Abstract
Purpose
Prognostic and predictive markers in breast cancer are currently determined by single analysis of protein amounts. If RNA-based multi-gene analyses enter clinical practice, simultaneous determination of currently established markers like human epidermal growth factor receptor 2 (HER2), urokinase plasminogen activator (uPA) and its inhibitor (PAI-1) would represent an elegant simplification. To investigate the correlation between RNA and protein levels, we assessed HER2, uPA and PAI-1 in patients with breast cancer. In addition, we evaluated the influence of these factors on patient outcome.
Methods
We collected tumour samples from 133 patients with primary breast cancer. Protein and mRNA levels were measured for HER2, uPA and PAI-1. Protein concentration was measured by ELISA, mRNA expression was analysed by Affymetrix A133U Gene Chip and validated by quantitative PCR.
Results
We were able to demonstrate a statistically significant correlation between mRNA and protein expression for HER2 (r = 0.67, P < 0.001) and uPA (r = 0.7, P < 0.001) but not for PAI-1 (r = 0.27). We observed a prognostic information for PAI-1 mRNA and protein values. Patients with high PAI-1 mRNA expression had a reduced 10-year disease-free survival (DFS) rate (60 vs. 70%, P = 0.071) and 10-year overall survival (OS) rate (68 vs. 79%, P = 0.034). Patients with PAI-1 protein levels above 14 ng/mg protein had a reduced disease-free (10-year DFS rate 54 vs. 71%, P = 0.006) and overall survival rate (10-year OS-rate 63 vs. 83%, P = 0.018). In the patient cohort with no chemotherapy, PAI-1 mRNA levels were the strongest prognostic factor for OS in univariate and multivariate analysis.
Conclusions
Results of RNA-based multi-gene analyses of the prognostic and predictive markers HER2 and uPA correlate with the corresponding protein levels. This is not the case for PAI-1. However, PAI-1 mRNA expression might reveal new clinically relevant information in addition to PAI protein levels.
Keywords: Breast cancer, mRNA, uPA, PAI-1, HER2
Introduction
Important factors of breast cancer classification include prognostic and predictive biomarkers like the human epidermal growth factor receptor 2 (HER2) and the urokinase plasminogen-activator (uPA) with its inhibitor (PAI-1). These factors are currently determined by individual protein assays measuring single biomarkers with the need to perform multiple tests on the same tumour specimen.
RNA expression arrays offer the opportunity to simultaneously assess multiple biological markers or drug target genes (“Expression Profiling”). Gene chip assays for prognostic use in patients with breast cancer are prospectively evaluated in large cohorts (Bogaerts et al. 2006; van’t Veer et al. 2005), but results will not be available in the near future. If multi-gene analyses find their way into clinical practice, the determination of currently established markers like HER2, uPA and PAI-1 by the same method would represent an elegant simplification. Preliminary reports indicate that the evaluation of prognostic markers can be done as part of a clinical breast cancer specific multi-gene assay and may prove to be useful (Esteva et al. 2005; Paik et al. 2004). However, it is unclear for most of the markers whether the measured gene expression correlates with protein expression. Transcriptional cell activity does not necessarily translate into an active protein as posttranscriptional regulations and modifications take place with high complexity and dynamics. Therefore, several studies investigated the correlation between gene and protein expression.
HER2 represents the currently most promising target for therapy and is also discussed as predictive marker (Dowsett and Dunbier 2008). A correlation between gene expression by PCR and protein expression by immunohistochemistry (IHC) and gene copy number by fluorescence in situ hybridization (FISH) was described (Gjerdrum et al. 2004; Vinatzer et al. 2005).
The proteolytic factors uPA and PAI-1 are prospectively evaluated as prognostic markers in patients with axillary node-negative breast cancer (Annecke et al. 2008). The determination of these factors is performed from fresh frozen tissue by ELISA. Conflicting results for the correlation between gene and protein expression show either a good or a weak or no existing correlation (Biermann et al. 2008; Castello et al. 2007; Spyratos et al. 2002).
Taken together, the potential of RNA-based multi-gene analysis is not completely clear. Therefore, we examined the correlation between mRNA values of HER2, uPA and PAI-1 and the corresponding protein expression in fresh frozen tumour tissue of 133 patients with primary breast cancer. In addition, we investigated the prognostic impact of these factors on mRNA and protein level.
Materials and methods
Patients
Tissue samples of 133 patients with primary breast cancer were collected during surgery, snap-frozen and stored in liquid nitrogen. All patients were treated for breast cancer at the University Medical Center Hamburg Eppendorf between 1992 and 2002. Patient selection was based upon availability of tumour tissue.
Patients gave written informed consent to access their tissue and review their medical records according to our investigational review board and ethics committee guidelines.
