Skip to main content
NCBI home page
Journal of Cancer Research and Clinical Oncology logoLink to Journal of Cancer Research and Clinical Oncology
. 2015 Nov 21;142(4):723–732. doi: 10.1007/s00432-015-2070-7

Lentivirus-mediated knockdown of CTDP1 inhibits lung cancer cell growth in vitro

Runbo Zhong 1,#, Xiaoxiao Ge 1,#, Tianqing Chu 1, Jiajun Teng 1, Bo Yan 1, Jun Pei 1, Liyan Jiang 1, Hua Zhong 1,✉, Baohui Han 1,✉
PMCID: PMC11819366  PMID: 26590573

Abstract

Background

CTDP1 catalyzes serine phosphorylation and dephosphorylation of the mobile carboxy-terminal domain of the RNA polymerase II. It is conserved among eukarya and is essential for cell growth for its ability in regulation of transcription machinery. However, its function in the process of tumorigenesis is unclear. In the present study, we aim to explore the roles of CTDP1 in the progression of human lung cancer. To our knowledge, this is the first study that reports the functions of CTDP1 in human lung cancer.

Methods

We first detected the expression level of CTDP1 in four human lung cancer cell lines: H-125, H1299, LTEP-A-2 and NCI-H446 by semiquantitative RT-PCR. We compared the expression level of CTDP1 in lung cancer tissues and paired adjacent normal tissues on 29 pathologically confirmed patients by real-time quantitative PCR. To further explore the effect of CTDP1 on cell proliferation, a lentiviral vector expressing CTDP1 short hairpin RNA (shRNA) was constructed and infected into human lung cell lines H1299. Interference efficiency was determined by western blot analysis and real-time quantitative PCR. The effects of knockdown of CTDP1 on cell growth, cell cycle and apoptosis and cell colony formation were explored by Cellomics, fluorescence-activated cells sorting and fluorescence microscopy, respectively.

Results

CTDP1 was expressed in all four human lung cancer cell lines. The expression of CTDP1 in tumor tissues was significantly higher than paired adjacent normal tissues in 29 patients with lung cancer. The expression of CTDP1 was markedly reduced in cells infected with lentivirus delivering shRNA against CTDP1. Inhibition of CTDP1 expression significantly suppressed cell growth, induced G0/G1 phase arrest and repressed cell colony formation.

Conclusions

Our results demonstrated that CTDP1 was upregulated in human lung cancer tissues. In addition, it implied that CTDP1 played an important role in cell proliferation and may be a useful therapeutic target in human lung cancer.

Electronic supplementary material

The online version of this article (doi:10.1007/s00432-015-2070-7) contains supplementary material, which is available to authorized users.

Keywords: CTDP1, Lung cancer, Lentivirus, Cell growth

Introduction

Carcinogenesis is a complex, multistep process that involves massive genetic changes that alter cellular processes, such as proliferation, differentiation, invasion and metastasis (Hahn et al. 1999; Wright et al. 1992). Lung cancer is the leading cause of cancer deaths in patients of most industrialized countries, resulting from cigarette smoking, workplace agents and other environmental factors (Alberg et al. 2005). Traditionally, therapies and prognoses of lung cancer have been determined based on histological considerations, which cause bottleneck in clinical practice already. To dissect epigenetic and genetic mechanism underlying the process of lung cancer, many studies have been carried out. Among which, a lot of genes have been identified to dysregulate in lung cancer and draw much attention for their capabilities of being potential biomarkers for diagnoses, prognoses or treatment for lung cancer. p53 alteration was observed in more than half of all human malignancies including lung cancer (Tammemagi et al. 1999; Moldvay et al. 2000; Scagliotti and Novello 2003; Haga et al. 2003). Furthermore, p53 mutations in lung cancers correlated with cigarette smoking, which suggested the causative role for tobacco carcinogens (Greenblatt et al. 1994). However, the impact of p53 expression on lung cancer prognosis is still controversial (D’Amico et al. 1999; Pastorino et al. 1997). Epidermal growth factor receptor (EGFR) was reported to frequently overexpress in the development and progression of non-small cell lung cancer (Sun et al. 2007; Sato et al. 2007; Tang et al. 2005; Weihua et al. 2008). Meanwhile, EGFR mutations were associated with an improved prognosis in non-small cell lung cancer (NSCLC) (Kim et al. 2008; Hirsch et al. 2008). Vascular endothelial cell growth factor (VEGF) is a potent growth factor for endothelial cells, and increased VEGF expression has consistently been shown to adversely affect NSCLC outcome (O’Byrne et al. 2000; Liao et al. 2001; Han et al. 2001; Mineo et al. 2004). However, few studies focused on dysregulation of the transcription mechanism itself on cancers. Med19, a component of Mediator complex, has been reported to promote cell growth in breast cancer and gastric cancer in vitro (Li et al. 2011; Ding et al. 2012). Besides Mediator complex, a number of proteins are involved in dysregulation of the transcription machinery, such as RNA polymerase II and transcription factors.

