Abstract
Purpose
Cotinine has optimal characteristics as a hapten for pre-targeted radioimmunotherapy (PRIT). This study was performed to evaluate the applicability of cotinine/anti-cotinine antibody to PRIT.
Methods
We developed and prepared a tandem, single-chain, variable fragment Fc fusion protein [tandem single-chain variable fragment (scFv) Fc fusion protein] that is reactive to both human epidermal growth factor receptor 2 (Her2) and cotinine. Its simultaneous reactivity to Her2 and cotinine was tested in an enzyme-linked immunosorbent assay (ELISA) and two radioimmunoassays (RIA) employing Her2-coated RIA tubes and a Her2-overexpressing cell line. For in vivo imaging, mice bearing Her2-positive tumors were injected with a mixture of tandem scFv Fc fusion and 125I-cotinine-conjugated histidine dipeptide (125I-cotinine peptide). After a delay, 125I-cotinine peptide was injected again.
Results
ELISA and RIA results showed that tandem scFv Fc fusion protein successfully bound to both Her2 and cotinine. In single-photon emission computed tomography (SPECT), the complex of tandem scFv Fc fusion protein and 125I-cotinine peptide was localized to Her2-positive tumor xenografts in mice 4 h after the first injection. Enhanced radioactivity at the site of the Her2-positive tumor lesion was monitored 1 h after the second injection.
Conclusions
With these findings, we conclude that the tandem scFv Fc fusion protein and cotinine hapten system have the potential to be applied in PRIT.
Keywords: Pre-targeting, Bispecific antibody, Hapten, Cotinine, Human epidermal growth factor receptor 2 (Her2), In vivo imaging
Introduction
The use of pre-targeted radioimmunotherapy (PRIT) for the treatment of cancer was introduced to overcome the limitations of directly radiolabeled antibodies. Unlabeled antibody is injected prior to the injection of the radionuclide moiety. After the favorable distribution of the injected antibody is achieved, the radionuclide moiety is injected. Delayed injection of the radionuclide can reduce the level of unintended radiation to the bone marrow or spleen, since the antibody is cleared more rapidly from those tissues than from the tumor site (Milenic et al. 2004; Chang et al. 2002). As PRIT guarantees more specific delivery of radionuclide, the overall efficacy of the treatment is improved (Boerman et al. 2003; Gautherot et al. 1998; Chatal et al. 2009).
For earlier PRIT, avidin, streptavidin, and biotin were commonly employed. A tumor was pre-targeted with biotinylated antibody. Then avidin was injected to clear the biotinylated antibody from the circulation. Streptavidin was introduced to accumulate at the tumor, and then, a biotin-conjugated radionuclide was injected (Paganelli et al. 1988; Colombo et al. 1996; Knox et al. 2000). The limitation of this system lies on the immunogenicity of streptavidin and reduced signal due to binding of endogenous biotin to pre-targeted streptavidin.
After the development of recombinant antibody technology, PRIT strategies using a bispecific antibody and a small molecule hapten were developed. After the bispecific antibody, which has affinity for both the cancer-specific antigen and the hapten, is injected, the radiolabeled hapten is injected with a delay. The radiolabeled hapten localizes to the tumor tissue by binding to the bispecific antibody, and the unbound radiolabeled molecule is rapidly cleared from the systemic circulation (Sharkey et al. 2005, 2010; Karacay et al. 2005).
To be used for PRIT, the hapten must be non-toxic, exogenous, and biologically inactive or beneficial. Histamine-succinyl-glycine (HSG), diethylenetriamine pentaacetic acid (DTPA), and 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) have been used for this purpose. HSG, a derivative of histamine, is pharmacologically inactive and shows no evidence of biological activity in vitro (Rossi et al. 2006; Goldenberg et al. 2008; Chang et al. 2007). DTPA and DOTA are metal chelators with a long history of use as magnetic resonance imaging contrast agents in gadolinium (Gd)-chelated forms. Neither of these compounds is endogenous or metabolized, and is cleared rapidly from the systemic circulation (Orcutt et al. 2011). When chelated to Gd, DTPA and DOTA are non-toxic, with an LD50 of 3.9 and 5.6 g/kg in mice, respectively. However, the non-chelated forms of the molecules are quite toxic, with an LD50 of 1.57 × 10−3 and 4.4 × 10−2 g/kg in mice, individually (Meyer et al. 2010; Fritz et al. 1991). DOTA and DTPA can be immunogenic (Watanabe et al. 1994; Kosmas et al. 1992, 1995; Baxter et al. 1991), and the number of radioisotopes per molecule is limited (Sharkey et al. 2010).