No radiotherapy or neoadjuvant chemotherapy had been performed prior to surgery. Breast conserving surgery was performed in 55% of the patients, 45% were treated by mastectomy. Seventy-three patients (60%) received adjuvant chemotherapy, 79 patients (66%) radiotherapy and 72 (59%) adjuvant endocrine treatment. Detailed patient characteristics at the time of primary diagnosis are listed in Table 1. At the time of recurrence, 25 patients (24%) had pulmonary metastases as first site of metastasis, 22 patients (21%) had liver metastases, 43 patients (41%) had bone metastases and 10 patients (10%) had brain metastases as first site of metastasis (n = 29 were unknown).
Table 1.
Tumour and treatment characteristics of the patients with primary breast cancer
| No. of patients | Percent | |
|---|---|---|
| Tumour size | ||
| T1 | 30 | 24.4 |
| T2 | 86 | 69.9 |
| T3 | 2 | 1.6 |
| T4 | 5 | 4.1 |
| Unknown | 10 | 7.5 |
| Grading | ||
| G1 | 12 | 9 |
| G2 | 50 | 37.6 |
| G3 | 60 | 45.1 |
| Grading unknown | 11 | 8.3 |
| Oestrogen receptor status | ||
| Positive | 94 | 75.2 |
| Negative | 26 | 20.8 |
| Unknown | 6 | 4.8 |
| Progesterone receptor status | ||
| Positive | 90 | 67.7 |
| Negative | 38 | 28.6 |
| Unknown | 5 | 3.8 |
| Axillary lymph node status | ||
| Positive | 93 | 69.9 |
| Negative | 35 | 26.3 |
| Unknown | 5 | 3.8 |
| Adjuvant treatment | ||
| Chemotherapy (CT) alone | 37 | 31 |
| Endocrine therapy (ET) alone | 36 | 30 |
| CT plus ET | 30 | 29 |
| No therapy | 12 | 10 |
Median age at the time of surgery: 56.3 years
Protein extraction/tissue preparation for ELISA analyses
For all tumours, samples were snap-frozen and stored in liquid nitrogen. Tumour cell content exceeded 70% in all samples, verified by H&E staining of cryo-cut sections. Pieces of approximately 100 mg were cut from the samples and pulverized using a microdismembrator (Braun-Melsungen, Melsungen, Germany) for 2 × 45 s at 200 rpm. The resulting powder was immediately suspended in 670 μl TBS with 1% Triton X-100. The suspension was incubated overnight at 4°C with gentle shaking and subjected to ultracentrifugation for 1 h at 25,000 rpm at 4°C in order to remove insoluble cell material. The supernatants were stored in liquid nitrogen until use.
HER2-determination by ELISA
Tissue HER2 was quantified by a commercially available enzyme-linked immunosorbent assay (Siemens Healthcare Diagnostics Inc., Tarrytown, NY, USA) as previously described (Mueller et al. 2004). The results were expressed in ng per mg of total protein.
Quantitative analysis of uPA and PAI-1 by ELISA
uPA and PAI-1 antigen concentrations were determined applying commercially available ELISA kits (Femtelle™ uPA/PAI-1 ELISA kit, American Diagnostica Inc., Stamford, CT, USA). Antigen concentrations in the detergent extracts were expressed in ng per mg of total protein.
RNA isolation
Approximately 50 mg of frozen breast tumour tissue was pulverized in liquid nitrogen. RLT-Buffer (QIAGEN, Hilden, Germany) was added and the homogenate was centrifuged through a QIAshredder column (QIAGEN). From the eluate, total RNA was isolated by the RNeasy Kit (QIAGEN) according to the manufacturer’s instructions. RNA yield was determined by UV absorbance and RNA quality was assessed by analysis of ribosomal RNA band integrity on an Agilent 2100 Bioanalyzer RNA 6000 LabChip kit (Agilent Technologies, Palo Alto, CA, USA).
Microarray analysis
The Affymetrix (Santa Clara, CA, USA) HG-U133A array and GeneChip System™ was used to quantify the relative transcript abundance in breast cancer tissues. Starting from 5 μg total RNA, labelled cRNA was prepared using the Roche Microarray cDNA Synthesis, Microarray RNA Target Synthesis (T7) and Microarray Target Purification Kit, according to the manufacturer’s instructions. In the analysis settings, the global scaling procedure was chosen which multiplied the output signal intensities of each array to a mean target intensity of 500. Samples with suboptimal average signal intensities (i.e., scaling factors >25) or GAPDH 3′/5′ ratios >5 were relabelled and rehybridized on new arrays.