The RNA polymerase II (Pol-II) consisted of a fold region and the mobile carboxy-terminal domain (CTD) (Cramer et al. 2001). The CTD functions as an assembly platform for massive genes that regulate the initiation, elongation and termination steps of Pol-II transcription, modify chromatin structure, and catalyze or regulate RNA capping, splicing and polyadenylation (Phatnani and Greenleaf 2006). The CTD undergoes waves of serine phosphorylation and dephosphorylation during the transcription cycle. This process was catalyzed by CTD phosphatase subunit 1 (CTDP1), also known as FCP1 (Cho et al. 1999; Kobor et al. 1999; Lin et al. 2002). The CTDP1 sequence comprises two conserved regions. The N-terminal Fcp1 homology (FCPH) region includes the DXDX(T/V) signature motif with residues important for catalysis. The C-terminal BRCT (breast cancer protein-related carboxy-terminal) domain binds to the phosphorylated CTD (Yu et al. 2003). CTDP1 is conserved among eukarya and is essential for cell viability. It can facilitate recycling of the hyperphosphorylated form of the polymerase for a new round of transcription (Cho et al. 2001). Its phosphatase activity is stimulated by the general transcription factor TFIIF, and the general factor TFIIB inhibits this stimulation (Chambers et al. 1995). In addition to its phosphatase activity, CTDP1 is involved in transcription regulation as a component of the elongation complex, as a positive transcription regulator (Mandal et al. 2002; Licciardo et al. 2001). Recently, it was suggested to have role in regulating mitotic progression by perhaps counteracting Cdk-1-mediated phosphorylation (Son and Osmani 2009).

It is well known that tumorigenesis originates from uncontrol cell proliferation. Given CTD is essential for cell growth and viability, it may be have roles in tumor genesis. However, no studies were carried out to investigate the roles of CTDP1 in the progression of cancer. This study was tried to figure out whether CTDP1 has effects on the progression of human lung cancer. Results were shown that inhibition of CTDP1 expression significantly suppressed cell growth, induced G0/G1 phase arrest, augmented cell apoptosis and repressed cell colony formation.

Materials and methods

Patients and tissue sample

Lung cancer tissues and their pair-matched adjacent normal tissues from twenty-nine patients utilized in this study were obtained at Shanghai Chest Hospital (Shanghai, China). No local or systemic treatment was conducted in these patients before the operation. All specimens were immediately frozen in liquid nitrogen after resection and stored at −80 °C until RNA extraction. The study was approved by the Research Ethics Committee of Shanghai Chest Hospital, China. And this work conforms to the provisions of the Declaration of Helsinki. Written informed consents were obtained from all patients before inclusion in this study.

Cell lines and cell culture conditions

Human lung cancer H-125, H1299, LTEP-A-2 and NCI-H446 cell lines and human renal epithelial 293T cell line were purchased from American Type Culture Collection (ATCC) and maintained at 37 °C, 5 % CO2. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, GIBCO) supplemented with 10 % FBS.

RNA isolation, reverse transcription PCR (RT-PCR) and real-time PCR

RT-PCR assay was carried out to examine the endogenous expression levels of CTDP1 in human lung cancer cell lines: H-125, H1299, LTEP-A-2 and NCI-H446. After resuscitation, cells were amplified by passage culture when they reached about 90 % confluence. Total RNA was extracted with Trizol agents following the manufacturer’s instructions (Invitrogen Life Technologies), and then RNA was quantitatively detected by UV spectrophotometry. cDNA was obtained using 2 μl total RNA as template, oligo dT as primers and M-MLV reverse transcriptase (Promega). PCR was performed in a 20-μl reaction volume containing 1 μl of cDNA template, 0.5 μl of each of the 5′ and 3′ primers (Table S1) (synthesized by Shanghai GeneChem Co., Ltd), and 10 μl of 2 × premix ex Taq. PCR conditions were set as 95.0 °C 15 s, 1 cycle; 95.0 °C 5 s, 60.0 °C 30 s, 45 cycle. The relative expression of Med19 mRNA was calculated with the 2−∆∆CT method, using GAPDH mRNA expression level for normalization.