Here, we propose that cotinine, a small chemical with a molecular weight of 176.22, can be used as a hapten in PRIT. It is a major metabolite of nicotine, exogenous in relation to human or animal tissues, and commonly used as a biomarker of smoking (Kim and Huestis 2006). Additionally, cotinine is non-toxic, with an LD50 of 4 ± 0.1 g/kg in mice (Riah et al. 1999). Daily doses of cotinine up to 1,800 mg for a period of 4 days do not induce deleterious side effects in humans (Bowman and Herbert McKennis 1962). Recently, cotinine was reported to possess a beneficial psychopharmacological effect in a mouse model, and its potential therapeutic use is under discussion (Moran 2012). Trans-4-cotininecarboxylic acid (carboxycotinine) is commercially available at low cost; its carboxyl group can be employed for chemical cross-linking. We have previously developed an anti-cotinine antibody and showed that it binds specifically to cotinine and does not cross-react with chemicals that possess similar structures, such as nicotine, anabasine, caffeine, or cholesterol (Park et al. 2012). We also confirmed that cotinine-conjugated peptides with molecular masses less than 10 kDa clear rapidly from the blood (manuscript under preparation).
In this study, we developed a tandem single-chain variable fragment (scFv) Fc fusion protein that binds to human epidermal growth factor receptor 2 (Her2) and a cotinine-conjugated molecule, a new hapten, simultaneously (Fig. 1). Using a bispecific antibody and a cotinine-conjugated peptide labeled with a radioisotope, we can successfully visualize tumors in mouse xenografts.
Fig. 1.
A schematic diagram of tandem scFv Fc fusion protein binding to both Her2 and cotinine
Materials and methods
Generation and expression of the tandem scFv Fc fusion protein
A set of complimentary oligomers encoding two SfiI endonuclease recognition sites, a linker consisting of (Gly–Gly–Gly–Ser)3, an AgeI endonuclease recognition site, and a NotI endonuclease recognition site was chemically synthesized (Genscript, Piscataway, NJ, USA). The sequences of the oligomers were as follows: 5′-CGGCCATGTCGTCCATCGGCCAGGCCGGCCAGGGAGGAGGTGGATCGGGGGGAGGGGATCCGGTGGAGGCGGATCGACCGGTCGGTCAAGAGCCAGCGGCCGCGGGGC-3′ (sense); 5′-CGCGGCCGCTGGCTCTTGACCGACCGGTCGATCCGCCTCCACCGGATCCCCCTCCCCCCGATCCACCTCCTCCCTGGCCGGCCTGGCCGATGGACGACATGGCCGCCT-3′ (antisense). After mixing the set of oligomers up to a final concentration 0.5 μg/μL in distilled water, the mixture was incubated in a water bath at 95 °C for 10 min and cooled to room temperature for annealing.
Annealed oligomers were subjected to 1 % agarose (Invitrogen, Carlsbad, CA, USA) gel electrophoresis and purified using the QIAquick® Gel Extraction Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions. Each end of the oligomer was designed to complimentarily match the SfiI-digested sequence of the pCEP4 vector (Invitrogen) modified to encode the hinge region and CH2–CH3 domains of human IgG1 as described previously (Park et al. 2010). A redundant single nucleotide was introduced to the antisense oligomer to disrupt the second SfiI site of the vector upon ligation. After digestion of the pCEP4 vector by SfiI (New England Biolabs, Beverly, MA, USA), the oligomers and the vector were ligated using T4 ligase (Invitrogen).