PCR
Aliquots of total RNA used for GeneChip expression analysis were used for quantitative RT-PCR for uPA and PAI-1 with an ABI PRISM 7900 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). cDNA for PCR amplification was generated by oligo dT-primed reverse transcription (Superscript First Strand System, Invitrogen Corporation, Carlsbad, CA, USA) including DNAse I treatment. Primers and probes were designed with the Primer Express software (Applied Biosystems, Foster City, CA, USA) and spanned the same gene region of the respective Affymetrix probe set. Labelled oligonucleotides were obtained from Eurogentec s.a. (Liege, Belgium). Absolute copy numbers were normalized according to GAPDH as a reference gene. The primer/probes were prepared by mixing 25 μl of 100 μM stock solution “upper primer”, 25 μl of 100 μM stock solution “lower primer” plus 12.5 μl of the 100 μM stock solution TaqMan-probe (FAM/TAMRA) and adjusted to 500 μl with H2O (Primer/probe-mix). PCR reactions using cDNA generated from 1.5 ng total RNA were performed in duplicates in a volume of 10 μl. This included TaqMan universal Mix (Eurogentec s.a.) according to manufacturer’s protocol in a 384-well format and 1 μl of the P&P mix. Thermal cycler parameters were 2 min at 50°C, 10 min at 95°C and 40 cycles, each consisting of a 15 s denaturation step at 95°C and a 1-min annealing/extension step at 60°C. Relative abundance of a gene transcript was calculated either by the ΔΔCt method or by arbitrarily defined RNA copy number estimates at a Ct = 24 as 106 copies. Subsequent analysis included normalization steps such as median centring and per gene median division.
The primer/probe sets used for amplification of the target genes were the following:
uPA Probe ACTACATCGTCTACCTGGGTCGCTCAAGG
Forward Primer CGCCACACACTGCTTCATTG
Reverse Primer CCCCTTGCGTGTTGGAGTT
PAI-1 Probe TGGGCCAAGTGATGGAACCCTGAC
Forward Primer GCACAACCCCACAGGAACA
Reverse Primer GTCCCAGATGAAGGCGTCTTT
Statistical analysis
Correlations between protein or mRNA expression and clinical or histological tumour parameters were calculated by Spearman analysis using the SPSS 15.0 software (SPSS Inc, Chicago, IL, USA). A correlation coefficient below 0.3 (r < 0.3) was interpreted as weak correlation. For prognostic parameters, the following groups were compared: Tumour size <5 cm (pT1 + 2) versus more than 5 cm (pT3 + 4), G1/G2 vs. G3; node-positive versus node-negative tumours; ER/PR positive versus ER/PR negative tumours; age <56 vs. 56 years and older. For survival analyses, the mRNA values were first divided into quartiles. Survival analyses were then performed for all quartiles. The cut-offs that resulted in the most significant difference in outcome were used. For HER2, the upper 25% of values were compared with the lower 75%, for uPA and PAI-1, values below and above the median were compared. Overall survival was computed from the date of surgery to the date of death due to breast cancer. Survival curves were compared with the logrank test. Univariate as well as multivariate P values for the respective risk factors in the survival model were obtained by a Cox proportional hazards model. All tests were performed at a significance level of P = 0.05 (two-sided).
Results
Correlation of biological factors determined by ELISA and mRNA expression determined by microarray analysis
Growth factor receptor HER2
A high correlation between HER2 levels measured on protein and mRNA level was observed (r = 0.67, P < 0.001, Fig. 1). The median HER2 protein level in tissue extracts was 18 ng/mg protein (2.5–750 ng/mg protein), the median HER2 mRNA expression value on the Affymetrix chip was 286 (54–4300).
Fig. 1.
Correlations between HER2 protein expression and HER2 mRNA expression (r = 0.67)
Invasion factors uPA and PAI-1
We found highly significant correlations between uPA protein and mRNA levels (r = 0.7, P < 0.001, Fig. 2a) but a weak association between PAI-1 protein and mRNA levels (r = 0.27, P = 0.001, Fig. 2b). The median uPA protein level was 2.55 ng/mg protein (0.17–21.36 ng/mg protein), the median uPA mRNA level was 135 (40–800). The median PAI-1 protein level was 12.2 ng/mg protein (0.21–111.33 ng/mg protein), the median PAI-1 mRNA level was 77 (4.8–448). Taking previously published cut-off levels (Harbeck et al. 1999) into account, 43% of patients had elevated uPA protein levels (>3 ng/mg protein) and 41% of patients had elevated PAI-1 protein levels (>14 ng/mg protein).
Fig. 2.

Correlations between uPA protein expression und uPA mRNA expression (r = 0.70) (a) and between PAI-1 protein expression und PAI-1 mRNA expression (r = 0.27) (b)
Taken together, we observed a highly significant concordance between protein expression determined by ELISA and mRNA expression measured by microarray-based analyses for HER2 and uPA (P < 0.001), but not for PAI-1 (Table 2). The same results could be obtained in different subsets of patients according to their hormone receptor status (ER and PR positive vs. ER and PR negative).
Table 2.
Correlation between protein and mRNA expression data (ELISA vs. RNA-based analysis)
| Number (n) | Correlation (r) | 95% Confidence-interval | P value | |
|---|---|---|---|---|
| HER2 | 133 | 0.67 | 0.56–0.76 | <0.001 |
| uPA | 133 | 0.70 | 0.53–0.81 | <0.001 |
| PAI-1 | 133 | 0.27 | 0.18–0.38 | 0.001 |
Validation of microarray-based RNA measurements by quantitative PCR
In order to validate results obtained from microarray analysis, we performed a quantitative PCR for uPA and PAI-1 in a subset of patients (n = 46). Strong correlations between RNA levels measured by both methods were found (r = 0.72 for uPA, P < 0.001 and r = 0.78 for PAI-1, P < 0.001).
mRNA expression and protein levels and their association with clinical and histomorphological parameters
The relation between mRNA expression and protein levels of the three markers and clinicopathological parameters including tumour size, nodal status, oestrogen and progesterone receptor status, age and grading were analysed in the cohort of 133 patients.