Construction of shRNA lentiviral vector and cell infection

Short hairpin RNA (shRNA) targeting CTDP1 sequence (GACCAGACGTTGATTCACACA) and scrambled non-silencing RNA (TTCTCCGAACGTGTCACGT) was designed and synthesized (Shanghai GeneChem Co., Ltd). Then they were cloned into pGCSIL-GFP lentiviral vector with AgeI/EcoRI sites to form recombinant lentiviral shRNA expression vector. ShRNA-containing lentiviruses were packaged and amplified by co-transferring pGCSIL-GFP vector, together with two plasmids pHelper 1.0 and pHelper 2.0 into 293T cells with the help of Lipofectamine 2000. Lentiviral particles were purified using ultracentrifugation. The viral titer was determined by endpoint dilution assay. H1299 cell suspensions were formed by trypsinization. Suspensions were cultured in six-well plates at 50,000 cells per well and incubated at 37 °C, 5 % CO2 for 24 h. Then, suspensions were infected with shRNA-containing lentiviruses; 24 h later, culture medium was substituted. Cells were continued to culture if GFP fluorescence expression was observed under the microscope in more than 50 % cells on the third days after infection. Otherwise, cells were reinfected.

Western blot analysis

Total protein was isolated using ice-cold protein lysis buffer [1 % Triton X-100, 50 mM Tris–HCl, pH 7.4; 150 mM NaCl; 0.1 % SDS; 1 mM phenylmethanesulfonyl fluoride (PMSF); 1 mM EDTA]. This was followed by 15 min of incubation on ice and centrifugation at 12,000g for 10 min at 4 °C. The concentration of total protein was finally adjusted as 2 μg/μl by the bicinchoninic acid assay (BCA Protein Assay Kit, HyClone-Pierce). Then protein extracts were separated on a SDS-polyacrylamidegel, blotted onto a nitrocellulose membrane and incubated with CTDP1 (protein tech 60004, 1:10000) and GAPDH (GTX104649, 1:2000) primary antibodies. Membranes were then washed and incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Signals were detected with enhanced chemiluminescence, using GAPDH as the internal standard.

Cell growth assay

Four days after H1299 cells infected, cells in logarithmic phase were digested by trypsin and resuspended. Then cells were counted and inoculated in 96-well plates at about 2000 cells per well and incubated at 37 °C, 5 % CO2. From the second day, cells with green fluorescence were taken photographs and counted by Cellomics ArrayScan VTIHCS Reader once a day. Cell growth was observed continuously for 5 days, and cell growth curves were drawn.

Detection of cell cycle by fluorescence-activated cells sorting (FACS)

Infected H1299 cells were washed by D-Hanks, digested by trypsin and centrifuged at 1200 rmp for 5 min when reached about 80 % confluence after infection. Then cells were washed twice with cold PBS, fixed with cold 70 % ethanol for 1 h, centrifuged at 1500 rpm for 5 min to discard ethanol and then resuspended with PBS. Finally, cells were stained by propidium iodide (PI) was added and a total of 10,000 fixed cells were analyzed by BD FACSCalibur flow cytometer (BD Biosciences, USA) with the throughput of cells about 200–350 cell/s.

Apoptosis detection by FACS

H1299 cells cultured in supernatant were collected in 5-ml centrifuge tube on the fifth day after infection. Cells were washed by D-Hanks, digested by trypsin and centrifuged at 1500 rmp for 5 min. Cells were washed by PBS and centrifuged. Next, cells were washed by binding buffer and centrifuged. Then cells were resuspended at 1,000,000 cell/ml; 100 μl (1 × 105–1 × 106 cells) of cell suspension was transferred into flow tube of flow cytometry after adding 5 μl annexin V-APC.

Colony formation assay

Four days after H1299 cells infected, cells in logarithmic phase were digested by trypsin, resuspended, counted and seeded in 6-well plates at 800 cells per well. Cells were incubated for 14 days to form colonies. Then cells were washed by PBS, fixed by paraformaldehyde for 1 h, stained with giemsa for 20 min, washed three times by ddH2O and then photographed with a digital camera. The number of colonies (>50 cells/colony) was counted under fluorescence microscopy (MicroPublisher 3.3RTV; Olympus, Tokyo, Japan). All assays were performed in triplicate.