The ligated vector and the trastuzumab scFv gene (Carter et al. 1992; Olafsen et al. 2004) were individually digested with SfiI (New England Biolabs) and ligated to each other. Anti-cotinine scFv gene (Park et al. 2010) was amplified by the polymerase chain reaction (PCR) using primers that were designed to add the AgeI or NotI endonuclease recognition site at the 5′ and 3′ends, respectively. The sequences of the oligomers were as follows: 5′-AGGGACACCGGTGAGCTCGATCTGACCCAG-3′ (sense); 5′-ATGTGCGCGGCCGCTTGAAGAGATGG TGAC-3′ (antisense). Both the vectors containing the trastuzumab scFv gene and the PCR product were each digested with AgeI (New England Biolabs) and NotI (New England Biolabs), and ligated using T4 ligase (Invitrogen).
The completed expression vector encoding anti-Her2 scFv, anti-cotinine scFv, linker, and the human IgG1 Fc region was transfected into HEK293F cells (FreeStyle™ 293-F Cells, Invitrogen) using Lipofectamine 2000 (Invitrogen), according to manufacturer’s instructions. Cells were grown in FreeStyle™ 293 Expression Medium (Invitrogen) containing 100 U/mL penicillin and 100 μg/mL streptomycin at 37 °C in air containing 7 % CO2 on an orbital shaking incubator (Minitron, INFORS HT, Bottmingen, Switzerland) at 135 rpm. The culture supernatant was collected at the third, sixth, and ninth days after the transfection. The tandem scFv Fc fusion protein was purified from the culture supernatant by affinity chromatography using protein A-agarose beads (RepliGen, Waltham, MA, USA). The eluate was dialyzed with 4 L phosphate-buffered saline (PBS; 137 mM sodium chloride, 10 mM phosphate, and 2.7 mM potassium chloride, pH 7.4) overnight at 4 °C.
Cell culture
Human breast cancer cell lines, MCF7-ErbB2, MCF-7, KPL-4, and MDA-MB-231, were obtained from the Korean Cell Line Bank (Seoul, Republic of Korea). All cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Welgene, Seoul, Korea) supplemented with 10 % fetal bovine serum (GIBCO, Grand Island, NY, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in air containing 7 % CO2 and 95 % relative humidity (RH) on an orbital shaking incubator (Minitron, INFORS HT) at 135 rpm.
Enzyme-linked immunosorbent assay (ELISA)
The wells of a 96-well microtiter plate (Corning Costar Corp., Cambridge, MA, USA) were coated with 5 μg/mL recombinant human Her2 (R&D Systems, Minneapolis, MN, USA) in coating buffer (0.1 M sodium bicarbonate in distilled water, pH 8.6) overnight at 4 °C and blocked with 150 μL blocking buffer [3 % bovine serum albumin (BSA) in PBS] for 1 h at 37 °C. The tandem scFv Fc fusion protein at concentrations of 6 and 30 nM in 50 μL blocking buffer was added to each well and incubated for 1 h at 37 °C. After washing three times with 0.05 % Tween 20 in PBS (PBST), cotinine-conjugated horseradish peroxidase (HRP) diluted in blocking buffer (1 μg/mL) was added and incubated for 1 h at 37 °C. After washing three times with 0.05 % PBST, 50 μL 3,3′,5,5′-tetramethyl benzidine substrate solution (TMB) (Pierce, Rockford, IL, USA) was added to each well, and the optical density was measured at 650 nm (Labsystems Multiskan Ascent microplate reader, ThermoFisher Scientific, Waltham, MA, USA).
Iodine isotope labeling of carboxycotinine conjugated with two histidines
The histidine dipeptide was chemically synthesized and cross-linked with carboxycotinine at the N-terminus using the Fmoc-solid-phase peptide synthesis reaction (Peptron, Daejun, Korea). Sixteen grams of the cotinine-conjugated histidine dipeptide (0.032 mol) and 148 MBq 125I-NaI (PerkinElmer, Waltham, MA, USA) were dissolved in 200 μL of 0.1 M Na2CO3 and added to an IodoGen pre-coated iodination tube (Pierce). The mixture was incubated at 25 °C for 90 min and then subjected to high-performance liquid chromatography (HPLC) on a Phenomenex C18 column (Synergi Hydro-RP, particle size 4 μm, pore size 80 Å, 150 × 4.6 mm; Torrance, CA, USA) with a gradient of 0.1 % trifluoroacetic acid (TFA) in water and 0.1 % TFA in acetonitrile. The flow rate was 1 mL/min as monitored by a UV detector at 220 nm. The eluate containing 125I-cotinine peptide was filtered with a sterile 0.22-μm filter (Pall Corporation, Ann Arbor, MI, USA) and was evaporated and solubilized with saline solution (0.9 % NaCl, pH 7).