Regarding the RNA data, we found significant positive correlations between uPA and PAI-1 (r = 0.45, P < 0.001). In addition, we observed a negative correlation between oestrogen receptor and uPA (r = −0.37, P < 0.001) and PAI-1 (r = −0.38, P < 0.001), respectively. We also found a positive correlation between uPA mRNA and PAI protein levels (r = 0.33, P < 0.001) as well as a weak correlation between PAI-1 mRNA and uPA protein levels (r = 0.22, P = 0.01). A positive PR status (IHC) correlated inversely with PAI-1 mRNA levels (r = −0.3, P = 0.01). No additional correlations were found.
Disease free and overall survival analysis
Analyses were performed separately for mRNA and protein expression and for established clinicopathological parameters. mRNA values were divided into two groups as described earlier (see statistics).
After a median follow-up time of 88 months (range 8–169 months), 30% of the patients (34/117) had recurrent disease and 24% of the patients (30/126) had died.
Univariate analysis
A non-significant trend for shorter disease-free survival was observed for high PAI-1 mRNA expression (10-year disease-free survival (DFS) rates 60 vs. 70%, P = 0.071, Fig. 3a; Table 3).
Fig. 3.

Disease-free survival in patients with high and low PAI-1 mRNA levels (P = 0.071) (a). Overall survival in patients with high and low PAI-1 mRNA levels (P = 0.034) (b). q1–2: quartiles 1 to 2; q3–4: quartile 3 to 4
Table 3.
mRNA expression and protein levels in relation to disease-free survival in 133 patients (univariate analysis)
| Cut-off | Number of patients in each group above and below the cut-off | Number of events | 10-year-DFS-survival rate (percent) | P value | |
|---|---|---|---|---|---|
| Gene analysis | mRNA values | ||||
| uPA | 134 | 62 | 23 | 62 | 0.97 |
| 61 | 16 | 66 | |||
| PAI-1 | 76 | 64 | 21 | 60 | 0.071 |
| 59 | 17 | 70 | |||
| HER2 | 425 | 31 | 12 | 59 | 0.54 |
| 92 | 25 | 66 | |||
| Protein analysis | Protein values | ||||
| uPAa | 3 | 72 | 20 | 56 | 0.062 |
| 51 | 19 | 70 | |||
| PAI-1a | 14 | 72 | 19 | 54 | 0.006 |
| 51 | 19 | 71 | |||
| HER2a | 31 | 31 | 12 | 60 | 0.638 |
| 92 | 23 | 65 |
ang/mg protein
Bold value indicates P < 0.05
In addition, a significantly shorter overall survival could be demonstrated by univariate analysis for high PAI-1 mRNA expression (10-year overall survival (OS) rates 68 vs. 79%, P = 0.034, Fig. 3b; Table 4).
Table 4.
mRNA expression and protein levels in relation to overall survival in 133 patients (univariate analysis)
| mRNA | Cut-off | Number of patients in each group above and below the cut-off | Number of events | 10-year-OS-survival rate (percent) | P value |
|---|---|---|---|---|---|
| Gene analysis | mRNA values | ||||
| uPA | 134 | 64 | 15 | 73 | 0.71 |
| 62 | 13 | 74 | |||
| PAI-1 | 76 | 65 | 18 | 68 | 0.034 |
| 61 | 10 | 79 | |||
| HER2 | 425 | 32 | 5 | 84 | 0.59 |
| 94 | 23 | 70 | |||
| Protein analysis | Protein values | ||||
| uPAa | 3 | 54 | 11 | 65 | 0.177 |
| 72 | 9 | 82 | |||
| PAI-1a | 14 | 52 | 12 | 63 | 0.018 |
| 74 | 8 | 83 | |||
| HER2a | 31 | 31 | 4 | 83 | 0.428 |
| 95 | 23 | 70 |
ang/mg protein
Bold values indicate P < 0.05
For protein determinations, a shorter disease-free survival was observed in the univariate analysis for high PAI-1 levels (>14 ng/mg protein, 10-year DFS rates 54 vs. 71%, P = 0.006, Table 3). In addition, a shorter overall survival was observed for high PAI-1 levels (10-year OS rates 83 vs. 63%, P = 0.018, Table 4).
For uPA as well as HER2 mRNA and protein levels, we observed no prognostic impact on DFS and OS except a trend pointing to a shorter DFS in cases with high uPA protein levels (P = 0.062, Tables 3, 4).