Statistical analysis

Real-time PCR was analyzed by 2−∆∆CT method. The significance of difference between two groups was determined using the Student’s t test with R software (http://cran.r-project.org/). P < 0.05 was considered statistical significance.

Results

Measurement of CTDP1 expression in human lung cancer cell lines

We measured the expression level of CTDP1 in human lung cancer cell lines H-125, H1299, LTEP-A-2, NCI-H446 by semiquantitative RT-PCR. It was shown that CTDP1 was expressed in all four human lung cancer cell lines (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Expression of CTDP1 in four human lung cancer cell lines. The expression of CTDP1 in four human lung cancer cell lines was detected by semiquantitative RT-PCR. GAPDH gene was used as an internal control

CTDP1 is overexpressed in lung cancerous tissues

The expression level of CTDP1 in 29 samples from patients with lung cancer was examined by qRT-PCR. It was shown that CTDP1 was upregulated in 82.8 % (24/29) cancer tissues compared with adjacent normal tissues. In addition, the average expression level of CTDP1 in cancer tissues was 2.484, which was significantly higher than that of adjacent normal tissues (1.231, P = 1.53E-08, Fig. 2). The correlation between CTDP1 expression and some clinicopathologic characteristics was further examined. It revealed that the expression level of CTDP1 was associated with patients’ age (Table 1).

Fig. 2.

Fig. 2

Open in a new tab

Average expression of CTDP1 in human lung cancer tissues and adjacent normal tissues. The expression level of CTDP1 in 29 tumors and adjacent normal tissues was examined by qRT-PCR. It was shown that the average CTDP1 expression in tumors was significantly higher than that of adjacent normal tissues

Table 1.

Correlation between CTDP1 expression and clinicopathologic characteristics

Characteristics Number of case CTDP1 expression P value
High (n = 16) % Low (n = 13) %
Age (years) 29 65 ± 10.8 56.2 ± 10.7 0.04*
Gender 0.353
 Male 9 4 25 5 38.5
 Female 20 12 75 8 61.5
Tumor size 0.336
 < 3.5 cm 20 10 62.5 10 76.9
 ≥ 3.5 cm 9 6 37.5 3 23.1
T stage 0.704
 T1 and T2 27 15 93.8 12 92.3
 T3 and T4 2 1 6.2 1 7.7
N stage 0.374
 N1 and N2 22 13 81.2 9 69.2
 N3 and N4 7 3 18.8 4 30.8
M stage 0.448
 M0 28 16 100 12 92.3
 M1 1 0 0 1 7.7
Open in a new tab

Data are expressed as mean ± standard deviation

* P < 0.05

Knockdown of CTDP1 by shRNA lentivirus system in human lung cancer cells

CTDP1-siRNA vector and scr-siRNA vector expressing GFP were generated and infected into human lung cancer cell line H1299. The lentivirus infection efficiency was monitored by the detection of GFP-expressing cells. Over 90 % of the cells can be infected after 3 days of transfection (Fig. 3a). This demonstrated the high infection efficiency of lentivirus vector. The mRNA levels of CTDP1 in H1299 cells were detected by real-time PCR. As shown in Fig. 3b, CTDP1 mRNA level of H1299 cells infected with CTDP1-siRNA vector was significantly lower than that infected with scr-siRNA vector (P = 5.95E-04), with a dramatically reduction of ~98 % (Table 2). The protein level of CTDP1 was also greatly reduced in group infected with CTDP1-siRNA vector compared with group infected with scr-siRNA vector, indicating effective knockdown of the target sequence (Fig. 3c).

Fig. 3.

Fig. 3

Open in a new tab

Lentivirus vectors were constructed and were used to infect human lung cancer cell line H1299. a Fluorescence photomicrographs were shown. Pictures were taken 72 h after infection at a magnification of ×100. Then, silencing efficiency was investigated by b qRT-PCR assay and c western blot. Scr-siRNA: cells infected with lentivirus containing scrambled shRNA, negative control. CTDP1-siRNA: cells infected with lentivirus specific interfering of CTDP1

Table 2.

