Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2025 Jan 20;104(2):104837. doi: 10.1016/j.psj.2025.104837

Oral administration of recombinant Lactococcus lactis co-expressing fusion VP1 protein of duck hepatitis a virus type 1 and 3 protects ducklings against infection

Xiaoting Zhang a,b,c, Hui Yan a,b, Lei Bei a,b, Guige Xu a,b, Mingrui Zhao a,b, Ruihua Zhang a,b, Yu Meng a,b, Yanli Zhu a,b, Zhijing Xie a,b, Shijin Jiang a,b,⁎
PMCID: PMC11803836  PMID: 39854966

Abstract

Duck viral hepatitis (DVH) is one of the most common diseases of waterfowl. Duck hepatitis A virus type 1 (DHAV-1) and type 3 (DHAV-3) have been on the rise seriously endangering the development of duck farming. In this study, we constructed a recombinant Lactococcus lactis (L. lactis) co-expressing the fusion VP1 protein of DHAV-1 and DHAV-3. Western blot and immunofluorescence analyses confirmed that the fusion VP1 protein was expressed on the cell surface of recombinant L. lactis stain. After immunization with the recombinant L. lactis by oral administration, the ducklings were challenged with highly pathogenic DHAV-1 and DHAV-3 by natural infection. The results showed that the recombinant L. lactis induced the specific IgG antibodies, and significantly increased the level of mucosal secretory immunoglobulin A (sIgA) and cytokines, such as interleukin-4 (IL-4), interleukin-10 (IL-10), and interferon gamma (IFN-γ). The immunized ducklings delayed death for around 4 days, and reduced mortality with the relative percent survival (RPS) being 64.71 %, 61.54 % and 57.89 % in DHAV-1, DHAV-3 and DHAV-1 + 3 infection group respectively. These results showed that the recombinant L. lactis constructed in this study provides a promising candidate for prevention and control of DHAV-1 and DHAV-3 infection.

Keywords: DHAV-1, DHAV- 3, VP1, L. lactis, mucosal immune

Introduction

Duck viral hepatitis (DVH), mainly caused by duck hepatitis A virus (DHAV), is a highly fatal and rapidly spreading contagious disease of ducklings (Chalmers and Woolcock, 1984; Yang et al., 2012). DHAV is the only member of the novel genus Avihepatovirus in the family Picornaviridae. Excluding the poly(A) tail, DHAV's genome is a single-stranded positive-sense RNA approximately 7700 nucleotides (Kim et al., 2006, 2007; Tseng et al., 2007). It is encapsulated in an icosahedral structure, which is assembled with the structural proteins, namely VP0, VP3 and VP1 (Kim et al., 2006; Tseng et al., 2007). Among them, VP1 is considered as the external and dominant antigen with several conserved linear epitopes (Zhang et al., 2015; Wu et al., 2015; Xue et al., 2019).

Based on phylogenetic analyses and neutralization tests, DHAVs had been genetically classified into three serotypes: type 1 (DHAV-1), type 2 (DHAV-2), and type 3 (DHAV-3) (Kim et al., 2007; Tseng and Tsai, 2007; Gao et al., 2012). In recent years, co-infection of DHAV-1 and DHAV-3 has become increasingly prevalent in the domestic duck farms in China and Korea (Chen et al., 2013; Lin et al., 2016; Soliman et al., 2015). Live attenuated vaccines were developed to prevent the simultaneous infections caused by DHAV-1 and DHAV-3 (Zou et al., 2016; Kang et al., 2018). It is worth noting that multiple intramuscular injections can cause stress to the duck. Despite the availability of the vaccine, DHAV-like diseases still occurred. Therefore, the development of an effective and convenient vaccines is urgently needed to prevent simultaneous infections caused by DHAV-1 and DHAV-3.

Lactic acid bacteria (LAB) play a key role in maintaining the intestinal balance (Maldonado Galdeano et al., 2019). As a promising vaccine vectors, LAB has been proved to be effective mucosal delivery vehicles (Wells et al., 2011; García-Fruitós et al., 2012; Szatraj et al., 2017). Signal peptide and anchor protein are essential for anchoring functional protein. In terms of the mucosal presentation effect of recombinant LAB, anchoring expression of foreign protein is more advantageous than secretory expression or intracellular expression (Liu et al., 2020). The signal peptide Usp45 has been confirmed in almost all secreted expression of LAB (Avall-Jääskeläinen and Palva, 2006). Poly-γ-glutamic acid aynthetase A (pgsA, GenBank: KJ175232.1), a component protein of the Polyglutamate Synthetase (PGA) system of Bacillus subtilis, can be used as a bacterial surface display element to anchor the enzyme system stably on the surface of cell membrane (Ashiuchi et al., 2001). As a shortened anchored protein of pgsA, pgsA' could display exogenous proteins on the surface of Lactobacillus plantarum with a higher efficacy than pgsA (Cai et al., 2016). In this study, the Usp45-pgsA' was used to bind to the N-terminal of 1VP1-3VP1-eGFP fusion protein and anchor the DHAV target protein to the surface of Lactococcus lactis (L. lactis) MG1363. Our study revealed oral Lactococcus-based immuno-microecological preparations may be a potential strategy against DHAV-1 and DHAV-3 co-infection in the future.

