demethylase 5C (KDM5C). miR-181a and KDM5C expression were examined in NPC.

Results

miR-181a expression was reduced while KDM5C expression was elevated in NPC. hUC-MSCs-derived exosomes restrained NPC cell growth in vivo and in vitro. Depleting or restoring exosomal miR-181a promoted or delayed NPC cell progression. KDM5C silencing suppressed NPC cell progression.

Conclusion

This study concluded that hUC-MSCs-derived exosomal miR-181a retards NPC development via negatively modulating KDM5C, serving as a candidate reference for the therapy of NPC.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00432-021-03684-6.

Introduction

Nasopharyngeal carcinoma (NPC) is an epithelial malignant tumor in the nasopharyngeal area, which has a high incidence in southern China (Chan, 2020). NPC is initiated with relevance to Epstein-Barr virus infection, environmental and genetic risk factors (Wu, 2020). Early NPC tumors can be treated by radiotherapy, but the survival of NPC patients is unfavorable due to diagnosis at an advanced stage (Wang 2020b). At the same time, NPC primary and/or local recurrence possibly happens after radiotherapy, and repeated irradiation often induces serious complications (Li 2020). Hence, agents that are effective and applicable for NPC are urgently required.

Human umbilical cord mesenchymal stem cells (hUC-MSCs) can migrate to the nasal mucosa propria and improve mucus clearance time and mucosal edema in nasal complications after radiotherapy (Duan 2015). Exosomes are extracellular vesicles generated by all types of cell that are able to mediate the extracellular communication in a tumor microenvironment, thus to modulate the process of tumors (Wang 2020c). Specifically, exosomes released by hUC-MSCs can mediate cell proliferation, invasion, migration and apoptosis to inhibit the malignant phenotype of cancers, such as esophageal squamous cell carcinoma (ESCC), ovarian cancer and breast cancer (He 2020; Qiu 2020; Yuan 2019). Often, exosomes could suppress the development of cancers through transport microRNAs (miRNAs) into the tumor sites. For instance, MSCs-released exosomes could deliver miR-34c into the NPC tumor site, thereafter the malignant behaviors of NPC cells are restrained (Wan 2020). Of the member of miRNAs, miR-181a is usually an anti-tumor actor that restricts the aggressive activities of cancer cells, such as laryngeal carcinoma cells and non-small cell lung cancer (NSCLC) cells (Dai 2019; Shi 2017). Also, miR-181a has been confirmed to involve in NPC drug resistance, and restored miR-181a can enhance the paclitaxel-sensitivity of NPC cells (Wang et al. 2017). Lysine specific demethylase 5 (KDM5C) was predicted as a target of miR-181a on the bioinformatics website and we speculated it may involve in miR-181a-mediated NPC development. KDM5C, a histone H3K4-specific demethylase has been studied to enhance cell proliferation in prostate cancer (Hong 2019), and regulate cell migration and invasion in hepatocellular carcinoma (HCC) (Ji 2015). Searching for the literature, we have recognized the actions of hUC-MSCs-derived exosomes, miR-181a and KDM5C in cancers, thus, we hypothesized that miR-181a from hUC-MSCs-derived exosomes may function to retard NPC cell progression by interacting with KDM5C.

Methods and materials

Ethics statement

The experiment approval was obtained from ethics committee of Hunan University of Chinese Medicine. The participants signed the informed consent. All animal experiments were in conformity with the Guidelines for the Care and Use of Laboratory Animals (National Academy of Sciences Press, revised in 2010).

Specimen collection

From March 2015 to April 2018, NPC patients (n = 134) in Hunan University of Chinese Medicine were enrolled in the study. The patients including 87 males and 47 females, were 28–80 years old, with an average age of 47.36 ± 10.30 years. All patients were diagnosed pathologically and none of them received chemotherapy or radiotherapy before surgery. The preoperative biopsy specimens and nasopharyngeal mucosa tissues adjacent to cancer lesion were stored in liquid nitrogen (Lv 2020). Umbilical cord specimens were collected from healthy newborns and stored in liquid nitrogen (Xie 2019).