Radioimmunoassay (RIA)
RIA tubes (BD Falcon Cat. 352008, Mississauga, ON, Canada) were coated with 200 μL of 20 g/mL recombinant human Her2 in coating buffer overnight at 4 °C and blocked with 500 μL blocking buffer for 1 h at 37 °C. After pre-incubation with 5 μCi 125I-cotinine peptide and 2 μg tandem scFv Fc fusion protein in 300 μL blocking buffer for 5 min, the mixture was applied to each tube and incubated for 1 h at 37 °C. After washing five times with 0.05 % PBST and once with distilled water, gamma radioactivity from each tube was measured under γ-counter (WIZARD2 Automatic Gamma Counter, Perkin Elmer, Waltham, MA, USA).
Her2-positive human breast cancer cell lines, MCF-7-ErbB2 and KPL-4, and Her2-negative MCF-7 and MDA-MB-231 cells were grown on a 24-well plate (Corning). When the cell density reached 2.5 × 105 per well, cells were washed twice with sterilized PBS. Then 5 μCi 125I-cotinine peptide and 2 μg tandem scFv Fc fusion protein in 1 mL DMEM were pre-incubated for 5 min and added to each well. After a 1 h incubation in an incubator (37 °C, 5 % CO2), cells were washed twice with PBS and transferred to RIA tubes (BD Falcon). Gamma radioactivity was measured as described above.
Single-photon emission computed tomography (SPECT) imaging of mice bearing tumor xenografts
Six-week-old female Balb/c-nude mice were purchased from Central Lab Animal Inc. (Seoul, Korea). The animals were maintained in the National Cancer Center animal facility in accordance with the AAALAC International Animal Care Policy (accredited unit number 1392). The mice were subcutaneously injected with the Her2-positive breast cancer cell line, KPL-4 (Massarweh et al. 2006), and with the Her2-negative breast cancer cell line, MDA-MB-231. Tumors were grown on the left flank of mice for 4 weeks until the tumor volume reached 50–100 mm3.
Each mouse was injected via the tail vein with 37 MBq 125I-cotinine peptide, pre-incubated with 80 μg tandem scFv Fc fusion protein dissolved in 100 μL sterile PBS. SPECT images were obtained (NanoSPECT, Bioscan, Washington, DC, NW) 4 h after the first injection. Right after the scan was performed, the mice were injected once more with 37 MBq 125I-cotinine peptide. One hour after the second injection, SPECT images were obtained again.
Results
Preparation of the tandem scFv Fc fusion protein
The gene construct encoding the tandem scFv Fc fusion protein was cloned into a eukaryotic expression vector for expression in mammalian cells. The tandem scFv Fc fusion protein was purified from culture supernatants using protein A affinity column chromatography. On a sodium dodecyl sulfate polyacrylamide (SDS) gel stained with Coomassie Brilliant Blue 250 (Invitrogen), the band corresponding to the tandem scFv Fc fusion protein was successfully visualized, without any other contaminating bands (data not shown).
The reactivity of the tandem scFv Fc fusion protein to both Her2 and cotinine was tested by ELISA. The tandem scFv Fc fusion protein was able to bind to Her2 coated on the microtiter plate and cotinine-conjugated HRP simultaneously. The amount of the tandem scFv Fc fusion protein bound to Her2 increased in a dose-dependent manner from 6 nM to 30 nM without a significant background signal (Fig. 2).
Fig. 2.