Regarding clinicopathological parameters, tumour size (T1 + 2 vs. T3 + 4) correlated with shorter disease-free (10-year DFS rates 64 vs. 43%, P = 0.04) and overall survival (10-year OS rates 74 vs. 53%, P = 0.04, data not shown). Positive nodal status and high grading (G3) were of borderline significance for DFS (P = 0.08 for nodal status and P = 0.075 for grading) but not for OS (P > 0.10). The use of adjuvant hormone therapy correlated with longer overall survival (10-year OS-rate 78 vs. 60%, P = 0.045) but not with DFS (P > 0.05) and the use of adjuvant chemotherapy had no impact on DFS and OS (P > 0.05) in univariate analysis.
In the subgroup of patients who received no chemotherapy, the prognostic impact of PAI-1 was even stronger. Patients with high PAI-1 protein levels or high PAI-1 mRNA levels had a shorter disease-free survival (10-year DFS rate 41 vs. 79%, P = 0.01 for PAI-1 protein levels, 10-year DFS rate 44 vs. 74%, P = 0.03 for PAI-1 mRNA levels, Fig. 4a). A shorter overall survival in the group of patients with no adjuvant chemotherapy was only observed for high PAI-1 mRNA levels (10-year OS rate 41 vs. 79%, P = 0.004, Fig. 4b).
Fig. 4.

Disease-free (a) and overall survival (b) in the subgroup of patients with no chemotherapy with high and low PAI-1 mRNA levels. q1–2: quartiles 1 to 2; q3–4: quartile 3 to 4
Multivariate analysis
Only PAI-1 protein levels correlated with shorter disease-free survival (HR = 1.02, 95% CI 1.004–1.034, P = 0.014) and overall survival (HR = 1.02, 95% CI 1.0–1.04, P = 0.06) by multivariate analysis adjusted for age, nodal status, grading, ER status and PAI-1 mRNA-expression (not shown).
However, in the subgroup of patients with no adjuvant systemic treatment, only PAI-1 mRNA levels correlated with overall survival (HR 4.38, 95% CI 1.45–13.02, P = 0.009) by multivariate analysis adjusted for the same parameters (not shown).
Discussion
Our aim was to evaluate whether RNA-based analysis of established prognostic markers could provide clinically useful results comparable to protein determination. In the present study, we observed a significant correlation between protein and mRNA levels for HER2 and uPA but not for PAI-1.
Stratification of patients with breast cancer regarding adjuvant therapy is currently based on clinicopathological parameters. In the near future, multi-gene analyses may be added to the clinical routine once the results from large prospectively designed, randomized studies will be available. As soon as these new techniques enter clinical practice, it will be essential if relevant biomarkers like HER2, uPA and PAI-1 can be measured reliably in the same specimen. RNA analysis by microarray or multiplex PCR represents a promising approach to assess biological factors requiring very small amounts of tumour tissue and delivering quantitative estimates of the mRNA expression. In addition, establishment of RNA-based analysis also seems feasible from paraffin-embedded tissue sections (Ross et al. 2008).
Patients with tumours overexpressing HER2 are candidates for the treatment with anti-HER2 agents like trastuzumab and lapatinib (Di Cosimo and Baselga 2008). The selection of patients with HER2-overexpressing tumours for treatment is usually based on IHC combined with FISH for validation in cases with moderate expression (2+) by IHC (Birner et al. 2001; Wolff et al. 2007). Despite published standards, a relevant rate of discordance between IHC and FISH was found also in recent clinical trials (Perez et al. 2006). Thus, new HER2 tests like gene expression analyses might be useful. Several studies showed a good correlation between HER2 status measured by gene expression analysis and IHC or FISH. Schlemmer et al. (2004) found a strong correlation between RT-PCR, IHC and FISH for HER2 results in 112 patients without clinical follow-up. Berqvist et al. (2007) showed a good concordance between microarray-based RNA expression analysis and IHC for HER2 in 306 primary breast cancer tumours with a significant impact of HER2 levels measured by RNA on survival. Vinatzer et al. (2005) also observed a positive correlation between RT-PCR and IHC for HER2 in 136 tumours of 85 patients with breast cancer. HER2 overexpression determined by RT-PCR correlated with reduced disease-free survival (P < 0.003).
In our study, we also demonstrated a strong correlation between mRNA and protein levels for HER2, but we were not able to show a correlation of HER2 expression with survival which is in line with the current opinion that HER2 is not a strong prognostic factor. HER2 protein levels were determined by ELISA, currently not a standard diagnostic procedure in primary breast cancer tissue. The ELISA test used in our study is an FDA-approved method to monitor HER2 levels in the serum of women with metastatic breast cancer (Carney et al. 2003). Our group as well as others were able to demonstrate that this approach represents a useful method to determine quantitative HER2 levels in tumour tissue (Konecny et al. 2001; Mueller et al. 2003).
For uPA and PAI-1 protein determination, the measurement by ELISA is the standard method and has been validated in several studies demonstrating the clinical relevance of these proteins as prognostic factors (Harbeck et al. 1999, 2002; Jaenicke et al. 1993). These factors are already part of clinical practice recommendations and are further evaluated in the context of large studies particularly in patients with node-negative breast cancer (Annecke et al. 2008). The currently established uPA and PAI-1 measurement by ELISA requires a relatively large amount of fresh frozen tumour tissue. Measurement of mRNA expression offers the opportunity to determine multiple markers from limited tumour tissue specimens and should help to reduce the amount of tissue required (Castello et al. 2002, 2006). This is of clinical relevance since the average size of newly diagnosed tumours is decreasing with the improvements in early breast cancer detection.