Cell culture

NPC cell lines (C666-1 and SUNE1) were provided by Shanghai Huiying Biological Technology Co., Ltd. (Shanghai, China). The Roswell park memorial institute 1640 medium (Hyclone, Logan, USA) containing 10% fetal bovine serum (FBS; 10099141, GIBCO BRL, Gaithersburg, USA), 100 U/mL penicillin and 100 μg/L streptomycin was applied to the culture of NPC cell lines. All cell lines were routinely cultured in an incubator (thromo3111, Jinan Beisheng Medical Devices Co., Ltd., Shandong, China).

Isolation and induction of hUC-MSCs

The umbilical cords (10–12 cm) near the placenta were collected from healthy newborns delivered by full-term cesarean section. The adventitia, arteries and veins were removed, and the wharton’s jelly was peel off, cut into pieces and incubated with type II collagenase (100–200 U/mL) for 6–8 h. After that, hUC-MSCs were filtered through a 200 µm sieve, centrifuged, resuspended in the special culture medium and cultured (the medium was changed every other day).

Osteogenic differentiation and adipogenic differentiation of hUC-MSCs were induced with the OriCell™ kit (Cyagen Biosciences Inc, CA, USA). The hUC-MSCs of passage 3 were alternately reacted with adipogenic induction and differentiation complete culture medium A and B for 21 days, then stained with oil red O staining solution and observed under a microscope.

The hUC-MSCs of passage 3 were incubated with hUC-MSC osteogenic differentiation complete culture medium on the 6-well plate coated with gelatin for 21 days, stained with alizarin red solution and observed under a microscope (Xie 2019).

Identification of hUC-MSCs

hUC-MSCs of passage 3 were detached with 0.25% trypsin, centrifuged at 1000 r/min and rinsed twice with phosphate-buffered saline (PBS) containing 1% bovine serum albumin (BSA). hUC-MSCs (1 × 10⁶ cells/mL, 200 μL) were probed with 2 μL antibody (CD31, CD44, CD45 and CD73; all from Abcam, MA, USA), centrifuged and detected by flow cytometry.

Extraction and identification of exosomes

hUC-MSCs of passage 3 were rinsed with sterile PBS to remove residual liquid and incubated with serum-free medium for 24 h. The supernatant during passage was collected and processed by a horizontal rotor to remove dead cells, cell debris and large cell contaminants. Then, the supernatant was ultracentrifuged at 30,000 r/min to produce the exosome pellet, which was then resuspended and ultracentrifuged once again at 30,000 r/min. Next, the obtained exosome pellet was resuspended in 500 μL PBS and photographed by a transmission electron microscope (TEM) (Fu 2020).

The particle size of exosomes was analyzed by Nano series-Nano-ZS (Zetasizer Nano ZS, Hangzhou Neoline Technology Co., Ltd., Zhejiang, China). The exosome pellet was resuspended, dropped on a copper mesh with a diameter of 2 nm, counter-stained with 3% phosphotungstic acid (pH 6.8) and observed and photographed under a TEM (JEM-1200EX; JEOL, Tokyo, Japan). Exosome markers CD63 and CD81 were examined by Western blot assay (Hu 2020).

Cell transfection

miR-181a mimic/inhibitor, along with their negative control (NC) were supplied by Ribobio Co., Ltd. (Guangzhou, China). KDM5C-NC, sh-KDM5C and overexpression (oe)-KDM5C plasmids were constructed by Sangon Biotech (Shanghai, China). Cell transfection was carried out with Lipofectamine 2000 reagent (Invitrogen). miR-181a mimic/inhibitor or their NC were transfected into hUC-MSCs while KDM5C-NC, sh-KDM5C, or oe-KDM5C into C666-1 cells.

Uptake of exosomes by C666-1 cells

The exosome suspension (1 mL) was mixed PKH-26 (4 μL) and incubated for 4 min. Subsequently, the mixture was added with an equal volume of 1% BSA, then supplemented with PBS to 8.9 mL, and ultracentrifuged at 120,000×g (70 min). The red pellet was resuspended in 1 mL PBS.