Enzyme-linked immunosorbent assay (ELISA) for binding specificity of the tandem scFv Fc fusion protein against Her2. Tandem scFv Fc fusion protein was added to wells coated with Her2. Cotinine-conjugated horseradish peroxidase and 3,3′,5,5′-tetramethylbenzidine substrate solution were added with intermittent washing. Optical density was measured at 650 nm. Data are shown as the mean ± SEM; **P < 0.01
Synthesis of cotinine-conjugated histidine dipeptide labeled with radioactive iodine
Histidine dipeptide was chemically synthesized, and cotinine was cross-linked at the N-terminus. Cotinine-conjugated histidine dipeptide was then labeled with 125I. The final radiochemical yield and purity were 75 and 99.8 % (111 MBq/150 μL, decay corrected), respectively. The total preparation time, including HPLC purification, was 130 min.
Characterization of the tandem scFv Fc fusion protein using RIA
A RIA was performed to test whether the tandem scFv Fc fusion protein could bind to Her2 and 125I-cotinine peptide simultaneously. The complex of the tandem scFv Fc fusion protein and 125I-cotinine peptide successfully bound to Her2-coated tubes (Fig. 3).
Fig. 3.
Radioimmunoassay (RIA) of the tandem scFv Fc fusion protein and 125I-cotinine peptide. The tandem scFv Fc fusion protein was pre-incubated with 125I-cotinine peptide and added to tubes coated with Her2. After incubation and washing, the radioactivity was measured using a gamma counter. Values were expressed as CPM ± SEM for the triplicate assays; **P < 0.01
The tandem scFv Fc fusion protein was then tested for simultaneous binding to Her2-overexpressing breast cancer cell lines and 125I-cotinine peptide by RIA (Fig. 4). There was a statistically significant difference in the radioactivities between Her2-positive and Her2-negative cells treated with the mixture of the tandem scFv Fc fusion protein and 125I-cotinine peptide in parallel. These findings suggest that the tandem scFv Fc fusion protein binds to Her2 and 125I-cotinine peptide simultaneously.
Fig. 4.
RIA of the tandem scFv Fc fusion protein and 125I-cotinine peptide in human breast cancer cell lines. NT not treated. The tandem scFv Fc fusion protein was pre-incubated with 125I-cotinine peptide and added to two Her2-positive and two Her2-negative human breast cancer cell lines. After washing, gamma radioactivity was measured with cell pellets. Experiments were done in triplicate
In vivo SPECT imaging of pre-targeting efficiency with the tandem scFv Fc fusion protein and 125I-cotinine peptide
To evaluate the Her2-dependent tumor targeting of our combination system as a pre-targeting tool in mice, we monitored the distribution of 125I-cotinine peptide via in vivo SPECT imaging. Two mouse groups bearing subcutaneous tumors (from Her2-positive KPL-4 cells and Her2-negative MDA-MB231 cells, respectively) received intravenous injections of 125I-cotinine peptide pre-incubated with the tandem scFv Fc fusion protein. After 4 h, SPECT images were taken, and 125I-cotinine peptide was injected again. The second SPECT images were taken 1 h after the second injection (Fig. 5). Background signals from the thyroid, stomach, and bladder were observed, which may result from the accumulation of free iodine cleaved from the 125I-cotinine peptide in the circulation. As shown in Fig. 5a, in mice with Her2-positive tumors, tumor sites were discriminated from the surrounding tissues and clearly visualized, whereas 125I-cotinine peptide uptake signals were not detected in Her2-negative tumors. The average standardized uptake value (SUV) maximal uptake (SUVmax) in the Her2-positive group (2.355 ± 0.332) was high only in tumor sites in contrast to the Her2-negative group (1.023 ± 0.459) (Fig. 5b, c). Moreover, the second injection of 125I-cotinine peptide showed enhanced signal accumulation only at the locus of the Her2-positive tumor compared with the SUVmax of the first injection (from 2.355 ± 0.332 to 3.687 ± 0.546). These data suggest that the second injection of 125I-cotinine peptide was specifically localized to the tandem scFv Fc fusion protein at the tumor site.
Fig. 5.