CT values of GAPDH and CTDP1 detected by real-time quantitative PCR in Scr-siRNA group and CTDP1-siRNA group

Group GAPDH average CT value CTDP1 average CT value 2−∆∆CT P value
Scr-siRNA 14.747 ± 0.025 28.463 ± 0.090 1.001 ± 0.045 5.95E-04***
CTDP1-siRNA 14.763 ± 0.078 34.663 ± 0.549 0.014 ± 0.005
Open in a new tab

Data are expressed as mean ± standard deviation

Scr-siRNA, cells infected with lentivirus containing scrambled shRNA, negative control; CTDP1-siRNA, cells infected with lentivirus specific interfering of CTDP1

*** P < 0.001

Inhibition of CTDP1 suppresses cell growth

To explore the effect of lentivirus-mediated downregulation of CTDP1 on the growth of human lung cancer cells, GFP-expressing H1299 cells were counted in five consecutive days by Cellomics scan after infection. The growth of H1299 cells treated with CTDP1 siRNA lentivirus was markedly inhibited compare to negative control group as observed reduced green fluorescence of GFP-expressing H1299 cells (Fig. 4a). The counts of H1299 cells increased to a much lesser extent at each time point during the whole assay period (5 days) in cells infected with CTDP1-siRNA vector compared to the negative control group (Table 3; Fig. 4b). The difference can be observed beginning on day 2. And it became more pronounced with time-dependent manner, which indicated inhibitory effect of CTDP1-siRNA vector on cell proliferation. At the fifth day, the count of H1299 cells infected with CTDP1-siRNA vector was about ten times fewer than negative control group (Table 3; Fig. 4c). These findings suggested that knockdown of CTDP1 greatly diminished cell growth.

Fig. 4.

Fig. 4

Open in a new tab

Growth of H1299 cells was inhibited by infection of CTDP1 targeting lentivirus. a Fluorescence photomicrographs of H1299 cell in consecutive 5 days after infection at a magnification of ×100. b Cell counts obtained from Cellomics scan in consecutive 5 days. c Cell counts fold change in consecutive 5 days, which equal to cell counts divide cell counts in the first day after infection. Scr-siRNA: cells infected with lentivirus containing scrambled shRNA, negative control. CTDP1-siRNA: cells infected with lentivirus specific interfering of CTDP1

Table 3.

Cell numbers and cell growth rate in five consecutive days counted by Cellomics scan after infection with CTDP1-siRNA and scr-siRNA vectors

Time Cell numbers Cell growth rate
scr-siRNA CTDP1-siRNA scr-siRNA CTDP1-siRNA
Day 1 772.67 ± 31.37 636.67 ± 113.39 1.00 ± 0.00 1.00 ± 0.01
Day 2 1688.67 ± 260.15 879.67 ± 147.26 2.19 ± 0.40 1.38 ± 0.40
Day 3 3883.33 ± 493.66 964.33 ± 178.59 5.03 ± 0.70 1.51 ± 0.70
Day 4 6862.33 ± 428.60 973 ± 179.55 8.90 ± 0.85 1.53 ± 0.85
Day 5 10,501.33 ± 111.40 940.33 ± 213.18 13.61 ± 0.71 1.47 ± 0.71
Open in a new tab

Cell growth rate equal to cell counts divide cell counts in the first day after infection. Data are expressed as mean ± standard deviation

Scr-siRNA, cells infected with lentivirus containing scrambled shRNA, negative control; CTDP1-siRNA, cells infected with lentivirus specific interfering of CTDP1

Inhibition of CTDP1 induces G0/G1 phase arrest

We further examined the effect of knockdown of CTDP1 on the cell cycle of lung cancer cells by FACS. Figure 5a shows the cell cycle profile of H1299 cells that transfect with CTDP1-siRNA lentiviral vector for 72 h, and Fig. 5b shows the cell cycle profile of negative control group. The percentages of H1299 cells in G0/G1 phase in negative control and CTDP1-siRNA groups were significantly different (P = 1.78E-05) with percentages of (58.02 ± 0.76) and (80.23 ± 0.42), respectively (Fig. 5c). Meanwhile, the percentage of H1299 cells in S phase in shRNA group (8.48 ± 0.71) % was significantly lower (P = 0.0002) than in negative control group (30.08 ± 1.37) % (Fig. 5c). These data indicated that cells were arrest in G0/G1 phase after CTDP1 gene silence. Therefore, we proposed that knockdown of CTDP1 may exerted an inhibitory effect on cell proliferation via G0/G1 cell cycle arrest.

Fig. 5.