C666-1 and SUNE1 that were adhered to the wall were added with exosomes for incubation of 24 h. After that, cells were fixed in 4% paraformaldehyde, blocked with 5% BSA, stained with 4ʹ,6-diamidino-2-phenylindole for 1 h, mounted with an anti-fluorescence quencher and observed by a fluorescence microscope (Olympus, Tokyo, Japan).

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Trizol reagent (16096020, Thermo Fisher Scientific Inc., Waltham, USA) was adopted to extract total RNA from tissues, cells and exosomes. RNA reverse transcription was conducted by a cDNA synthesis kit (K1622, Fermentas Inc., Ontario, USA). miR-181a and KDM5C expression was tested by a PrimeScript RT-PCR kit (Takara, Shiga, Japan). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 were utilized to normalize the results. The data was measured by the 2^−ΔΔCt method (Lv 2020). The primers were displayed in Table 1.

Table 1.

Primer sequences

Genes	Primer sequences (5ʹ–3ʹ)
miR-181a	F: ACACTCCAGCTGGGAACATTCAACGCTGTCGG
	R: CTCAACTGGTGTCGTGGA
KDM5C	F: GAGGTGACCCTGGATGAGAA
	R: CAGGAGCTGAGGTCTGAAC
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT
GAPDH	F: CGGAGTCAACGGATTTGGTCGTAT
	R: AGCCTTCTCCATGGTGGTGAAGAC

F forward, R reverse, miR-181a microRNA-181a, KDM5C lysine-specific demethylase 5C, GAPDH glyceraldehyde-3-phosphate dehydrogenase

Western blot assay

Total protein of tissues, cells and exosomes was extracted by radio-immunoprecipitation assay cell lysis buffer (R0010, Solarbio Science & Technology Co., Ltd., Beijing, China), separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, transferred to the polyvinylidene fluoride membrane, and blocked by 5% skimmed milk. After that, the membrane was probed with the rabbit primary antibodies KDM5C (1:1000) and GAPDH (ab32391, 1:1000), and with horseradish peroxidase-labeled goat anti-rabbit immunoglobulin G secondary antibody (ab205718, 1:5000; all from Abcam). The protein bands were imaged in the Bio-Rad imaging system (BioRad, Hercules, USA) and the gray values were evaluated by Quantity One v4.6.2 software. GAPDH served as the internal control.

Cell counting kit (CCK)-8 assay

Cells in 96-well plates (1 × 10³ cells/well) were supplemented with 1/10 of the total volume of CCK-8 reagent (Dojindo, Japan) at 0, 1, 2, and 3 days and further cultivated for 3 h. A microplate reader was utilized to measure the optical density (OD_{450 nm}) values.

Colony formation assay

Cells in 6-well plates (600 cells/well) were allowed to incubate for 2–3 weeks to form colonies. The visible colonies were added with 5 mL acid/methanol (1:3) and stained with an appropriate amount of Giemsa staining solution. The colonies (> 50 cells) were counted under a low-power microscope.

Flow cytometry

Cells were collected by trypsinization and centrifugation at 1000 r/min (2 min). Cell cycle distribution: cells were fixed in 75% pre-cooled ethanol (500 μL) overnight, soaked in 100 μL RNase A (Auragene Biological Technology, Changsha, China), incubated with 500 μL propidium iodide (PI; Solarbio) for 30 min and detected by a FACScanto II flow cytometer (BD Biosciences). Cell apoptosis: cells (1.5 × 10⁵ cells/mL) were stained with Annexin V-fluorescein isothiocyanate for 5 min and analyzed by a flow cytometer.

Transwell assay

Cell invasion: Matrigel (BD Company, NJ, USA) together with serum-free medium, was spread on the upper chamber surface of the Transwell chamber. Cells were added on the bottom of the Transwell chamber, and then incubated with 10% FBS for 48 h. After that, the Transwell chamber was taken out, and the invasive cells were fixed with paraformaldehyde, stained with crystal violet buffer and counted.

Cell migration: Matrigel was not required, and the remaining steps were the same as the invasion experiment (Jiang 2019).