We evaluated the protein and gene expression of uPA and PAI-1 by array analysis and ELISA and found a high concordance between mRNA levels and protein values for uPA, but not for PAI-1. Thus, our results show that PAI-1 antigen concentrations do not reflect the mRNA expression levels. This might be due to posttranscriptional regulation processes which were described for components of the plasminogen activation system (Nagamine et al. 2005). As we could show the same correlation coefficients for uPA, PAI-1 and HER2 consistently in different subsets of patients, we exclude that the weak correlation for PAI-1 is due to analytical problems directly related to the assay utilized. The lack of correlation between PAI-1 measured on mRNA and protein level was previously observed by Biermann et al. (2008) and Castelló et al. (2007), who similarly found no correlation for PAI-1 (r < 0.3) in a smaller group of 74 and 70 patients, respectively, with the same method of protein extraction for ELISA and RT-PCR for determination of mRNA values. In addition, Castelló et al. (2007) found no prognostic value of PAI-1 mRNA values in their patient cohort (50% node-positive) with a median follow-up time of 30 months.
Interestingly, in our patient cohort with a median follow-up time of 88 months PAI-1 mRNA levels as determined by microarray analysis were prognostic indicators by univariate analysis, similar to PAI-1 protein levels despite the weak correlation with PAI-1 protein levels. In the subgroup of patients with no chemotherapy, PAI-1 mRNA levels were even a better prognostic factor. In multivariate analysis, only high PAI-1 mRNA remained a significant indicator for shorter overall survival. This indicates that PAI-1 mRNA expression may give additional prognostic information and that the worse prognosis of patients with high PAI-1 mRNA levels might be overcome by chemotherapy reflecting also a predictive effect of PAI-1. Our results are in accordance with previous studies showing that PAI-1 mRNA had a stronger prognostic impact for metastasis-free-survival and breast cancer–specific survival than uPA in lymph node-positive patients receiving adjuvant treatment (n = 87) (Leissner et al. 2006). Sternlicht et al. (2006) also showed an association with shorter overall survival for high PAI-1 mRNA expression in two breast cancer data sets (van de Vijver cohort, n = 295, and University of California San Francisco (UCSF) cohort, n = 118). In the UCSF dataset, PAI-1 was prognostic in node-positive patients, in the van de Vijver dataset in node-negative patients. However, more studies with clinical follow-up data of the patients are necessary to verify the influence of PAI-1 mRNA expression on clinical outcome in patients with breast cancer.
The rate of elevated uPA and PAI-1 protein levels in our patient cohort was in the range of published studies (Harbeck et al. 1999) but almost 70% of the patients were node positive. This might be the explanation why uPA which was mainly evaluated as an important marker in node-negative breast cancer patients had no impact on patient outcome in our study.
Potential drawbacks of our study are that patients received adjuvant treatment not regarded as current standard. Trastuzumab, e.g., was not available during the collection time. Nevertheless, we were able to collect clinical follow-up data for all patients, in contrast to many published studies evaluating methods for determination of biological factors in breast cancer.
In conclusion, we found that prognostic and predictive markers like HER2 and uPA can be measured by RNA-based analyses in patients with breast cancer. We observed additional prognostic information for PAI-1 mRNA expression. Our findings indicate that gene expression analyses deliver high-quality determination of biological markers. With expression profiling now integrated into several ongoing multinational breast cancer adjuvant trials, attention to breast tumour PAI-1 mRNA levels, measured alone or as part of gene expression signature, will further enhance the prognostic and predictive value of this important biomarker.
Acknowledgments
We wish to thank S. Krenkel, K. Beck, T. Ropers and E. Veltrup for excellent technical assistance.