Fig. 5

Open in a new tab

Knockdown of CTDP1 augments the proportion of G0/G1 phase in H1299 cells. a FACS histograms and cell cycle analysis of H1299 cells infected with scr-siRNA vector. b FACS histograms and cell cycle analysis of H1299 cells infected with CTDP1-siRNA vector. c Percentage of cells in cell cycle phase G0/G1, S and G2/M. Scr-siRNA: cells infected with lentivirus containing scrambled shRNA, negative control. CTDP1-siRNA: cells infected with lentivirus specific interfering of CTDP1

Inhibition of CTDP1 represses cell colony formation

We examined the colony formation capacity of H1299 cell lines with and without knockdown of CTDP1 mediated by lentivirus. After 72 h of lentivirus infection, cells were allowed to grow for 10 days to form colonies (Fig. 6a). The number of colonies in CTDP1-shRNA cells was 9 ± 2, which was significantly lower than negative group with 57 ± 3 colonies (P = 0.000173) (Fig. 6b). Our results revealed that inhibition of CTDP1 by lenti-shRNA could significantly suppress the colony formation capacity of lung cancer cells.

Fig. 6.

Fig. 6

Open in a new tab

Knockdown of CTDP1 represses cell colony formation. Photomicrographs of Giemsa-stained colonies of H1299 cells infected with lentivirus containing a scr-shRNA and CTDP1-shRNA for 10 days. b Colony number in negative control group and CTDP1-siRNA group. Scr-siRNA: cells infected with lentivirus containing scrambled shRNA, negative control. CTDP1-siRNA: cells infected with lentivirus specific interfering of CTDP1

Discussion

CTDP1 was identified as the RNA polymerase II carboxy-terminal domain phosphatase, and its functions in transcription regulation were largely studied (Cho et al. 1999; Kobor et al. 1999; Lin et al. 2002; Yu et al. 2003; Chambers et al. 1995). To our knowledge, however, there is no report to explore the role of CTDP1 in the progression of human lung cancer to date. In this study, the expression level of CTDP1 in tumor tissues and adjacent normal tissues was firstly evaluated. It was demonstrated that the expression of CTDP1 was significantly higher in human lung cancer tissues compare with adjacent normal tissues (Fig. 2), indicating potential association between CTDP1 and human lung cancer.

RNA interference (RNAi) is a phenomenon where gene expression is specifically regulated by small double-stranded RNAs. Applying this gene knockdown technique, it is possible to knockdown the expression of any genes. We constructed a lentiviral vector expressing shRNA against CTDP1 and a negative control which expressing scrambled shRNA not against any genes and infected into human lung cell lines. Lentivirus was chosen as vector for its high transfection efficiency and lifelong expression of shRNA (Qin et al. 2003; Brake et al. 2006; Manjunath et al. 2009). It was shown that the expression of CTDP1 was significantly reduced in cells infected with CTDP1-shRNA than negative control group measured by qRT-PCR assay and western blot (Fig. 3), thus ensuring the credibility of the subsequent assays.

In addition, our study demonstrated that cell growth was remarkably reduced in H1299 cells infected with shRNA against CTDP1 compared with negative control group (Fig. 4). Alteration cell growth may cause by alteration of cell cycle or cell apoptosis. We then applied cell cycle analysis by FACs. It was found that inhibition of CTDP1 induced more cells arrest at cycle G1/G0 phase and produced less apoptosis in cells (Fig. 5). In addition to dysregulated cell cycle, cell proliferative alteration may cause by apoptosis. We also detected cell apoptosis using the Annexin apoptosis detection kit 5 days after cell infection. However, there is no obvious change in the percentage of cell apoptosis between negative control and siRNA group. Collectively, our results revealed that inhibition of CTDP1 had an inhibitory effect on human lung cell growth via both cell cycle arrest. Besides, the colony formation ability was reduced when the expression of CTDP1 was knockdown (Fig. 6). These results implied that CTDP1 may be essential for maintaining malignancy of human lung cancer by promoting cell proliferation and survival and inhibition apoptosis. However, the underlying mechanism is still unclear.

Conclusions

In summary, a high level of expression of CTDP1 was found in human lung cancer cell. Inhibition of CTDP1 expression can reduce cell growth of lung cancer H1299 cells via G1/G0 arrest and reduce colony formation ability. Thus, CTDP1 was found to associate with the growth of lung cancer cells and may be a valuable therapeutic target in human lung cancer.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary material 1 (DOCX 13 kb) (13.5KB, docx)

Acknowledgments

This study was supported by National Natural Science Foundation of China (Grant number: 81201770 81472642) , Shanghai committee of science and technology (Grant number: 14430723300, 124119a6300), Shanghai Chest Hospital Key Project (2014YZDC20700).

Compliance with ethical standards

Conflict of interest

We declare that we have no conflict of interest.

Footnotes

Runbo Zhong and Xiaoxiao Ge contribute equally to this study.

Contributor Information

Hua Zhong, Email: eddiedong8@hotmail.com.