Tumor xenografts in nude mice

Specific pathogen-free BALB/c nude mice (6 weeks old; 18–22 g) were provided by Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China). Nude mice (n = 5 each group), randomly selected by double-blind method, were injected subcutaneously with NPC cells (25 μL, 1 × 10⁶ cells) and a week later with exosomes. The length and width of tumors were measured with a vernier caliper every 7 days. Volume = 1/2 × (length × width²). All mice were euthanized at 5 weeks post injection to collect the tumors, which were photographed and weighed.

Dual luciferase reporter gene assay

The binding site between miR-181a and KDM5C was predicted by TargetScan 7.2. The correctly sequenced luciferase reporter was co-transfected with KDM5C-wild type (wt) or KDM5C-mutant type (mut) into C666-1 cells with miR-181a mimic or mimic NC. The specific steps followed the specifications of Dual Luciferase Reporter Gene Assay Kit (Yeasen, Shanghai, China) and the luciferase activity was measured by a dual-luciferase assay system (Promega, Madison, USA) (Wang et al. 2020a).

Statistical analysis

All data were processed by SPSS 21.0 statistical software (IBM, NY, USA). Measurement data were expressed as mean ± standard deviation. The comparison between NPC tissues and normal tissues was performed by paired t test while that between other two groups by independent sample t test. The difference among multiple groups was evaluated by one-way analysis of variance (ANOVA), followed by Tukey’s post-test. Data comparison at different time points was performed by repeated analysis of variance and Bonferroni post-hoc test. Pearson was adopted to evaluate the correlation between miR-181a and KDM5C in NPC tissues. P < 0.05 was of statistical significance.

Results

miR-181a expression is reduced in NPC; miR-181a is delivered by hUC-MSCs-derived exosomes into NPC cells

When investigating the role of miR-181a in NPC, we tested miR-181a expression in NPC tissues and normal nasopharyngeal mucosa, and found that miR-181a was down-regulated in NPC tissues (Fig. 1A). Meanwhile, the correlation between miR-181a expression and clinicopathological features of NPC patients was evaluated, and the results showed miR-181a expression was correlated with tumor node metastasis staging and lymph node metastasis (Table 2).

Fig. 1.

miR-181a expression is reduced in NPC; miR-181a is delivered by hUC-MSCs-derived exosomes into NPC cells. A RT-qPCR tested miR-181a expression in NPC tissues and normal tissues; B flow cytometry detected the surface markers of hUC-MSCs; C the morphology of hUC-MSCs, and oil red staining and alizarin red staining of hUC-MSCs; D TEM observed exosomes (50 nm); E western blot detected CD63 and CD81 in exosomes; F NTA evaluated exosomes; G RT-qPCR detected miR-181a expression in exosomes; H uptake of exosomes by C666-1 and SUNE1 cells; I RT-qPCR detected miR-181a expression in C666-1 and SUNE1 cells; the data in the figure were all measurement data, showing as mean ± standard deviation (n = 3). The comparison between NPC tissues and normal tissues was performed by paired t test while that between two groups by independent sample t test. The difference among multiple groups was evaluated by one-way ANOVA and Tukey’s post-test

Table 2.

The correlation between miR-181a expression and clinicopathological features of NPC patients

Clinicopathological features	Cases	miR-181a level
		Low expression	High expression	p
Gender				0.7175
Male	87	45	42
Female	47	22	25
Age (years)				0.604
≤ 45	64	34	30
> 45	70	33	37
Lymph node metastasis				< 0.0001
Yes	74	54	20
No	60	13	47
TNM staging				< 0.0001
I–II	72	52	20
III–IV	62	15	47
Smoking history				0.8628
Yes	64	33	31
No	70	34	36

TNM tumor node metastasis

Identification of hUC-MSCs: the surface markers of hUC-MSCs were identified by flow cytometry, and the results manifested that CD44 and CD73 were positively expressed, and CD31 and CD45 were negatively expressed (Fig. 1B). Observed through a microscope, hUC-MSCs were in a small long spindle shape and surrounded by many filiform pseudopods. Through oil red O staining, the intracellular fat droplets were red and the nucleus was blue in adipocytes. Through alizarin red staining, osteoblasts turned to purple-red (Fig. 1C). hUC-MSCs-derived exosomes were separated by ultracentrifugation, showing disc-shaped vesicles under the TEM (Fig. 1D). Western blot showed that CD63 and CD81 were positively expressed in exosomes (Fig. 1E) and Nanoparticle Tracking Analysis (NTA) found that the hUC-MSCs-derived exosomes were distributed in 30–150 nm (Fig. 1F).