Materials and methods

Bacterial strain and vector

The DHAV-1 LY0801 (FJ436047, median embryo lethal dose (ELD50) = 10-5.7/0.2 mL), DHAV-3 SD1201 strain (KC993890, ELD50 = 10-3.7/0.2 mL) were isolated and stored in our laboratory. The plasmid pMG36e and L. lactis strain MG1363 were purchased from BIO SCI BIO (Hangzhou, China). The bacillus subtilis was provided by the Shandong Baolai-leelai Bioengineering Co., Ltd. Escherichia coli (E. coli) DH5α competent cells was purchased from TaKaRa (TaKaRa, Dalian, China). pR-DHAV-1 and pR-DHAV-3 infectious clones, plasmid T7g10L-Usp45-VP1-eGFP-pMG36e, L. lactis MG1363/pMG36e, and monoclonal antibody (mAb) 4F8 were made in our previous works (Chen et al., 2017; Zhang et al., 2015, 2021).

Main reagents and antibodies

The Clone Express II One Step Cloning Kit and 2 × Phanta Master Mix were purchased from Vazyme Biotech Co., Ltd. (Nanjing, China). The Pure Plasmid Mini Kit and Gel Extraction Kit were both purchased from Beijing Cowin Biotech Co., Ltd. (Beijing, China). The 0.2 cm electrode gap was purchased from Bio-Rad Laboratories, Inc. (Bio-Rad, Hercules, CA, USA). The dialysis bag and lysozyme were purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). The anti-eGFP magnetic beads was purchased from Shanghai Epizyme Biomedical Technology Co., Ltd. (Shanghai, China). The Express Cast PAGE, 5 × SDS-PAGE Loading Buffer and Ncm Ecl Ultra were purchased from New Cell & Molecular Biotech Co., Ltd. (Suzhou, China). The enhanced HRP-DAB Chromogenic Kit was purchased from Tiangen biotech Co., Ltd. (Beijing, China). The eGFP-Tag Mouse mAb was purchased from Shanghai Abways Biotechnology Co., Ltd. (Shanghai, China). The HRP conjugated goat anti-mouse IgG was purchased from Sigma-Aldrich (St. Louis, USA). The AtarRuler Color Prestained protein Maker was purchased from GenStar Biotechnology Co., Ltd. (Beijing, China). The sIgA ELISA kit, IFN-γ ELISA kit, IL-4 ELISA kit and IL-10 ELISA kit were all purchased from Beijing Funcheng Biotechnology Co., Ltd. (Beijing, China). The L. lactis MG1363 was cultured in M17 medium supplemented with 0.5 % glucose (GM17, Haibo, Qingdao, China). The erythromycin was purchased from Solarbio Co., Ltd. (Beijing, China), the working concentration of which was 200 μg/mL in E. coli and 2 μg/mL in L. lactis.

Expression plasmid construction in E. coli

The primers used in this study are listed in Table 1. Using plasmid T7g10L-Usp45-VP1-eGFP-pMG36e as template, the first fragment T7g10L-Usp45 was amplified with primers 1F/1R, Using the bacillus genome as template, the fragment pgsA' was amplified with primers 2F/2R. Using plasmid pR-DHAV-1 as template, the DHAV-1/VP1 fragment was amplified with primers 3F/3R. Using plasmid pR-DHAV-3 as template, the DHAV-3/VP1 fragment was amplified with primers 4F/4R. Using plasmid pEGFP-3C as template, the fragment eGFP was amplified with primers 5F/5R. The T7g10L-Usp45, pgsA', 1VP1, 3VP1, eGFP were fused together, a 2955 bp fusion gene T7g10L-Usp45-pgsA'−1VP1-3VP1-eGFP with homologous arms of pMG36e, was obtained (Fig. 1). The final 2911 bp fragment was inserted to plasmid pMG36e with the restriction enzyme Xba Ⅰ and Hind Ⅲ. The recombinant plasmid was transformed into the E. coli DH5α competent cells, and the positive clones were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).

Table 1.

Primers used in this study.