Her2-dependent pre-targeting by the coupling of 125I-cotinine peptide and the tandem scFv Fc fusion protein in the mouse subcutaneous xenograft model of breast cancer. The tandem scFv Fc fusion protein was pre-incubated with 125I-cotinine peptide and injected into mice bearing Her2-positive or Her2-negative tumors. After 4 h, SPECT images were taken. Right after the image was taken, 125I-cotinine peptide was injected again. A second SPECT image was taken 1 h after the second injection (a). The white arrows indicate the location of the tumor. The SUVmax values of 125I-cotinine peptide in each tumor of the Her2-positive (b) and Her2-negative (c) groups
Discussion
In this study, we studied the applicability the tandem scFv Fc fusion and cotinine in PRIT. After confirming the bispecificity of the tandem scFv by ELISA (Fig. 2), RIA (Fig. 3), and cell RIA (Fig. 4), the localization of 125I-cotinine peptide to the tumor xenograft was monitored in the presence of the tandem scFv Fc fusion (Fig. 5).
In conventional PRIT, bispecific antibodies and radiolabeled haptens are injected sequentially. But in this study, we tried to prove that the 125I-cotinine peptide was localized to the tumor site where the tandem scFv Fc fusion protein accumulated. To show this, we injected a mixture of the tandem scFv Fc fusion protein and 125I-cotinine peptide and took images. Subsequently, the 125I-cotinine peptide was injected again to obtain enhanced images. As the Koff value of the previously developed anti-cotinine scFv was 1.253 × 10−5/s (unpublished data), it was expected that after 4 h, approximately 15 % of the 125I-cotinine peptide would be detached from the tandem scFv Fc fusion protein localized at the tumor site (Jakubowski 2002; Anderson et al. 2009). We expected that this time point would be optimal for the enhancement of the radiological signal. The actual enhancement was higher than expected, which suggests that the 125I-cotinine peptide was more rapidly detached from the bispecific, tandem scFv Fc fusion protein. Unexpected localization of the radioactive signal was not detected.
For an amino acid residue to be labeled with 125I, we selected histidine rather than tyrosine, because the incidence of deiodination by hepatic deiodase activity in the liver is much lower for 125I-labeled histidine conjugates compared to other 125I-labeled amino acid conjugates, leading to a minimum loss of radioactivity in in vivo experiments (Behr et al. 2002). Carboxycotinine can cross-link the N-terminus of peptides quite easily and efficiently. Various radiolabeled peptides with different compositions and lengths can be tested with ease. This might be the main advantage of cotinine over other haptens. We also tested cotinine conjugated with 15 histidines residues, which did not provide superior images compared with histidine dipeptides. We think that the composition, length, and sequence of the peptide affect its size, isoelectric point, and hydrophobicity, which would then determine its distribution. Currently, we are investigating what the optimal length and composition of the peptide would be for a cotinine-conjugated moiety.
In summary, we showed that the tandem scFv Fc fusion protein retained reactivity for both Her2 and cotinine. A cotinine-conjugated histidine dipeptide was successfully radiolabeled with 125I. The complex of the tandem scFv Fc fusion protein with 125I-cotinine peptide was localized to Her2-positive tumor xenografts in mice. With these findings, we conclude that the tandem scFv fusion protein and cotinine hapten system can potentially be used for PRIT.
Acknowledgments
This work was supported by a grants from the following programs: Pioneer Research Center Program through the National Research Foundation of Korea funded by the Ministry of Science, ICT and Future Planning (2013-009119); Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2009-0093820); and the National Research Foundation of Korea (NRF) funded by the Korean government (MSIP) (2011-0030119).
Conflict of interest
None.
Footnotes
Soomin Yoon and Yun-Hee Kim have contributed equally to this study.