Next, RT-qPCR discovered that miR-181a expression was elevated in exosomes from hUC-MSCs transfected with miR-181a mimic; on the other hand, miR-181a expression was reduced in exosomes after hUC-MSCs transfected with miR-181a inhibitor (Fig. 1G). We observed in exosome uptake experiment that C666-1 and SUNE1 cells took up exosomes (Fig. 1H). RT-qPCR analysis found that exosomes treatment increased miR-181a expression. Meanwhile, elevated miR-181a-modified exosomes further enhanced miR-181a expression while reduced miR-181a-modified exosomes suppressed miR-181a expression in C666-1 and SUNE1 cells (Fig. 1I).

hUC-MSCs-derived exosomes restrict NPC cell growth in vivo and in vitro

miR-181a was determined to down-regulate in NPC, and hUC-MSCs-derived exosomes could deliver miR-181a to C666-1 and and SUNE1 cells. Next, the effect of exosomes on C666-1 and and SUNE1 cell progression was examined. CCK-8 and colony formation assays, flow cytometry and Transwell assay were applied to measure cell proliferation, invasion, migration and apoptosis. The results evidenced that exosomes suppressed the proliferation, invasion and migration but promoted the apoptosis of C666-1 cells (Fig. 2A–F). Repeated experiments were conducted in SUNE1 cells, and the results were consistent with those of C666-1 cells (Supplementary Fig. 1A–F), clarifying that hUC-MSCs-derived exosomes disrupted the biological functions of NPC cells.

Fig. 2.

hUC-MSCs-derived exosomes restrict NPC cell growth in vivo and in vitro. A CCK-8 assay detected C666-1 cell proliferation; B colony formation assay detected C666-1 cell colony formation ability; C flow cytometry detected C666-1 cell cycle; D flow cytometry detected C666-1 cell apoptosis E transwell assay detected C666-1 cell migration; F transwell assay detected C666-1 cell invasion; G tumor volume of nude mice; H representative tumors and tumor weight; the data in the figure were all measurement data, showing as mean ± standard deviation (n = 5). *P < 0.05 compared with the PBS group. The comparison between two groups was analyzed by independent sample t test

Tumor xenografts in mice manifested that the tumor volume was increased in a time-dependent manner. The resected tumors were weighed, and the smaller tumors were found in mice injected with exosomes (Fig. 2G, H).

Regulation of NPC cell progression by hUC-MSCs-derived exosomes after targeting miR-181a

For further exploring the role of exosomal miR-181a from hUC-MSCs in NPC cells, exosomes with altered miR-181a expression were co-cultured with C666-1 cells. The findings demonstrated that exosomes from miR-181a inhibitor-transfected hUC-MSCs induced proliferation, invasion, and colony formation of C666-1 in vitro and tumor formation in vivo. On the other hand, exosomes from miR-181a mimic-modified hUC-MSCs showed opposite effects in vitro and in vivo (Fig. 3A–H).

Fig. 3.