Baohui Han, Email: xkyyhan@yeah.net.

References

  1. Alberg AJ, Brock MV, Samet JM (2005) Epidemiology of lung cancer: looking to the future. J Clin Oncol 23:3175–3185 [DOI] [PubMed] [Google Scholar]
  2. Brake OT, Konstantinova P, Ceylan M, Berkhout B (2006) Silencing of HIV-1 with RNA interference: a multiple shRNA approach. Mol Ther 14:883–892 [DOI] [PubMed] [Google Scholar]
  3. Chambers RS, Wang BQ, Burton ZF, Dahmus ME (1995) The activity of COOH-terminal domain phosphatase is regulated by a docking site on RNA polymerase II and the by the general transcription factors IIF and IIB. J Biol Chem 270:14962–14969 [DOI] [PubMed] [Google Scholar]
  4. Cho H, Kim TK, Mancebo H, Lane WS, Flores O et al (1999) A protein phosphatase functions to recycle RNA polymerase II. Genes Dev 13:1540–1552 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cho EJ, Kobor MS, Kim M, Greenblatt J, Buratowski S (2001) Opposing effects of Ctk1 kinase and Fcp1 phosphatase at Ser 2 of the RNA polymerase II C-terminal domain. Genes Dev 15:3319–3329 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cramer P, Bushnell DA, Kornberg RD (2001) Structural basis of transcription: RNA polymerase II at 2.8 Ångstrom resolution. Science 29:1863–1876 [DOI] [PubMed] [Google Scholar]
  7. D’Amico TA, Massey M, Herndon JE II, Moore MB, Harpole DH Jr (1999) A biologic risk model for stage I lung cancer: immunohistochemical analysis of 408 patients with the use of ten molecular markers. J Thorac Cardiovasc Surg 117:736–743 [DOI] [PubMed] [Google Scholar]
  8. Ding XF, Huang GM, Shi Y, Li JA, Fang XD (2012) Med 19 promotes gastric cancer progression and cellular growth. Gene 504(2):262–267 [DOI] [PubMed] [Google Scholar]
  9. Greenblatt MS, Bennett WP, Hollstein M, Harris CC (1994) Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res 54:4855–4878 [PubMed] [Google Scholar]
  10. Haga Y, Hiroshima K, Iyoda A, Shibuya K, Shimamura F, Iizasa T et al (2003) Ki-67 expression and prognosis for smokers with resected stage I non-small cell lung cancer. Ann Thorac Surg 75:1727–1732 [DOI] [PubMed] [Google Scholar]
  11. Hahn WC, Counter CM, Lundberg AS, Beijersbergen RL, Brooks MW et al (1999) Creation of human tumour cells with defined genetic elements. Nature 400:464–468 [DOI] [PubMed] [Google Scholar]
  12. Han H, Silverman JF, Santucci TS, Macherey RS, d’Amato TA et al (2001) Vascular endothelial growth factor expression in stage I non-small cell lung cancer correlates with neoangiogenesis and a poor prognosis. Ann Surg Oncol 8:72–79 [DOI] [PubMed] [Google Scholar]
  13. Hirsch FR, Herbst RS, Olsen C, Chansky K, Crowley J et al (2008) Increased EGFR gene copy number detected by fluorescent in situ hybridization predicts outcome in non-small-cell lung cancer patients treated with cetuximab and chemotherapy. J Clin Oncol 26:3351–3357 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kim ES, Hirsh V, Mok T, Socinski MA, Gervais R et al (2008) Gefitinib versus docetaxel in previously treated non-small-cell lung cancer: a randomized phase III trial (INTEREST). Lancet 372:1809–1818 [DOI] [PubMed] [Google Scholar]
  15. Kobor MS, Archambault J, Lester W, Holstege FC, Gileadi O et al (1999) An unusual eukaryotic protein phosphatase required for transcription by RNA polymerase II and CTD dephosphorylation in S. cerevisiae. Mol Cell 4:55–62 [DOI] [PubMed] [Google Scholar]
  16. Li LH, He J, Hua D, Guo ZJ, Gao Q (2011) Lentivirus-mediated inhibition of Med19 suppresses growth of breast cancer cells in vitro. Cancer Chemother Pharmacol 68(1):207–215 [DOI] [PubMed] [Google Scholar]
  17. Liao M, Wang H, Lin Z, Feng J, Zhu D (2001) Vascular endothelial growth factor and other biological predictors related to the postoperative survival rate on non-small cell lung cancer. Lung Cancer 33:125–132 [DOI] [PubMed] [Google Scholar]