Target cDNA Primer Sequence (5′→3′)
T7g10L-Usp45 1F CCGGGGATCGATCCTCTAGAAATAATTTTGTTTAACTTTAAG
1R TGAAAGCTCAGTTCTTTTTTAGCGTAAACACCTGAC
pgsA' 2F CGTTGTCAGGTGTTTACGCTAAAAAAGAACTGAGCTTTC
2R CCTAACTGGTTAGAATCACCGACTTTCTGGTACGAAATTTTC
1VP1 3F GAAAATTTCGTACCAGAAAGTCGGTGATTCTAACCAGTTAGG
3R CCAAGCTGATTAGAATCACCTTCAATTTCCAAATTGAGTT
3VP1 4F CTCAATTTGGAAATTGAAGGTGATTCTAATCAGCTTGGTGAT
4R CAGCTCCTCGCCCTTGCTCACTTCAATTTCTAGATGGAGCT
eGFP 5F GAGCTCCATCTAGAAATTGAAGTGAGCAAGGGCGAGGAGCTG
5R TTCAGACTTTGCAAGCTTTCAATGGTGATGGTGATGATGGTTA
Open in a new tab

Fig. 1.

Fig 1

Open in a new tab

Construction diagram of the recombinant plasmid in the E. coli DH5α. The fused T7g10L-Usp45-pgsA'−1VP1-3VP1-eGFP was finally inserted into the plasmid pMG36e after being digested by Xba Ⅰ and Hind Ⅲ.

Construction of recombinant L. lactis MG1363/1 + 3VP1

The competent cells of L. lactis MG1363 were prepared in advance. The plasmid Usp45-pgsA'−1VP1-3VP1-eGFP-pMG36e was transferred into the competent cells by electroporation technology, and the cells were cultured in GM17 agar medium containing erythromycin at a concentration of 1 μg/mL. The positive plasmid was transformed into the L. lactis MG1363 for the second time. The positive recombinant MG1363 strain contains T7g10L-Usp45-pgsA'−1VP1-3VP1-eGFP-pMG36e, renamed as MG1363/1 + 3VP1. L. lactis MG1363/pMG36e as a negative control. The recombinant L. lactis solution was taken on sterile slides for observation under the Nikon upright fluorescence microscope 55i (Nikon, Japan).

Western blot analysis

Recombinant L. lactis MG1363/1 + 3VP1 and MG1363/pMG36e were grown in GM17 without erythromycin and cultured at 37°C for 18 h. The culture supernatant and the bacterial pellet sedimentation were separated by centrifugation at 5000 rpm for 10 min. The sedimentation was suspended with TES solution, 37°C for 30 min, the solution was centrifuged and resuspended with TE buffer. After centrifugation at 5000 rpm for 10 min, the precipitation was collected with ddH2O and repeated freeze-thaw for 5 times. After being centrifuged at 4°C, the sedimentation was suspended with PBS solution. The target protein separated by anti-GFP magnetic beads (Beyotime Biotechnology, Jiangsu, China). The mAb 4F8 and eGFP-Tag mAb were respectively used as the primary antibody, the HRP-conjugated goat anti-mouse IgG (Sigma, 1:5000) was used as the secondary antibody.

Oral vaccination of ducklings

A total of 277 one-day-old cherry valley ducklings were bought from Jingwei husbandry company (Taian, China). Five one-day-old ducklings were randomly selected to collect serum and intestine samples. The remaining ducklings were divided into two groups, named experimental group and control group (Fig. 2).

Fig. 2.

Fig 2

Open in a new tab

Oral vaccination experiment in ducklings. ▲: Ducklings in experimental groups 1-4 were orally immunized with recombinant L. lactis MG1363/1 + 3VP1 at 2, 4, 10 and 14 days. ◆: Ducklings in blank control groups 5-8 were only received food and water. ●: 12 ducklings from group 7 were infected DHAV to mimic nature infection at days 15. ■: Serum and duodenum in group 4 and group 8 were collected at 4, 7, 10, 14, 17, 20, 22 and 24 days. Inline graphic: From day 15, the living ducklings were recorded.

The immunized ducklings were divided into four groups, named group 1 (30 ducklings), group 2 (30 ducklings), group 3 (30 ducklings), group 4 (40 ducklings). The unimmunized ducklings were divided into four other groups, named group 5 (30 ducklings), group 6 (30 ducklings), group 7 (42 ducklings), group 8 (40 ducklings). Each duckling in immunized groups was orally immunized with 1 mL (5 × 108 CFU/mL) lyophilized bacterial powder dissolved in normal saline at 2, 4, 10 and 14 days. Each duckling in control groups only received sterile food and water. Five ducklings were randomly selected at 4, 7, 10, 14, 17, 20, 22 and 24 days from group 4 (experimental ducklings) and group 8 (control ducklings) to collected serum and duodenum. On the 15th day, 12 ducklings were randomly selected from group 7 to inject with 1 mL (2 × 105 copies/mL) DHAV per duck, then each of responding groups were thrown back 2 infected ducklings to mimic nature infection. Group 1 and group 5 were respectively thrown back 2 ducklings infected with DHAV-1, namely DHAV-1 experimental group and DHAV-1 control group. Group 2 and group 6 were respectively thrown back 2 ducklings infected with DHAV-3, namely DHAV-3 experimental group and DHAV-3 control group. Group 3 and group 7 were respectively thrown back 2 ducklings infected with DHAV-1 and DHAV-3 co-infection, namely DHAV-1 + 3 experimental group and DHAV-1 + 3 control group. From day 15, the surviving ducklings were recorded. The relative percent survival (RPS) was calculated at the end of the trial. RPS = (1-experiment group mortality/control mortality) × 100 %.