Depleted/restored miR-181a in hUC-MSCs-derived exosomes advances/delays NPC cell progression and tumor growth. A CCK-8 assay detected C666-1 cell proliferation; B colony formation assay detected C666-1 cell colony formation ability; C flow cytometry detected C666-1 cell cycle; D flow cytometry detected C666-1 apoptosis; E transwell assay detected C666-1 cell migration; F transwell assay detected C666-1 cell invasion; G tumor volume of nude mice; H representative tumors and tumor weight; the data in the figure were all measurement data, showing as mean ± standard deviation (n = 5). *P < 0.05 compared with the NC-Exo group. The difference among multiple groups was evaluated by one-way ANOVA and Tukey’s post-test

miR-181a negatively modulates KDM5C expression

RT-qPCR and Western Blot showed that KDM5C was up-regulated in NPC tissues (Fig. 4A, B). To explore the interaction between miR-181a and KDM5C, Pearson test was performed and the results indicated that miR-181a and KDM5C were negatively correlated in NPC cells (Fig. 4C). For further verification, the binding site between miR-181a and KDM5C was predicted by TargetScan 7.2, and the relation between the two was further confirmed by dual-luciferase reporter experiment (Fig. 4D, E).

Fig. 4.

miR-181a negatively modulates KDM5C A RT-qPCR detected KDM5C mRNA expression in NPC tissues and normal tissues; B western blot detected KDM5C protein expression in NPC tissues and normal tissues; C Pearson analyzed the correlation between miR-181a and KDM5C expression in NPC tissues; D TargetScan 7.2 predicted the targeting sites of miR-181a and KDM5C; E dual-luciferase reporter gene assay detected the targeting relationship between miR-181a and KDM5C; F RT-qPCR detected KDM5C mRNA expression in C666-1 cells; G western blot detected KDM5C protein expression in C666-1 cells; the data in the figure were all measurement data, showing as mean ± standard deviation (n = 3). The comparison between NPC tissues and normal tissues was performed by paired t test while that between two groups by independent sample t test. The difference among multiple groups was evaluated by one-way ANOVA and Tukey’s post-test

Next, RT-qPCR and Western blot measured KDM5Cexpression in C666-1 cells after exosome treatment and the findings highlighted that exosomes carrying miR-181a mimic suppressed KDM5C expression in C666-1 cells while those carrying miR-181a inhibitor had the opposite effect on KDM5C expression (Fig. 4F, G).

KDM5C silencing suppresses NPC cell progression

As suggested by the above findings, it was known that up-regulating miR-181a impaired the biological activities of NPC cells; and miR-181a negatively mediated KDM5C expression. However, the mechanism of KDM5C in NPC remained unclear. Given that, KDM5C down- and up-regulation assays were executed on C666-1 cells (Fig. 5A, B) and the findings reflected that restoring KDM5C induced C666-1 cell progression while depleting KDM5C functioned oppositely (Fig. 5C–H).

Fig. 5.

KDM5C silencing suppresses NPC cell progression. A RT-qPCR detected KDM5C mRNA expression in C666-1 cells; B western blot detected KDM5C protein expression in C666-1 cells; C CCK-8 assay detected C666-1 cell proliferation; D colony formation assay detected C666-1 cell colony formation ability; E flow cytometry detected C666-1 cell cycle; F Flow cytometry detected C666-1 apoptosis G transwell assay detected C666-1 cell migration; H transwell assay detected C666-1 cell invasion; the data in the figure were all measurement data, showing as mean ± standard deviation (n = 3). *P < 0.05 compared with the KDM5C-NC group. The difference among multiple groups was evaluated by one-way ANOVA and Tukey’s post-test

Discussion

NPC is a squamous cell carcinoma, showing an inclination of systemic dissemination (Huq 2020). In the present research, we displayed the performance of exosomal miR-181a in NPC. At first, we measured that miR-181a expression maintained a low level in NPC which drove NPC development. Subsequently, we observed that hUC-MSCs-derived exosomes restricted NPC cell growth in vivo and in vitro. Moreover, we investigated that miR-181a could be delivered by hUC-MSCs-derived exosomes into NPC cells and restored exosomal miR-181a delayed NPC cell progression while depleted exosomal miR-181a had the opposite effects. Next, we disclosed that miR-181a negatively mediated KDM5C to affect NPC process and silencing KDM5C destroyed the biological activities of NPC cells.