  18. Licciardo P, Ruggiero L, Lania L, Majello B (2001) Transcription activation by targeted recruitment of the RNA polymerase II CTD phosphatase FCP1. Nucleic Acids Res 29:3539–3545 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lin PS, Marshall NF, Dahmus ME (2002) CTD phosphatase: role in RNA polymerase II cycling and the regulation of transcript elongation. Prog Nucleic Acid Res Mol Biol 72:333–365 [DOI] [PubMed] [Google Scholar]
  20. Mandal SS, Cho H, Kim S, Cabane K, Reinberg D (2002) FCP1, a phosphatase specific for the heptapeptide repeat of the largest subunit of RNA polymerase II, stimulates transcription elongation. Mol Cell Biol 22:7543–7552 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Manjunath N, Wu H, Subramanya S, Shankar P (2009) Lentiviral delivery of short hairpin RNAs. Adv Drug Deliv Rev 61:732–745 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mineo TC, Ambrogi V, Baldi A, Rabitti C, Bollero P et al (2004) Prognostic impact of VEGF, CD31, CD34, and CD105 expression and tumour vessel invasion after radical surgery for IB-IIA non-small cell lung cancer. J Clin Pathol 57:591–597 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Moldvay J, Scheid P, Wild P, Nabil K, Siat J et al (2000) Predictive survival markers in patients with surgically resected non-small cell lung carcinoma. Clin Cancer Res 6:1125–1134 [PubMed] [Google Scholar]
  24. O’Byrne KJ, Koukourakis MI, Giatromanolaki A, Cox G, Turley H et al (2000) Vascular endothelial growth factor, platelet-derived endothelial cell growth factor and angiogenesis in non-small-cell lung cancer. Br J Cancer 82:1427–1432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Pastorino U, Andreola S, Tagliabue E, Pezzella F, Incarbone M et al (1997) Immunocytochemical markers in stage I lung cancer: relevance to prognosis. J Clin Oncol 15:2858–2865 [DOI] [PubMed] [Google Scholar]
  26. Phatnani HP, Greenleaf AL (2006) Phosphorylation and functions of the RNA polymerase II CTD. Genes Dev 20:2922–2936 [DOI] [PubMed] [Google Scholar]
  27. Qin XF, An DS, Chen IS, Baltimore D (2003) Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci USA 100:183–188 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Sato M, Shames DS, Gazdar AF, Minna JD (2007) A translational view of the molecular pathogenesis of lung cancer. J Thorac Oncol 2:327–343 [DOI] [PubMed] [Google Scholar]
  29. Scagliotti G, Novello S (2003) Adjuvant chemotherapy after complete resection for early stage NSCLC. Lung Cancer 42:S47–S51 [DOI] [PubMed] [Google Scholar]
  30. Son S, Osmani SA (2009) Analysis of all protein phosphatase genes in Aspergillus nidulans identifies a new mitotic regulator, fcp1. Eukaryot Cell 8(4):573–585 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sun S, Schiller JH, Gazdar AF (2007) Lung cancer in never smokers: a different disease. Nat Rev Cancer 7:778–790 [DOI] [PubMed] [Google Scholar]
  32. Tammemagi MC, McLaughlin JR, Bull SB (1999) Meta-analyses of p53 tumor suppressor gene alterations and clinicopathological features in resected lung cancers. Cancer Epidemiol Biomark Prev 8:625–634 [PubMed] [Google Scholar]
  33. Tang X, Shigematsu H, Bekele BN, Roth JA, Minna JD et al (2005) EGFR tyrosine kinase domain mutations are detected in histologically normal respiratory epithelium in lung cancer patients. Cancer Res 65:7568–7572 [DOI] [PubMed] [Google Scholar]
  34. Weihua Z, Tsan R, Huang WC, Wu Q, Chiu CH et al (2008) Survival of cancer cells is maintained by EGFR independent of its kinase activity. Cancer Cell 13:385–393 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wright PA, Quirke P, Attanoos R, Williams GT (1992) Molecular pathology of gastric carcinoma: progress and prospects. Hum Pathol 23(8):848–859 [DOI] [PubMed] [Google Scholar]
  36. Yu X, Chini CC, He M, Mer G, Chen J (2003) The BRCT domain is a phospho-protein binding domain. Science 302:639–642 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material 1 (DOCX 13 kb) (13.5KB, docx)

Articles from Journal of Cancer Research and Clinical Oncology are provided here courtesy of Springer

RESOURCES