Immune response and protection effect in ducklings after oral immunization

An enzyme-linked immunosorbent assay (ELISA) method described previously was used to determine the levels of specific blood-serum IgG (Song et al., 2019). The 96-well plate was coated with purified VP1 protein of DHAV-1 or VP1 protein of DHAV-3 (2.0 μg/mL) respectively and added 100 μL/well and incubated at 4 °C overnight. HRP-conjugated goat anti-duck IgG (KPL, 1:5000 dilution) was used to detect duck blood serum. OD450 nm values were detected by ELISA microplate reader. The intestine fluid of ducklings was examined by sIgA commercial ELISA kit, the cytokines IL-4, IL-10 and IFN-γ in blood-serum samples were detected using commercial ELISA kits according to the manufacturer's instructions. The IL-4, IL-10, IFN-γ, sIgA and IgG were detected at 1, 4, 7, 10, 14, 17, 20, 22, and 24 days.

The animal experiments were carried out in accordance with the guidelines issued by Shandong Agricultural University Animal Care and Use Committee (Approval Number: # SDAUA-2022-199).

Results

Construction of recombinant plasmid Usp45-VP1-eGFP-pMG36e

The full length of the plasmid Usp45-pgsA'−1VP1-3VP1-eGFP-pMG36e was 6485 bp; the restriction site Kpn I was found at 5568 bp and 5732 bp. The suitable restriction site Kpn I in the plasmid was selected for single restriction. After digestion, two bands of about 164 bp and 6321 bp were obtained. The plasmid was confirmed to have no amino acid mutations after sequencing.

Construction of recombinant L. lactis MG1363-VP1

The recombinant plasmid was introduced into L. lactis MG1363 competent cell by the electrotransfer method with conditions as 25 μf pulse, 2000 V voltage, 200 Ω resistance, using a 0.2 cm cuvette. The positive recombinant L. lactis was screened in GM17 medium containing erythromycin. Strain of L. lactis MG1363 harboring intact and recombinant plasmid is named L. lactis MG1363/1 + 3VP1. The fluorescence microscope showed that the recombinant L. lactis was positive (Fig. 3).

Fig. 3.

Fig 3

Open in a new tab

The results of fluorescence microscopy. (A) Bright field of MG1363/1 + 3VP1; (B) Fluorescent field of MG1363/1 + 3VP1; (C) Bright field of MG1363/pMG36e; (D) Fluorescent field of MG1363/pMG36e. (magnification, × 40; scale bar, 20 μm).

Western blotting detected the fusion protein expression in L. lactis MG1363/1 + 3VP1, L. lactis MG1363-pMG36e as the negative control. The target 72KD protein can be detected and existed on cytoderm (Fig. 4).

Fig. 4.

Fig 4

Open in a new tab

The results of Western blot. M: maker; +: L. lactis MG1363/1 + 3VP1; −: lactis MG1363/pMG36e. (A) The monoclonal antibody 4F8 was used as the primary antibody; (B) The monoclonal antibody eGFP-Tag were used as the primary antibody.

Index detection in fermentation process

A total of 1.1 Kg lyophilized powder was obtained from 500 L fermenter, the viable count was 5.5 × 1011 CFU/g. The maximum OD600 nm value is 1.619 at 18 h, and the maximum viable count is Lg9.72 CFU/mL at 16 h (Fig. 5).

Fig. 5.

Fig 5

Open in a new tab

Index detection in fermentation process. (A) Changes of fermentation on viable count; (B) Changes of fermentation on OD600 nm.

Immune response and protection effect in ducklings after oral immunization

Anti-DHAV-1-VP1 antibody, anti-DHAV-3-VP1 antibody, total sIgA, IL-4, IL-10, and IFN-γ were detected at 1, 4, 7, 10, 14, 17, 20, 22, and 24 days. A two-way anova analysis of multiple comparisons in GraphPad prism 9.1 were used to analyze data. There was a difference (P < 0.05) between experiment group and control group (Fig. 6). Overall, the concentrations of IgG, sIgA, IL-4, IL-10, and IFN-γ in ducklings of MG1363/1 + 3VP1 were higher than control group.

Fig. 6.