References
- Anderson K, Lai ZH, McDonald OB, Stuart JD, Nartey EN et al (2009) Biochemical characterization of GSK1070916, a potent and selective inhibitor of Aurora B and Aurora C kinases with an extremely long residence time. Biochem J 420:259–265 [DOI] [PubMed] [Google Scholar]
- Baxter AB, Melnikoff S, Stites DP, Brasch RC (1991) Immunogenicity of gadolinium-based contrast agents for magnetic-resonance-imaging—induction and characterization of antibodies in animals. Invest Radiol 26:1035–1040 [DOI] [PubMed] [Google Scholar]
- Behr TM, Gotthardt M, Becker W, Behe M (2002) Radioiodination of monoclonal antibodies, proteins and peptides for diagnosis and therapy—a review of standardized, reliable and safe procedures for clinical grade levels kBq to GBq in the Gottingen/Marburg experience. Nuklearmedizin-Nucl Med 41:71–79 [PubMed] [Google Scholar]
- Boerman OC, van Schaijk FG, Oyen WJG, Corstens FHM (2003) Pretargeted radioimmunotherapy of cancer: progress step by step. J Nucl Med 44:400–411 [PubMed] [Google Scholar]
- Bowman Edward R, Herbert McKennis J (1962) Studies on the metabolism of (−)-cotinine in the human. J Pharmacol Exp Ther 135:306 [PubMed] [Google Scholar]
- Carter P, Presta L, Gorman CM, Ridgway JBB, Henner D et al (1992) Humanization of an Anti-P185her2 antibody for human cancer-therapy. Proc Natl Acad Sci USA 89:4285–4289 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chang CH, Sharkey RM, Rossi EA, Karacay H, McBride W et al (2002) Molecular advances in pretargeting radioimunotherapy with bispecific antibodies. Mol Cancer Ther 1:553–563 [PubMed] [Google Scholar]
- Chang CH, Rossi EA, Goldenberg DM (2007) The dock and lock method: a novel platform technology for building multivalent, multifunctional structures of defined composition with retained bioactivity. Clin Cancer Res 13:5586s–5591s [DOI] [PubMed] [Google Scholar]
- Chatal JF, Davodeau F, Cherel M, Barbet J (2009) Different ways to improve the clinical effectiveness of radioimmunotherapy in solid tumors. J Cancer Res Ther 5:36–40 [DOI] [PubMed] [Google Scholar]
- Colombo P, Siccardi AG, Paganelli G, Magnani P, Songini C et al (1996) Three-step immunoscintigraphy with anti-chromogranin a monoclonal antibody in tumours of the pituitary region. Eur J Endocrinol 135:216–221 [DOI] [PubMed] [Google Scholar]
- Fritz T, Unger E, Wilsonsanders S, Ahkong QF, Tilcock C (1991) Detailed toxicity studies of liposomal gadolinium-DTPA. Invest Radiol 26:960–968 [DOI] [PubMed] [Google Scholar]
- Gautherot E, Le Doussal JM, Bouhou J, Manetti C, Martin M et al (1998) Delivery of therapeutic doses of radioiodine using bispecific antibody-targeted bivalent haptens. J Nucl Med 39:1937–1943 [PubMed] [Google Scholar]
- Goldenberg DM, Rossi EA, Sharkey RM, McBride WJ, Chang CH (2008) Multifunctional antibodies by the dock-and-lock method for improved cancer Imaging and therapy by pretargeting. J Nucl Med 49:158–163 [DOI] [PubMed] [Google Scholar]
- Jakubowski H (2002) Understanding biochemical dissociation constants: a temporal perspective. J Chem Educ 79:968–971 [Google Scholar]
- Karacay H, Brard PY, Sharkey RM, Chang CH, Rossi EA et al (2005) Therapeutic advantage of pretargeted radioimmunotherapy using a recombinant bispecific antibody in a human colon cancer xenograft. Clin Cancer Res 11:7879–7885 [DOI] [PubMed] [Google Scholar]
- Kim I, Huestis MA (2006) A validated method for the determination of nicotine, cotinine, trans-3′-hydroxycotinine, and norcotinine in human plasma using solid-phase extraction and liquid chromatography-atmospheric pressure chemical ionization-mass spectrometry. J Mass Spectrom 41:815–821 [DOI] [PubMed] [Google Scholar]
- Knox SJ, Goris ML, Tempero M, Weiden PL, Gentner L et al (2000) Phase II trial of yttrium-90-DOTA-biotin pretargeted by NR-LU-10 antibody/streptavidin in patients with metastatic colon cancer. Clin Cancer Res 6:406–414 [PubMed] [Google Scholar]