Conflict of interest statement
Ralph M. Wirtz and Claudia Roth are employees of Siemens Healthcare Diagnostics, Cologne, Germany. Volkmar Mueller has received unrestricted research support from Siemens Healthcare Diagnostics, Cologne, Germany. According to all authors, there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
References
- Annecke K, Schmitt M, Euler U, Zerm M, Paepke D, Paepke S, von Minckwitz G, Thomssen C, Harbeck N (2008) uPA and PAI-1 in breast cancer: review of their clinical utility and current validation in the prospective NNBC-3 trial. Adv Clin Chem 45:31–45 [DOI] [PubMed] [Google Scholar]
- Bergqvist J, Ohd JF, Smeds J, Klaar S, Isola J, Nordgren H, Elmberger GP, Hellborg H, Bjohle J, Borg AL, Skoog L, Bergh J (2007) Quantitative real-time PCR analysis and microarray-based RNA expression of HER2 in relation to outcome. Ann Oncol 18:845–850 [DOI] [PubMed] [Google Scholar]
- Biermann JC, Holzscheiter L, Kotzsch M, Luther T, Kiechle-Bahat M, Sweep FC, Span PN, Schmitt M, Magdolen V (2008) Quantitative RT-PCR assays for the determination of urokinase-type plasminogen activator and plasminogen activator inhibitor type 1 mRNA in primary tumor tissue of breast cancer patients: comparison to antigen quantification by ELISA. Int J Mol Med 21:251–259 [PubMed] [Google Scholar]
- Birner P, Oberhuber G, Stani J, Reithofer C, Samonigg H, Hausmaninger H, Kubista E, Kwasny W, Kandioler-Eckersberger D, Gnant M, Jakesz R (2001) Evaluation of the United States Food and Drug Administration-approved scoring and test system of HER-2 protein expression in breast cancer. Clin Cancer Res 7:1669–1675 [PubMed] [Google Scholar]
- Bogaerts J, Cardoso F, Buyse M, Braga S, Loi S, Harrison JA, Bines J, Mook S, Decker N, Ravdin P, Therasse P, Rutgers E, van’t Veer LJ, Piccart M (2006) Gene signature evaluation as a prognostic tool: challenges in the design of the MINDACT trial. Nat Clin Pract Oncol 3:540–551 [DOI] [PubMed] [Google Scholar]
- Carney WP, Neumann R, Lipton A, Leitzel K, Ali S, Price CP (2003) Potential clinical utility of serum HER-2/neu oncoprotein concentrations in patients with breast cancer. Clin Chem 49:1579–1598 [DOI] [PubMed] [Google Scholar]
- Castello R, Estelles A, Vazquez C, Falco C, Espana F, Almenar SM, Fuster C, Aznar J (2002) Quantitative real-time reverse transcription-PCR assay for urokinase plasminogen activator, plasminogen activator inhibitor type 1, and tissue metalloproteinase inhibitor type 1 gene expressions in primary breast cancer. Clin Chem 48:1288–1295 [PubMed] [Google Scholar]
- Castello R, Espana F, Vazquez C, Fuster C, Almenar SM, Aznar J, Estelles A (2006) Plasminogen activator inhibitor-1 4G/5G polymorphism in breast cancer patients and its association with tissue PAI-1 levels and tumor severity. Thromb Res 117:487–492 [DOI] [PubMed] [Google Scholar]
- Castello R, Landete JM, Espana F, Vazquez C, Fuster C, Almenar SM, Ramon LA, Radtke KP, Estelles A (2007) Expression of plasminogen activator inhibitors type 1 and type 3 and urokinase plasminogen activator protein and mRNA in breast cancer. Thromb Res 120:753–762 [DOI] [PubMed] [Google Scholar]
- Di Cosimo S, Baselga J (2008) Targeted therapies in breast cancer: where are we now? Eur J Cancer 44:2781–2790 [DOI] [PubMed] [Google Scholar]
- Dowsett M, Dunbier AK (2008) Emerging biomarkers and new understanding of traditional markers in personalized therapy for breast cancer. Clin Cancer Res 14:8019–8026 [DOI] [PubMed] [Google Scholar]
- Esteva FJ, Sahin AA, Cristofanilli M, Coombes K, Lee SJ, Baker J, Cronin M, Walker M, Watson D, Shak S, Hortobagyi GN (2005) Prognostic role of a multigene reverse transcriptase-PCR assay in patients with node-negative breast cancer not receiving adjuvant systemic therapy. Clin Cancer Res 11:3315–3319 [DOI] [PubMed] [Google Scholar]
- Gjerdrum LM, Sorensen BS, Kjeldsen E, Sorensen FB, Nexo E, Hamilton-Dutoit S (2004) Real-time quantitative PCR of microdissected paraffin-embedded breast carcinoma: an alternative method for HER-2/neu analysis. J Mol Diagn 6:42–51 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harbeck N, Thomssen C, Berger U, Ulm K, Kates RE, Hofler H, Jaenicke F, Graeff H, Schmitt M (1999) Invasion marker PAI-1 remains a strong prognostic factor after long-term follow-up both for primary breast cancer and following first relapse. Breast Cancer Res Treat 54:147–157 [DOI] [PubMed] [Google Scholar]
- Harbeck N, Kates RE, Look MP, Meijer-Van Gelder ME, Klijn JG, Kruger A, Kiechle M, Jaenicke F, Schmitt M, Foekens JA (2002) Enhanced benefit from adjuvant chemotherapy in breast cancer patients classified high-risk according to urokinase-type plasminogen activator (uPA) and plasminogen activator inhibitor type 1 (n = 3424). Cancer Res 62:4617–4622 [PubMed] [Google Scholar]