Fig 6

Open in a new tab

Detection of immune responses in serum or intestine samples of ducklings. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

The infection period in this study mimicked the natural infection from day 15, the survival and death of the 6 groups of ducklings were monitored. On the third day after infection, acute deaths occurred among the ducklings in the blank control group, meanwhile the experiment ducklings that were orally immunized with L. lactis MG1363/1 + 3VP1 didn't die during the four days after infection. The immunized ducklings infected with DHAV-1 died on day 20 and day 21, the control ducklings infected with DHAV-1 died acutely within day 17-21. The experiment ducklings infected with DHAV-3 died slowly on day 20, 21 and 22. A total of 13 control ducklings infected with DHAV-3 died within 18-21 days. Eight experiment ducklings infected with DHAV-1 and DHAV-3 died slowly within 20-23 days, meanwhile, 19 control ducklings died rapidly within 17-20 days and slowly within 21-24 days (Fig. 7).

Fig. 7.

Fig 7

Open in a new tab

Surviving numbers of the ducklings after natural DHAV infection.

By calculating the death of ducklings naturally infected with DHAV-1, DHAV-3 and DHAV-1+DHAV-3 respectively, the mortalities of experiment groups and control groups were shown in Table 2. The RPS of DHAV-1, DHAV-3 and DHAV-1+DHAV-3 was 64.71 %, 61.54 % and 57.89 % respectively (Table 2).

Table 2.

Immune effect of virus attack protection test.

Groups Mortality (%) RPS1 (%)
Group 1 (DHAV-1 experiment) 20 64.71
Group 5 (DHAV-1 control) 56.67
Group 2 (DHAV-3 experiment) 16.67 61.54
Group 6 (DHAV-3 control) 43.33
Group 3 (DHAV-1 + 3 experiment) 26.67 57.89
Group 7 (DHAV-1 + 3 control) 63.33
Open in a new tab
1

Relative percent survival (RPS)= (1-experiment group mortality/control mortality) × 100 %.

Discussion

DHAV-1 and DHAV-3 cause high mortality in ducklings, and dual infections of the two viruses were common in recent years in eastern Asia (Chen et al., 2013; Lin et al., 2016; Soliman et al., 2015). Although both the inactivated vaccines and live attenuated vaccines have been used to protect ducklings, DHAV-1 and DHAV-3 still cause significant serious damage to the ducklings. So, there is a continuing need to develop safer, cost-effective vaccine. As a food-grade bacterium, L. lactis is a potential candidate to produce biologically useful proteins and delivery plasmid DNA (Pontes et al., 2011). Being the most external and dominant surface protein, VP1 of DHAV is an attractive candidate antigen for oral vaccines (Song et al., 2019; Zhang et al., 2021). In this study, the DHAV-1 and DHAV-3 VP1 were co-expressed in recombinant L. lactis (Figs. 3 and 4).

Since most pathogens invade the body through mucosal surfaces, such as the gastrointestinal, respiratory, and reproductive tracts, it is necessary to develop immunity at mucosal surfaces to act as a first line of defense (Gonzalez-Cruz and Gill, 2021). Use of the mucosal routes for delivery therapeutic molecules have several important advantages over systemic delivery such as reduction of secondary effects, easy administration, elicit antigen-specific sIgA responses at mucosal surfaces and effective systemic immune responses (Lavelle and O'Hagan, 2006). DHAV infects ducks mainly through gastrointestinal tract. In earlier study, we constructed a recombinant L. lactis that could express a recombinant protein of DHAV-3/VP1 relying on the nisin-controlled inducible expression system (Song et al., 2019). In the subsequent research, the DHAV-1/VP1 could be successfully continuously expressed as soluble protein and insoluble protein in the recombinant L. lactis without induction (Zhang et al., 2021). In this study, to maximize the immunogenicity of the recombinant L. lactis in the intestine, we have developed a novel L. lactis cell surface display system by employing Usp45 as a signal peptide and pgsA' as an anchoring motif, the recombinant protein can be attached to the membrane layer (Figs. 1 and 3). Earlier study has determined the survivability of LAB in stomach-level acidity of probiotic delivery vehicles for lyophilized powder production (Fleming et al., 2017). In this study, the recombinant L. lactis was prepared into lyophilized powder for oral immunization. After the second immunization, the anti-DHAV specific IgG and sIgA statistically differences were observed from the 7th day. After natural infection with DHAV-1, DHAV-3, and DHAV-1+DHAV-3 respectively, the immunized ducklings died slowly and had a low mortality rate (Fig. 7). Based on the mortalities of experiment groups and control groups, the RPS of DHAV-1, DHAV-3 and DHAV-1+DHAV-3 was 64.71 %, 61.54 % and 57.89 % respectively (Table 2). These results indicate that the recombinant LAB constructed in this study has good immunogenicity in ducklings.