In NPC, miR-181a was revealed to be regulated by lncRNA colon cancer-associated transcript-1 in cells, showing a down-regulation in its expression and resulting in restrained apoptosis of paclitaxel-resistant cells (Wang et al. 2017). Including but not limited to NPC, miR-181a has been recorded to down-regulate in laryngeal squamous cell carcinoma, and up-regulating miR-181a was obstructive for the malignant cell progression while down-regulating owned the opposite effects (Hao 2019). Similarly, another study has observed the reduced miR-181a in laryngeal cancer, and miR-181a knockdown increased nucleophosmin 1 expression, thereby restraining cell apoptosis via apoptosis-related pathways (Wang 2019). Also, miR-181a-5p was suppressed by overexpressing small nucleolar RNA host gene 7 in NSCLC, and NSCLC cells with restored miR-181a-5p were manifested with destroyed cell viability, colony-forming, migration, invasion and anti-apoptosis abilities (Wang et al. 2020a). Furthermore, miR-181a-5p was evidenced to down-regulate in breast cancer, and overexpressing miR-181a-5p was specialized to mediate fibroblast growth factor receptor 3/signal transducer and activator of transcription 3 axis to restrict cell metastasis and proliferation (Mao 2019). From these literature, the anti-tumorigenic functions of miR-181a were consistent with the concluded results in this research.

Exosomes often function to carry miRNAs to tumors to treat cancers. Reported previously, the introduction of hUC-MSCs-derived exosomes prevented ESCC cells from invading, migrating and forming tumors in vitro and in vivo through delivering overexpressed miR-375 to regulate enabled homolog (He 2020). Besides, in pancreatic ductal adenocarcinoma, exosomes released by hUC-MSC could encumber cell proliferation and invasion, and induce cell cycle attest and apoptosis through transportation of miR-145-5p (Ding 2019). In a specific way, hUC-MSCs-derived exosomes were proved to discourage chronic myelogenous leukemia cell viability and reinforce cell apoptosis which were induced by imatinib (Liu 2018). Independently, the exosomes secreted from hUC-MSCs were reported to diminish cellular progression in ovarian cancer, while in combination, hUC-MSCs-derived exosomes with suppressed miR-146a were documented to drive cancer development (Qiu 2020). To the best we have known, hUC-MSCs-released exosomes with up-regulated miR-148b-3p undermined the aggressiveness of breast cancer cells and tumorigenic capacity in animal models (Yuan 2019). All of these studies have provided evidence that hUC-MSCs-derived exosomes could disrupt the development of cancers through miRNA transportation. However, nearly no research has figured out the combined performance of hUC-MSCs-released exosomes and miR-181a in cancers.

KDM5C was commonly regarded as a tumor driver. Reviewed in a creative research, elimination of KDM5C depressed S100A oncogenes and cancer-related phenotypes (Shen 2016). Excessively expressed KDM5C was noticed in HCC, and the impeded cell migration and invasion in HCC were ascribed to functionally knocked down KDM5C whereas restored KDM5C elicited the aggressive behaviors of HCC cells through modulating bone morphogenetic protein-7 (Ji 2015). Also, KDM5C was proved to overexpress in prostate cancer, which would strengthen the proliferation of malignant cells which were resistant to castration (Hong 2019). Additionally, gastric cancer exhibited up-regulated KDM5C, which was contributory to the improved cell proliferation and invasion while KDM5C down-regulation exerted the opposite results (Sun 2017).

Conclusion

Briefly, our research caught the conclusion that up-regulated miR-181a in hUC-MSCs-released exosomes delayed the development of NPC via its negative regulation on KDM5C. This research has widely approached the potential strategy for NPC treatment. Much studies are expected to conduct extensively to further verify the results in this work.

Supplementary Information

Below is the link to the electronic supplementary material.

Funding

The financial reports of The Self-funded Research Projects of National Health and Family Planning Commission of Guangxi (NO. Z20170226); Basic Ability Improvement Project for young and middle-aged Teachers in Universities of Guangxi (NO. 2018KY0451); 2018 Guangxi scholarship Fund of Guangxi Education Department; Special Funding for Guangxi Special Experts (No. GRCT[2019]13#); Guangxi Medical High-level Leading Talents Training “139” Project (No. GWKJ[2018] 22#).

Declarations

Conflict of interest

The authors declare that they have no conflicts of interest.