- Jaenicke F, Schmitt M, Pache L, Ulm K, Harbeck N, Hofler H, Graeff H (1993) Urokinase (uPA) and its inhibitor PAI-1 are strong and independent prognostic factors in node-negative breast cancer. Breast Cancer Res Treat 24:195–208 [DOI] [PubMed] [Google Scholar]
- Konecny G, Untch M, Arboleda J, Wilson C, Kahlert S, Boettcher B, Felber M, Beryt M, Lude S, Hepp H, Slamon D, Pegram M (2001) Her-2/neu and urokinase-type plasminogen activator and its inhibitor in breast cancer. Clin Cancer Res 7:2448–2457 [PubMed] [Google Scholar]
- Leissner P, Verjat T, Bachelot T, Paye M, Krause A, Puisieux A, Mougin B (2006) Prognostic significance of urokinase plasminogen activator and plasminogen activator inhibitor-1 mRNA expression in lymph node- and hormone receptor-positive breast cancer. BMC Cancer 6:216 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mueller V, Thomssen C, Karakas C, Eustermann I, Ramirez Porras J, Coith C, Berger J, Loning T, Jaenicke F, Pantel K (2003) Quantitative assessment of HER-2/neu protein concentration in breast cancer by enzyme-linked immunosorbent assay. Int J Biol Markers 18:13–20 [DOI] [PubMed] [Google Scholar]
- Mueller V, Witzel I, Lück H, Köhler G, vMinckwitz G, Möbus V, Sattler D, Löning T, Wilczak W, Jaenicke F, Pantel K, Thomssen C (2004) Prognostic and predictive impact of the HER-2/neu extracellular domain (ECD) in the serum of patients treated with chemotherapy for metastatic breast cancer. Breast Cancer Res Treat 86:9–18 [DOI] [PubMed] [Google Scholar]
- Nagamine Y, Medcalf RL, Munoz-Canoves P (2005) Transcriptional and posttranscriptional regulation of the plasminogen activator system. Thromb Haemost 93:661–675 [DOI] [PubMed] [Google Scholar]
- Paik S, Shak S, Tang G, Kim C, Baker J, Cronin M, Baehner FL, Walker MG, Watson D, Park T, Hiller W, Fisher ER, Wickerham DL, Bryant J, Wolmark N (2004) A multigene assay to predict recurrence of tamoxifen-treated, node-negative breast cancer. N Engl J Med 351:2817–2826 [DOI] [PubMed] [Google Scholar]
- Perez EA, Suman VJ, Davidson NE, Martino S, Kaufman PA, Lingle WL, Flynn PJ, Ingle JN, Visscher D, Jenkins RB (2006) HER2 testing by local, central, and reference laboratories in specimens from the North Central Cancer Treatment Group N9831 intergroup adjuvant trial. J Clin Oncol 24:3032–3038 [DOI] [PubMed] [Google Scholar]
- Ross JS, Hatzis C, Symmans WF, Pusztai L, Hortobagyi GN (2008) Commercialized multigene predictors of clinical outcome for breast cancer. Oncologist 13:477–493 [DOI] [PubMed] [Google Scholar]
- Schlemmer BO, Sorensen BS, Overgaard J, Olsen KE, Gjerdrum LM, Nexo E (2004) Quantitative PCR—new diagnostic tool for quantifying specific mRNA and DNA molecules: HER2/neu DNA quantification with LightCycler real-time PCR in comparison with immunohistochemistry and fluorescence in situ hybridization. Scand J Clin Lab Invest 64:511–522 [DOI] [PubMed] [Google Scholar]
- Spyratos F, Bouchet C, Tozlu S, Labroquere M, Vignaud S, Becette V, Lidereau R, Bieche I (2002) Prognostic value of uPA, PAI-1 and PAI-2 mRNA expression in primary breast cancer. Anticancer Res 22:2997–3003 [PubMed] [Google Scholar]
- Sternlicht MD, Dunning AM, Moore DH, Pharoah PD, Ginzinger DG, Chin K, Gray JW, Waldman FM, Ponder BA, Werb Z (2006) Prognostic value of PAI1 in invasive breast cancer: evidence that tumor-specific factors are more important than genetic variation in regulating PAI1 expression. Cancer Epidemiol Biomarkers Prev 15:2107–2114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- van’t Veer LJ, Paik S, Hayes DF (2005) Gene expression profiling of breast cancer: a new tumor marker. J Clin Oncol 23:1631–1635 [DOI] [PubMed] [Google Scholar]
- Vinatzer U, Dampier B, Streubel B, Pacher M, Seewald MJ, Stratowa C, Kaserer K, Schreiber M (2005) Expression of HER2 and the coamplified genes GRB7 and MLN64 in human breast cancer: quantitative real-time reverse transcription-PCR as a diagnostic alternative to immunohistochemistry and fluorescence in situ hybridization. Clin Cancer Res 11:8348–8357 [DOI] [PubMed] [Google Scholar]
- Wolff AC, Hammond ME, Schwartz JN, Hagerty KL, Allred DC, Cote RJ, Dowsett M, Fitzgibbons PL, Hanna WM, Langer A, McShane LM, Paik S, Pegram MD, Perez EA, Press MF, Rhodes A, Sturgeon C, Taube SE, Tubbs R, Vance GH, van de Vijver M, Wheeler TM, Hayes DF (2007) American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer. J Clin Oncol 25:118–145 [DOI] [PubMed] [Google Scholar]