Cytokines are indispensable regulatory factors of immune cell secretion that can regulate the immune response, repair damaged tissues and resist infection (Chen et al., 2018). IFN-γ has a vital role to play in directing immune responses and regulating immune network, especially the aspect of antivirus effect (Liu et al., 2012). IFN-γ is produced predominantly by natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops and associated with Th1 cell subsets mediate cellular immunity (Matsushita et al., 2015). IL-4 could effectively promote the proliferative differentiation of B cells into plasma cells secreting antibodies and enhance both the secretion and cell-surface expression of IgE and IgG. The critical role of IL-10 in the maintenance of intestinal homeostasis and balance between intestinal flora and the digestive system has been shown (Steidler et al., 2000; Shouval et al., 2014). IL-4 and IL-10 are associated with Th2 cell subsets and mediate humoral immunity (Mosmann et al., 1986). In this study, the results of animal immunoassay showed that IL-4, IL-10, IFN-γ were together induced to make Th1/ Th2 relatively balanced.

Conclusions

In summary, a recombinant L. lactis MG1363/1 + 3VP1 was successfully constructed in this study, and it was proved that the DHAV-1/VP1 and DHAV-3/VP1 fusion protein could be successfully co-expressed in the recombinant L. lactis without induction. After oral immunization, specific antibodies can be detected in ducklings, and the RPS can reach 60 %, 64 %, 53 % after DHAV-1, DHAV-3, and DHAV-1+DHAV-3 virulent infections respectively.

Declaration of competing interest

We confirm that there are no know conflicts and interests associated with this publication and it can't be influenced on its outcome.

Acknowledgements

This study was supported by the Major Scientific and Technological Innovation Project of Tai'an City, Shandong Province, China (2021ZDZX032), Key Research and Development Program of Shandong Province, China (2022CXGC010606) and Shandong Provincial Poultry Industry and Technology System, China (SDAIT-11-03).