- Kosmas C, Snook D, Gooden CS, Courtenayluck NS, Mccall MJ et al (1992) Development of humoral immune-responses against a macrocyclic chelating agent (Dota) in cancer-patients receiving radioimmunoconjugates for imaging and therapy. Cancer Res 52:904–911 [PubMed] [Google Scholar]
- Kosmas C, Maraveyas A, Gooden CS, Snook D, Epenetos AA (1995) Anti-chelate antibodies after intraperitoneal yttrium-90-labeled monoclonal-antibody immunoconjugates for ovarian-cancer therapy. J Nucl Med 36:746–753 [PubMed] [Google Scholar]
- Massarweh S, Osborne CK, Jiang S, Wakeling AE, Rimawi M et al (2006) Mechanisms of tumor regression and resistance to estrogen deprivation and fulvestrant in a model of estrogen receptor-positive, HER-2/neu-positive breast cancer. Cancer Res 66:8266–8273 [DOI] [PubMed] [Google Scholar]
- Meyer DCC, Port M, Barbotin V, Bonnemain B (2010) Process for preparing a pharmaceutical formulation of contrast agents. EP2242515 A2
- Milenic DE, Brady ED, Brechbiel MW (2004) Antibody-targeted radiation cancer therapy. Nat Rev Drug Discov 3:488–498 [DOI] [PubMed] [Google Scholar]
- Moran VE (2012) Cotinine: beyond the expected, more than a biomarker of tobacco consumption. Frontiers Pharmacol 3:1–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Olafsen T, Tan GJ, Cheung CW, Yazaki PJ, Park JM et al (2004) Characterization of engineered anti-pI85(HER-2) (scFv-C(H)3)(2) antibody fragments (minibodies) for tumor targeting. Protein Eng Des Sel 17:315–323 [DOI] [PubMed] [Google Scholar]
- Orcutt KD, Nasr KA, Whitehead DG, Frangioni JV, Wittrup KD (2011) Biodistribution and clearance of small molecule hapten chelates for pretargeted radioimmunotherapy. Mol Imag Biol 13:215–221 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paganelli G, Riva P, Deleide G, Clivio A, Chiolerio F et al. (1988) Invivo labeling of biotinylated monoclonal-antibodies by radioactive avidin—a strategy to increase tumor radiolocalization. Int J Cancer 2:121–125 [DOI] [PubMed] [Google Scholar]
- Park S, Lee DH, Park JG, Lee YT, Chung J (2010) A sensitive enzyme immunoassay for measuring cotinine in passive smokers. Clin Chim Acta 411:1238–1242 [DOI] [PubMed] [Google Scholar]
- Park S, Hwang D, Chung J (2012) Cotinine-conjugated aptamer/anti-cotinine antibody complexes as a novel affinity unit for use in biological assays. Exp Mol Med 44:554–561 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Riah O, Dousset JC, Courriere P, Stigliani JL, Baziard-Mouysset G et al (1999) Evidence that nicotine acetylcholine receptors are not the main targets of cotinine toxicity. Toxicol Lett 109:21–29 [DOI] [PubMed] [Google Scholar]
- Rossi EA, Goldenberg DM, Cardillo TM, McBride WJ, Sharkey RM et al (2006) Stably tethered multifunctional structures of defined composition made by the dock and lock method for use in cancer targeting. Proc Natl Acad Sci USA 103:6841–6846 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sharkey RM, Karacay H, Chang CH, McBride WJ, Horak ID et al (2005) Improved therapy of non-Hodgkin’s lymphoma xenografts using radionuclides pretargeted with a new anti-CD20 bispecific antibody. Leukemia 19:1064–1069 [DOI] [PubMed] [Google Scholar]
- Sharkey RM, Rossi EA, McBride WJ, Chang CH, Goldenberg DM (2010) Recombinant bispecific monoclonal antibodies prepared by the dock-and-lock strategy for pretargeted radioimmunotherapy. Semin Nucl Med 40:190–203 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Watanabe N, Goodwin DA, Meares CF, Mctigue M, Chaovapong W et al (1994) Immunogenicity in rabbits and mice of an antibody-chelate conjugate—comparison of (S) and (R) macrocyclic enantiomers and an acyclic chelating agent. Cancer Res 54:1049–1054 [PubMed] [Google Scholar]