References

  1. Ashiuchi M., Nawa C., Kamei T., Song J.J., Hong S.P., Sung M.H., Soda K., Misono H. Physiological and biochemical characteristics of poly gamma-glutamate synthetase complex of Bacillus subtilis. Eur. J. Biochem. 2001;268:5321–5328. doi: 10.1046/j.0014-2956.2001.02475.x. [DOI] [PubMed] [Google Scholar]
  2. Avall-Jääskeläinen S., Palva A. Secretion of biologically active porcine interleukin-2 by lactococcus lactis. Vet. Microbiol. 2006;115:278–283. doi: 10.1016/j.vetmic.2006.02.007. [DOI] [PubMed] [Google Scholar]
  3. Cai R., Jiang Y., Yang W., Yang W., Shi S., Shi C., Hu J., Gu W., Ye L., Zhou F., Gong Q., Han W., Yang G., Wang C. Surface-displayed IL-10 by recombinant Lactobacillus plantarum reduces Th1 responses of RAW264.7 cells stimulated with poly(I:C) or LPS. J. Microbiol. Biotechnol. 2016;26:421–431. doi: 10.4014/jmb.1509.09030. [DOI] [PubMed] [Google Scholar]
  4. Chalmers W.S.K., Woolcock P.R. The effect of animal sera on duck Hepatitis virus. Avian Pathol. 1984;13:727–732. doi: 10.1080/03079458408418569. [DOI] [PubMed] [Google Scholar]
  5. Chen L.L., Xu Q.., Zhang R.H., Yang L., Li J.X., Xie Z.J., Zhu Y.L., Jiang S.J., Si X.K. Improved duplex RT-PCR assay for differential diagnosis of mixed infection of duck hepatitis a virus type 1 and type 3 in ducklings. J. Virol. Methods. 2013;192:12–17. doi: 10.1016/j.jviromet.2013.04.012. [DOI] [PubMed] [Google Scholar]
  6. Chen J., Zhang R., Lin S., Li P., Lan J., Xie Z., Wang Y., Jiang S. Construction and characterization of an improved DNA-launched infectious clone of duck hepatitis a virus type 1. Virol. J. 2017;14:212. doi: 10.1186/s12985-017-0883-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen S.W., Liu C..H., Hu S.Y. Dietary administration of probiotic paenibacillus ehimensis NPUST1 with bacteriocin-like activity improves growth performance and immunity against aeromonas hydrophila and streptococcus iniae in nile tilapia (Oreochromis niloticus) Fish Shellfish Immunol. 2018;84:695–703. doi: 10.1016/j.fsi.2018.10.059. [DOI] [PubMed] [Google Scholar]
  8. Fleming D., Kesey J., Rumbaugh K., Dissanaike S. Comparing the survivability of Lactobacillus species in various probiotic delivery vehicles. JPEN J. Parenter. Enteral Nutr. 2017;41:1411–1413. doi: 10.1177/0148607116672266. [DOI] [PubMed] [Google Scholar]
  9. Gao J., Chen J., Si X., Xie Z., Zhu Y., Zhang X., Wang S., Jiang S. Genetic variation of the VP1 gene of the virulent duck Hepatitis a virus type 1 (DHAV-1) isolates in Shandong province of China. Virol. Sin. 2012;27:248–253. doi: 10.1007/s12250-012-3255-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. García-Fruitós E. Lactic Acid bacteria: a promising alternative for recombinant protein production. Microb. Cell Fact. 2012;11:157. doi: 10.1186/1475-2859-11-157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gonzalez-Cruz P., Gill H.S. Demystifying particle-based oral vaccines. Expert Opin. Drug Deliv. 2021;18:1455–1472. doi: 10.1080/17425247.2021.1946511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kang M., Roh J.H., Jang H.K. Protective efficacy of a bivalent live attenuated vaccine against duck hepatitis a virus types 1 and 3 in ducklings. Vet. Microbiol. 2018;214:108–112. doi: 10.1016/j.vetmic.2017.12.018. [DOI] [PubMed] [Google Scholar]
  13. Kim M.C., Kwon Y..K., Joh S.J., Lindberg A.M., Kwon J.H., Kim J.H., Kim S.J. Molecular analysis of duck hepatitis virus type 1 reveals a novel lineage close to the genus parechovirus in the family picornaviridae. J. Gen. Virol. 2006;87:3307–3316. doi: 10.1099/vir.0.81804-0. [DOI] [PubMed] [Google Scholar]
  14. Kim M.C., Kwon Y..K., Joh S.J., Kim S.J., Tolf C., Kim J.H., Sung H.W., Lindberg A., Kwon J.H. Recent Korean isolates of duck hepatitis virus reveal the presence of a new geno-and serotype when compared to duck hepatitis virus type 1 type strains. Arch. Virol. 2007;152:2059–2072. doi: 10.1007/s00705-007-1023-0. [DOI] [PubMed] [Google Scholar]
  15. Lavelle E.C., O'Hagan D.T. Delivery systems and adjuvants for oral vaccines. Expert Opin. Drug Deliv. 2006;3:747–762. doi: 10.1517/17425247.3.6.747. [DOI] [PubMed] [Google Scholar]
  16. Lin S.L., Cong R..C., Zhang R.H., Chen J.H., Xia L.L., Xie Z.J., Wang Y., Zhu Y.L., Jiang S.J. Circulation and in vivo distribution of duck hepatitis a virus types 1 and 3 in infected ducklings. Arch. Virol. 2016;161:405–416. doi: 10.1007/s00705-015-2648-z. [DOI] [PubMed] [Google Scholar]
  17. Liu D.Q., Ge J..W., Qiao X.Y., Jiang Y.P., Liu S.M., Li Y.J. High-level mucosal and systemic immune responses induced by oral administration with Lactobacillus-expressed porcine epidemic diarrhea virus (PEDV) S1 region combined with Lactobacillus-expressed N protein. Appl. Microbiol. Biotechnol. 2012;93:2437–2446. doi: 10.1007/s00253-011-3734-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liu Y.S., Liu Q.., Jiang Y.L., Yang W.T., Huang H.B., Shi C.W., Yang G.L., Wang C.F. Surface-displayed porcine IFN-λ3 in Lactobacillus plantarum inhibits porcine enteric coronavirus infection of porcine intestinal epithelial cells. J. Microbiol. Biotechnol. 2020;30:515–525. doi: 10.4014/jmb.1909.09041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Maldonado Galdeano C., Cazorla S.I., Lemme Dumit J.M., Vélez E., Perdigón G. Beneficial effects of probiotic consumption on the immune system. Ann. Nutr. Metab. 2019;74:115–124. doi: 10.1159/000496426. [DOI] [PubMed] [Google Scholar]
  20. Matsushita H., Hosoi A., Ueha S., Abe J., Fujieda N., Tomura M., Maekawa R., Matsushima K., Ohara O., Kakimi K. Cytotoxic T lymphocytes block tumor growth both by lytic activity and IFNgamma-dependent cell-cycle arrest. Cancer Immunol. Res. 2015;3:26–36. doi: 10.1158/2326-6066.CIR-14-0098. [DOI] [PubMed] [Google Scholar]
  21. Mosmann T.R., Cherwinski H.., Bond M.W., Giedlin M.A., Coffman R.L. Two types of murine helper T cell clone. I. definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 1986;136:2348–2357. [PubMed] [Google Scholar]
  22. Pontes D.S., de Azevedo M..S., Chatel J.M., Langella P., Azevedo V., Miyoshi A. Lactococcus lactis as a live vector: heterologous protein production and DNA delivery systems. Protein Expr. Purif. 2011;79:165–175. doi: 10.1016/j.pep.2011.06.005. [DOI] [PubMed] [Google Scholar]
  23. Shouval D.S., Ouahed J.., Biswas A., Goettel J.A., Horwitz B.H., Klein C., Muise A.M., Snapper S.B. Interleukin 10 receptor signaling: master regulator of intestinal mucosal homeostasis in mice and humans. Adv. Immunol. 2014;122:177. doi: 10.1016/B978-0-12-800267-4.00005-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Soliman M., Alfajaro M.M., Lee M.H., Jeong Y.J., Kim D.S., Son K.Y., Kwon J., Choi J.S., Lim J.S., Choi J.S., Lee T.U., Cho K.O., Kang M.I. The prevalence of duck hepatitis A virus types 1 and 3 on Korean duck farms. Arch. Virol. 2015;160:493–498. doi: 10.1007/s00705-014-2264-3. [DOI] [PubMed] [Google Scholar]
  25. Song S., Li P., Zhang R., Chen J., Lan J., Lin S., Guo G., Xie Z., Jiang S. Oral vaccine of recombinant Lactococcus lactis expressing the VP1 protein of duck hepatitis A virus type 3 induces mucosal and systemic immune responses. Vaccine. 2019;37:4364–4369. doi: 10.1016/j.vaccine.2019.06.026. [DOI] [PubMed] [Google Scholar]
  26. Steidler L., Hans W., Schotte L., Neirynck S., Obermeier F., Falk W., Fiers W., Remaut E. Treatment of murine colitis by lactococcus lactis secreting interleukin-10. Science. 2000;289:1352–1355. doi: 10.1126/science.289.5483.1352. [DOI] [PubMed] [Google Scholar]
  27. Szatraj K., Szczepankowska A.K., Chmielewska-Jeznach M. Lactic acid bacteria- promising vaccine vectors: possibilities, limitations, doubts. J. Appl. Microbiol. 2017;123:325–339. doi: 10.1111/jam.13446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Tseng C.H., Knowles N..J., Tsai H.J. Molecular analysis of duck hepatitis virus type 1 indicates that it should be assigned to a new genus. Virus Res. 2007;123:190–203. doi: 10.1016/j.virusres.2006.09.007. [DOI] [PubMed] [Google Scholar]
  29. Tseng C.H., Tsai H.J. Molecular characterization of a new serotype of duck hepatitis virus. Virus Res. 2007;126:19–31. doi: 10.1016/j.virusres.2007.01.012. [DOI] [PubMed] [Google Scholar]
  30. Wells J. Mucosal vaccination and therapy with genetically modified lactic acid bacteria. Annu. Rev. Food Sci. Technol. 2011;2:423–445. doi: 10.1146/annurev-food-022510-133640. [DOI] [PubMed] [Google Scholar]
  31. Wu X., Li X., Zhang Q., Wulin S., Bai X., Zhang T., Wang Y., Liu M., Zhang Y. Identification of a conserved B-cell epitope on duck hepatitis a type 1 virus VP1 protein. PLoS One. 2015;10 doi: 10.1371/journal.pone.0118041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Xue W., Zhao Q., Li P., Zhang R., Lan J., Wang J., Yang X., Xie Z., Jiang S. Identification and characterization of a novel nanobody against duck hepatitis a virus type 1. Virology. 2019;528:101–109. doi: 10.1016/j.virol.2018.12.013. [DOI] [PubMed] [Google Scholar]
  33. Yang L., Li J., Bi Y., Xu L., Liu W. Development and application of a reverse transcription loop-mediated isothermal amplification method for rapid detection of duck hepatitis a virus type 1. Virus Genes. 2012;45:585–589. doi: 10.1007/s11262-012-0798-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zhang R., Zhou G., Xin Y., Chen J., Lin S., Tian Y., Xie Z., Jiang S. Identification of a conserved neutralizing linear B-cell epitope in the VP1 proteins of duck hepatitis a virus type 1 and 3. Vet. Microbiol. 2015;180:196–204. doi: 10.1016/j.vetmic.2015.09.008. [DOI] [PubMed] [Google Scholar]
  35. Zhang X., Zhang R., Wang J., Sui N., Xu G., Yan H., Zhu Y., Xie Z., Jiang S. Construction of recombinant lactococcus lactis strain expressing VP1 fusion protein of duck hepatitis a virus type 1 and evaluation of its immune effect. Vaccines. 2021;9:1479. doi: 10.3390/vaccines9121479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zou Z., Ma J., Huang K., Chen H., Liu Z., Jin M. Live attenuated vaccine based on duck enteritis virus against duck hepatitis a virus types 1 and 3. Front. Microbiol. 2016;7:1613. doi: 10.3389/fmicb.2016.01613. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES