Abstract
Purpose
Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is one of the most frequently mutated human tumor suppressor genes. The present study aims to investigate the role of PTEN mutation in breast carcinogenesis by analyzing PTEN mutation spectrum and the protein expression in breast cancers, adjacent hyperplastic lesions, benign breast lesions and normal breast tissues.
Methods
All 9 exons of PTEN gene were amplified by PCR with DNA extracted from 50 of human breast cancers and corresponding adjacent breast hyperplasia tissues, adjacent normal breast tissues, as well as 50 breast benign lesions residing in or around Yunnan, China, respectively. PCR products were then sequenced for mutation screening. And we also proved the effect of mutations on the expression of PTEN protein by immunohistochemistry.
Results
PTEN mutations were detected in 11 of 50 (22%) breast cancers and 4 of 50 (8%) adjacent ductal hyperplasia, all of which were atypical ductal hyperplasia and same PTEN mutation were detected in the corresponding cancer tissues. No PTEN mutation was detected in all adjacent normal breast tissues and 50 cases of breast benign lesions. The mutation sites concentrated at exon 3, 4, 5 and 7; no mutation was detected in exon 1, 2, 6, 8, or 9 and splicing sites of all introns. The hottest mutation spots were exon 5 with missense mutations. Immunohistochemical analysis showed that 24 of 50 (48%) breast cancers and 6 of 50 (12%) adjacent breast hyperplasia demonstrated negative immuno-staining of PTEN (loss of PTEN protein expression). All the 4 adjacent breast tissues harbored PTEN mutations and 9 of 11 breast cancers with PTEN mutation were loss of PTEN expression. Statistical analysis revealed that PTEN gene mutations were correlated with the PTEN expression.
Conclusions
The incidence of PTEN mutations is relatively high in patients with sporadic breast cancer in the region of Yunnan, China and exists at the early stage of breast cancer development. The PTEN mutations have significant effect on the expression silencing of PTEN protein indicating the important role of PTEN mutation in carcinogenesis of breast cancers.
Keywords: PTEN, Tumor suppressor gene, Mutation, Breast cancer, Mammary hyperplasia
Introduction
The tumor suppressor gene phosphatase and tensin homolog deleted on chromosome 10 (PTEN), which maps to 10q23.3 and encodes a 403 amino acid dual specificity phosphatase (protein tyrosine phosphatase), was shown to play a broad role in human malignancy (Li et al. 1997; Steck et al. 1997). Somatic PTEN deletions and mutations were observed in sporadic breast, brain, prostate and kidney cancer cell lines and in several primary tumors such as endometrial carcinomas, malignant melanoma and thyroid tumors (Ali et al. 1999; Alimov et al. 1999; Bruckheimer et al. 1999; Davies et al. 1999; Tate et al. 2007; Yoshimoto et al. 2007).
However, the effect of PTEN mutation in the genesis of breast cancer is controversial. Germ-line PTEN mutations, including missense mutation, nonsense mutation, base deletion and insertion in 81% of patients with Cowden syndrome (associated with a high risk of breast cancers) (Marsh et al. 1998), however, few PTEN mutations were detected, in primary breast cancers as reported by Rhei et al. (1997) and Guenard et al. (2007). Hence, it remains unclear whether PTEN mutation relates to the genesis of breast cancers. The present study aims to detect mutations of all PTEN exons and the splicing sites of all introns by DNA sequencing technique in breast cancers, adjacent hyperplastic lesions, benign breast proliferative lesions and normal breast tissues and examine the expression of PTEN by immunohistochemistry whereby to locate the mutational hot spots and mutation spectrum of PTEN in carcinogenesis and investigate the relations between PTEN mutation and carcinogenesis of breast cancers.
Materials and methods
Specimens collection
Fifty of breast cancerous tissues, adjacent hyperplastic breast lesions (with 2 cm distance from tumor margin), and adjacent normal breast tissues (with 5 cm distance from tumor margin) were collected from females (mean age 46.8, ranged 26–71) suffered from breast cancers and underwent radical mastectomy. Furthermore, 50 of benign breast disease tissues were obtained from patients who had undergone benign mastopathy. All the specimens were divided into two parts: one part was stored at −80°C for genomic DNA extraction and the other was fixed in 40 g/L buffered formalin and embedded in paraffin for histopathology. Histopathological examination of breast cancerous tissues demonstrated that there were 45 cases of invasive ductal carcinomas, 1 case of ductal carcinoma in situ and 4 cases of invasive lobular carcinomas in the 50 of breast cancer samples (clinical data was shown in Table 4). Thirty-three out of 50 adjacent breast tissues were atypical hyperplasia and the rest were ductal hyperplasia. No treatment was performed before surgery, and none of patients claimed familial breast cancer history. Among 50 human breast benign samples (mean age 34.8, ranged 16–54), 36 were breast fibro-adenoma and 14 were breast adenosis.
Table 4.
Comparison between mutations of human PTEN gene and clinical data
| Item | Case | Mutations | Mutation rate (%) | χ2 value | P value |
|---|---|---|---|---|---|
| Age | |||||
| ≤45 ages | 19 | 4 | 21.05 | 0.016 | 0.899 |
| >45 ages | 31 | 7 | 22.58 | ||
| Histological type | |||||
| Invasive ductal carcinoma | 45 | 11 | 24.44 | 1.567 | 0.457 |
| Invasive lobular carcinoma | 4 | 0 | 0 | ||
| Ductal carcinoma in situ | 1 | 0 | 0 | ||
| Tumor size | |||||
| ≤2 cm | 13 | 4 | 30.77 | 0.787 | 0.375 |
| >2 cm | 37 | 7 | 18.92 | ||
| Histological grade | |||||
| Grade I | 11 | 2 | 18.18 | 3.351 | 0.187 |
| Grade II | 25 | 8 | 32 | ||
| Grade III | 14 | 1 | 7.14 | ||
| Clinical stage | |||||
| Stage 0 | 1 | 0 | 0 | 0.306 | 0.959 |
| Stage I | 9 | 2 | 22.22 | ||
| Stage II | 23 | 5 | 21.74 | ||
| Stage III | 17 | 4 | 23.53 | ||
| Axillary lymph node | |||||
| Positive | 22 | 6 | 27.27 | 0.636 | 0.425 |
| Negative | 28 | 5 | 17.86 | ||
| ER expression | |||||
| − | 15 | 4 | 26.67 | 0.272 | 0.602 |
| + | 35 | 7 | 20 | ||
| PR expression | |||||
| − | 17 | 6 | 35.29 | 2.653 | 0.103 |
| + | 33 | 5 | 15.15 | ||
| HER2 amplification | |||||
| Amplified | 13 | 2 | 15.38 | 0.448 | 0.503 |
| Non-amplified | 37 | 9 | 24.32 | ||
The genomic DNA extraction
Genomic DNA was extracted from 20 milligrams (mg) of each breast cancer tissue, adjacent breast tissue, benign breast tissue, or adjacent normal tissue using standard phenol/chloroform kit (DNA Isolation Kit, Gentra Company, Minneapolis, MN, USA). DNA concentration and purity were determined by SmartSpecTMPlus, and then stored at −20°C until further analysis.
PCR amplification
The primers for all nine exons of PTEN, which covered the whole sequence of the associated exons and part of the introns in 5′ end and 3′ end, were designed and synthesized according to the PTEN DNA sequence [Genebank: AF067844] (Table 1).
Table 1.
Primer sequence for PTEN exons
| Target fragment | Primer | Sequences | Product length (bp) | Annealing temperature (°C) |
|---|---|---|---|---|
| Exon 1 | Sense | 5′CAGAAGAAGCCCCGCCACCA3′ | 177 | 53.0 |
| Antisense | 3′GTAAAGACGCCGACGAGGAGA5′ | |||
| Exon 2 | Sense | 5′TTTCAGATATTTCTTTCCTTA3′ | 117 | 50.4 |
| Antisense | 3′AACTACAAAATATAAGAACAA5′ | |||
| Exon 3 | Sense | 5′GCTCATTTTTGTTAATGGTGGC3′ | 244 | 48.2 |
| Antisense | 3′ATTCAGTTCTTCAGGTTCTCGT5′ | |||
| Exon 4 | Sense | 5′GGAAGCACCTGAATTTACAG3′ | 642 | 58.5 |
| Antisense | 3′AACTCCGTCAACCAGATTAT5′ | |||
| Exon 5 | Sense | 5′GCATTGAGAGTCCTGACG3′ | 339 | 53.0 |
| Antisense | 3′ATAAGAGGGGGGTCCCAC5′ | |||
| Exon 6 | Sense | 5′TACGACCCAGTTACCATAGCAA3′ | 403 | 53.0 |
| Antisense | 3′GAAACAACAAGTTGAGTAACCC5′ | |||
| Exon 7 | Sense | 5′GATTGCAGATACAGAATCCA3′ | 263 | 53.0 |
| Antisense | 3′GAATGAGACCGTAACCACTC5′ | |||
| Exon 8 | Sense | 5′GAAAATGCAACAGATAACTCAG3′ | 558 | 53.0 |
| Antisense | 3′CCCAACCACTGAACATACATAC5′ | |||
| Exon 9 | Sense | 5′AAGGCCTCTTAAAAGATCATG3′ | 376 | 53.0 |
| Antisense | 3′CTCCCTATTTTGTGGTACTTTT5′ |
Each 25 μL PCR reaction mixture contained 10× PCR buffer (containing 20 mmol/L MgCl2) 2.5 μL, 10 mmol/L dNTP 2 μL, 10 μmol/L primer 1.25 μL for each, 5 U/μL Taq polymerase 0.5 μL, DNA template 2 μL and sterile deionized water 15.5 μL. The condition for PCR reaction was: predenatured at 95°C for 5 min, then denatured at 95°C for 30 s, annealed for 45 s (annealing temperatures for each primer were shown in Table 1), extension at 72°C for 10–40 s, amplification for 30 cycles and extension at 72°C for 10 min.
DNA sequence
All PCR products were confirmed by running 1.5% agarose gel electrophoresis for expected sizes and recovered with DNA purification kit (Bioteke, Beijing, China). Purified PCR products were sequenced with upstream or downstream primers (Table 1) by ABI3730XL DNA sequencer. Sequences obtained were aligned with nucleic acids and amino acid sequence of normal human PTEN by using AlignX software (Vector NTI Suite).
Immunohistochemical staining
Paraffin-embedded tissues were subjected to immunohistochemical staining. EnVision Systems was adopted for the staining. Briefly, 4 μm deparaffinized sections were pre-treated with heat-induced epitope retrieval and then treated with 30 mL/L hydrogen peroxidase in methanol for 30 min to block endogenous peroxidase activity. The sections were further blocked with 10 mL/L normal goat serum for 30 min, followed by incubation with primary antibody (monoclonal mouse anti-PTEN antibody, 1:50, Gene Tech (Shanghai) Company Limited, Shanghai, China; monoclonal mouse anti-ER and PR antibody, 1:50, Maixin-Bio, Fuzhou, China) at 4°C overnight. The sections were then washed in 0.01 mol/L phosphate buffer solutions (PBS, pH 7.2) and sequentially incubated with Envision (Envision kit, DakoCytomation Inc., Carpinteria, CA, USA) for 30 min. The reaction product was visualized by diaminobenzidine tetrahydrochloride (DAB). All slides were counterstained with hematoxylin, dehydrated and mounted. PBS substituting for the primary antibody was used as the negative control. The positive staining of PTEN, ER and PR should all be localized in the nucleus. At least 500 cells were counted in high-staining density area in every component on every slide. The staining intensity and proportion of positive cells for PTEN were used to semi-quantitative estimation for the breast cancers, adjacent hyperplastic lesions, adjacent normal breast tissues and benign breast disease tissues. On the basis of criteria used by similar publications (Wang et al. 2003; Bouras et al. 2001), we prospectively chose 10% as a cutoff for positive-staining cells and used a subjective scale to classify staining patterns, as follows: (1) −, no staining; (2) +, weak staining; (3) ++, moderate staining; and (4) +++, intense staining. Specimens more than 10% of cells showed positive immunoreactivity were considered to be immunoreactive for ER and PR.
Fluorescence in situ hybridization
A HER2/neu probe kit (China Medical Technologies Inc., Beijing, China) was used for fluorescence in situ hybridization (FISH) analysis. Tissue sections were baked overnight at 56°C, dewaxed in xylene, dehydrated and air-dried. The slides were then pre-treated with sodium bisulfite at 50°C for 30 min and digested with protease K for 15 min at 37°C and finally hybridized overnight at 42°C with the probes (GLP HER2/CSP17 DNA probe, China Medical Technologies Inc., Beijing, China) after DNA denaturation at 73°C. Slides were washed with post-hybridization buffer at 73°C, counterstained with 4,6-diamidino-2-phenylindole (DAPI) and mounted and stored in the dark prior to signal enumeration. For FISH analysis, slides were examined with fluorescence microscope. Areas of optimal tissue digestion and no overlapping nuclei were then selected in each core for counting. 30 cells were counted for each case. We considered cases with a FISH ratio (HER2 gene signals to chromosome 17 signals) of ≥2.2 as HER2 amplified.
Statistical analysis
The statistical analysis was performed using the SPSS software package, version 11.0. The differences were analyzed by chi-squared distribution (χ2) and Fisher’s exact test. A value of P < 0.05 was considered statistically significant.
Results
All nine exons of PTEN gene were amplified successfully from breast cancers, adjacent hyperplastic lesions, benign breast proliferative lesions and normal breast tissues by our designed primers. Each PCR product was confirmed with expected sizes in agarose gel electrophoresis with fragments of 177, 117, 244, 642, 339, 403, 263, 558 and 376 bp, respectively (Fig. 1).
Fig. 1.
PTEN gene amplification. Bands from left to right exon 1–9: exon 1 (177 bp), exon 2 (117 bp), exon 3 (244 bp), exon 4 (642 bp), exon 5 (339 bp), exon 6 (403 bp), exon 7 (263 bp), exon 8 (558 bp), exon 9 (376 bp)
The DNA sequencing showed that exon mutations of PTEN gene happened in 22% (11/50) of breast cancers and 8% (4/50) of adjacent hyperplasia tissues. All of four adjacent hyperplasia tissues with PTEN mutations were atypical ductal hyperplasia, and same mutations were founded in their paired cancer tissues (Table 2). No mutation was detected in all 50 cases of adjacent normal breast tissues and all samples of breast benign diseases.
Table 2.
PTEN mutation in breast cancers and corresponding adjacent tissues
| Breast cancers | Adjacent hyperplasia tissues | Adjacent normal tissues | |||||
|---|---|---|---|---|---|---|---|
| Mutation | Expression | Mutation | Expression | Histological type | Mutation | Expression | |
| 053107 | + | − | − | + | ADH | − | ++ |
| 053497 | + | − | + | − | ADH | − | + |
| 063873 | + | − | − | + | ADH | − | ++ |
| 060165 | + | + | − | + | ADH | − | +++ |
| 053696 | + | + | − | ++ | UDH | − | ++ |
| 052888 | + | − | − | + | ADH | − | ++ |
| 053383 | + | − | + | − | ADH | − | ++ |
| 051721 | + | − | − | + | UDH | − | +++ |
| 053280 | + | − | + | − | ADH | − | ++ |
| 053417 | + | − | + | − | ADH | − | ++ |
| 054194 | + | − | − | + | ADH | − | +++ |
PTEN mutations were located in exon 3, 4, 5, or 7, no mutation was detected in exon 1, 2, 6, 8, 9 and any of the splicing sites of introns. Among the 11 cases with mutations, 10 cases showed single exon mutation (3 cases in exon 3, 2 cases in exon 4, 4 cases in exon 5, 1 case in exon 7), while only one case showed both exon 3 and 5 mutations (Table 3; Fig. 2).
Table 3.
PTEN mutation spectra in breast cancer and adjacent hyperplasia tissues
| Patients | Source | Exon | Mutation | Type | PTEN expression |
|---|---|---|---|---|---|
| Breast cancers | |||||
| 053107 | IBC | Exon 3 | c.179delA → p.K60SfsX98 | FS | − |
| 053497 | IBC | Exon 3 | c.179delA → p.K60SfsX98 | FS | − |
| 063873 | IBC | Exon 3 | c.179delA → p.K60SfsX98 | FS | − |
| Exon 5 | c.478A>T → p.T160S | MS | |||
| 060165 | IBC | Exon 3 | c.165G>T → p.R55S | MS | + |
| 053696 | IBC | Exon 4 | c.216T>C | SS | + |
| 052888 | IBC | Exon 4 | c.221delG → p.R74NfsX98 | FS | − |
| 053383 | IBC | Exon 5 | c.377C>A → p.N126H | MS | − |
| 051721 | IBC | Exon 5 | c.389G>A → p.R130Q | MS | − |
| 053280 | IBC | Exon 5 | c.482G>T → p.R161K | MS | − |
| 053417 | IBC | Exon 5 | c.482G>A → p.R161K | MS | − |
| 054194 | IBC | Exon 7 | c.766G>A → p.E256K | MS | − |
| Corresponding adjacent breast hyperplasia tissues | |||||
| 053497 | ADH | Exon 3 | c.179delA → p.K60SfsX98 | FS | − |
| 053383 | ADH | Exon 5 | c.377C>A → p.N126H | MS | − |
| 053280 | ADH | Exon 5 | c.482G>A → p.R161K | MS | − |
| 053417 | ADH | Exon 5 | c.482G>T → p.R161K | MS | − |
Fig. 2.
Sequencing results of PTEN gene mutation in breast cancer. Top PTEN exon 3 mutation (c.179delA). Bottom PTEN exon 5 mutation (c.389G>A)
In our data, all PTEN mutations were single base mutation. Base 482 of exon 5 site had highest mutation rates among all of the detected mutations, which were detected in 4 cases of breast tissues (2 cases detected in breast cancers and 2 in adjacent atypical hyperplasia tissue). Base 179 of exon 3 also had higher mutational rate where three cases mutations of breast cancers were detected (Table 3).
To investigate the effect of mutations on PTEN protein level we then analyzed the expression of PTEN by immunohistochemistry. 24 of 50 (48%) breast cancers and 6 of 50 (12%) adjacent breast hyperplasia demonstrated negative immuno-staining of PTEN (loss of PTEN protein expression). All the 4 adjacent breast tissues harbored PTEN mutations and 9 of 11 breast cancers with PTEN mutation were loss of PTEN expression (Table 3; Fig. 3). Furthermore, by semi-quantitative estimation of PTEN expression, the rest two breast cancers with PTEN mutation were PTEN weak stained. Statistical analysis revealed that PTEN gene mutations were correlated with the PTEN expression (P < 0.05). All 50 adjacent normal breast tissues and 49 of 50 benign breast tissues demonstrated PTEN protein positive expression, which proved there was almost no loss of PTEN expression in these tissues.
Fig. 3.
Immunohistochemical staining and FISH. Top left positive expression of PTEN in benign breast lesion; top right positive expression of PTEN in invasive ductal carcinoma; bottom left negative expression of PTEN in invasive ductal carcinoma; bottom right HER2 non-amplification in invasive ductal carcinoma
The relationship between PTEN gene mutations and clinic-pathological features of breast cancer is also listed in Table 4. The results revealed that PTEN gene mutations were neither correlated with patient ages, histological types, tumor sizes, histological grades, clinical stages or axillary lymph node metastases, nor with the condition of hormone receptors (ER, PR) expression and HER2 amplification (Table 4; Fig. 3).
Discussion
To date, the PTEN is the first tumor suppressor gene discovered with dual specific lipid and protein phosphatase activity and is the most frequently mutated human tumor suppressor gene found after the discovery of p53 (Bonneau and Longy 2000). PTEN negatively controls the phosphoinositide 3-kinase/AKT signaling pathway. The intracellular PI3K/PTEN/PKB/Akt signal transduction pathway is abnormal when the expression of PTEN protein is depleted or absent due to PTEN mutation, followed by PI3K/Akt activation and disturbance of cellular metabolism, proliferation and differentiation, finally causing malignant transformation (Chung et al. 2004; Lu et al. 2003).
Moreover, high-PTEN mutation rates exist in numerous tumor cell lines and primary tumor tissues such as glioblastoma, endometrial carcinoma, prostate cancer, renal carcinoma and small cell lung cancer (Ali et al. 1999; Alimov et al. 1999; Bruckheimer et al. 1999; Davies et al. 1999; Tate et al. 2007; Yoshimoto et al. 2007). Somatic PTEN mutations are more particularly involved in two types of human cancers: endometrial carcinomas and glioblastomas. In most cases, these somatic mutations result in protein inactivation and, as with germ-line mutations, recurrent somatic mutations are found in CpG dinucleotides. A mutagenesis by insertion–deletion in repetitive elements is, however, specifically observed in endometrial carcinomas (Bonneau and Longy 2000).
The previous studies have demonstrated that inactivation of PTEN closely related to the poor prognosis of breast cancers (Zhu et al. 2007). There was loss of PTEN expression in 32–48% of breast cancers (Chung et al. 2004; Depowski et al. 2001; Bose et al. 2002; Perren et al. 1999). Loss of PTEN expression was associated with lymph node metastasis, loss of estrogen receptor staining (P = 0.03), but did not correlate with tumor size, tumor grade, MVD, recurrence stage, or loss of progesterone receptor (Chung et al. 2004; Depowski et al. 2001).
The highest mutation rate of PTEN germ-line was 81 and 57%, respectively, in the population of Cowden disease and Bannayan–Riley–Ruvalcaba syndrome (Marsh et al. 1998). Germ-line mutation of PTEN occurs in exons 2–8, is highest in exon 5, and seldom occurs in exon 1 and 9 (Bonneau and Longy 2000). Cowden syndrome is an autosomal dominant genodermatosis, characterized by the presence of multiple hamartomas in the skin, breast, thyroid, gastrointestinal tract, central nervous system, and an increased risk in developing breast carcinomas. The patients with Cowden syndrome and PTEN mutation have more risk in developing breast carcinomas (Marsh et al. 1998; Bussaglia et al. 2002).
Although Cowden disease, a breast cancer susceptible syndrome, has high frequency of PTEN germ-line mutation (Marsh et al. 1998; Bussaglia et al. 2002), such mutation rate was not so high in sporadic breast cancer as some studies (Rhei et al. 1997; Guenard et al. 2007). So, the relationship between PTEN mutation and carcinogenesis of breast cancer remains unclear.
In order to investigate the role of PTEN mutation on sporadic breast carcinogenesis, we analyzed the mutation of all 1–9 exons and splicing sites of PTEN in 50 cases of breast cancer from Yunnan region of China and compared with that of adjacent hyperplasia lesions, adjacent normal breast tissues and non-adjacent benign breast hyperplastic lesions.
Because the coding region of PTEN shares over 98% homology with PTEN pseudogene which localized in 9p21, it may lead to misinterpretation when performing mutation analyses based on cDNA templates. In our experiment, we used primers covering the whole sequence of the associated exons and part of the introns in 5′ end and 3′ end which amplified the regions specific to PTEN and not homologous to the pseudogene. The results showed that there existed PTEN mutations in breast cancer and atypical ductal hyperplasia tissues, but not in normal breast tissues and breast benign samples. The mutations were identified in 11 of 50 breast cancer (22%) and 4 of 50 adjacent atypical ductal hyperplasia tissues (8%), respectively. The overall mutation frequency we detected in sporadic breast cancers was lower than that with inherited breast cancers which was in accordance with the previous results. Our results were also higher than other reported mutation frequency after screening of PTEN gene in sporadic breast cancers. The most reasonable explanation may lie on the region and race differentiation.
The mutation sites concentrated at exon 3, 4, 5 and 7; no mutation was detected in exon 1, 2, 6, 8, or 9 and splicing sites of all introns. The hot mutation spot was exon 5 with missense mutations as is the case in other tumor types. Among all of the detected mutations, base 179 of exon 3 and base 482 of exon 5 sites had highest mutation rates. For base 179 mutations all three cases were frameshift mutations. The shifting of reading frame resulted in the amino acid changes at the polypeptide chain and early appearance of termination codon which in turn produced a truncated protein with 98 amino acids, which led to the loss of dual specific phosphatase catalytic domain located at amino-end phosphatase region. As a result, the PTEN lost its normal protein function and tumor suppressive activity (Lee et al. 1999; Yaginuma et al. 2000). For base 482, all the four mutational cases were missense mutations with the substitution of arginine for lysine where the encoding amino acid was probably important for stabilizing the tertiary structure of the protein. We also found two mutations (base 377 and 389) located in the phosphatase core motif where high-mutational frequencies were detected in various tumors. Base 389 is also among the dinucleotide CpG. The mutation resulted in the change of arginine to glutamic acid. This is consistent with the observation that frequent C to T (or G to A) transition occurs at a much higher rate in methylated CpG dinucleotide than in unmethylated bases.
To prove if the mutations can produce alterations in the expression of PTEN, we then detected the expression of PTEN protein in all tested samples by immunohistochemistry. 24 of 50 breast cancer tissues (48%), 4 of 50 adjacent hyperplasia tissues (8%), 1 of 50 benign breast tissues demonstrated loss of expression of PTEN protein. 9 of 11 of breast cancer tissues and all the 4 cases of adjacent breast atypical ductal hyperplasia tissues with PTEN mutations were found to lose PTEN protein expression. Statistical analysis revealed that PTEN gene mutations were correlated with the PTEN expression (P < 0.05). Considering our study we conclude that PTEN mutations may have important effect on the expression of PTEN protein. At the same time, we also found not all the samples which lost PTEN protein expression, had PTEN mutations. This phenomenon implies other mechanisms such as promoter methylation, translational and post-translational regulation may also account for PTEN silencing. High frequency of PTEN promoter methylation which plays an important role in down regulation of PTEN expression, has been reported in various types of cancers including in breast cancers (Wang et al. 2007; Garcia et al. 2004).
We also analyzed the potential relationship with patients’ ages, histological types, tumor sizes, histological grades, clinical stages, axillary lymph node metastases, steroid receptors (ER, PR) condition and HER2 amplification to explore the role of mutations in PTEN gene in the development of breast cancer. No correlation was found between PTEN mutation and these indexes of breast cancer progression.
Conclusion
Our study demonstrated that there were PTEN mutations in human breast cancers and adjacent atypical ductal hyperplasia tissues. And the PTEN mutations had significant effect on the expression silencing of PTEN protein indicating the important role of PTEN mutation in the genesis of breast cancers. Currently, the mutation pattern and hot spots are consistent with those previously reported. But the PTEN mutation frequency was not consistent with the expression rate of PTEN protein suggesting other mechanisms may also account for PTEN silencing.
Conflict of interest statement
We declare that we have no conflict of interest.
References
- Ali IU, Schriml LM, Dean M (1999) Mutational spectra of PTEN/MMAC1 gene: a tumor suppressor with lipid phosphatase activity. J Natl Cancer Inst 91(22):1922–1932 [DOI] [PubMed] [Google Scholar]
- Alimov A, Li C, Gizatullin R, Fredriksson V, Sundelin B, Klein G, Zabarovsky E, Bergerheim U (1999) Somatic mutation and homozygous deletion of PTEN/MMAC1 gene of 10q23 in renal cell carcinoma. Anticancer Res 19(5B):3841–3846 [PubMed] [Google Scholar]
- Bonneau D, Longy M (2000) Mutations of the human PTEN gene. Hum Mutat 16(2):109–122 [DOI] [PubMed] [Google Scholar]
- Bose S, Crane A, Hibshoosh H, Mansukhani M, Sandweis L, Parsons R (2002) Reduced expression of PTEN correlates with breast cancer progression. Hum Pathol 33(4):405–409 [DOI] [PubMed] [Google Scholar]
- Bouras T, Southey MC, Venter DJ (2001) Overexpression of the steroid receptor coactivator AIB1 in breast cancer correlates with the absence of estrogen and progesterone receptors and positivity for p53 and HER2/neu. Cancer Res 61(3):903–907 [PubMed] [Google Scholar]
- Bruckheimer EM, Gjertsen BT, McDonnell TJ (1999) Implications of cell death regulation in the pathogenesis and treatment of prostate cancer. Semin Oncol 26(4):382–398 [PubMed] [Google Scholar]
- Bussaglia E, Pujol RM, Gil MJ, Marti RM, Tuneu A, Febrer MI, Garcia-Patos V, Ruiz EM, Barnadas M, Alegre M et al (2002) PTEN mutations in eight Spanish families and one Brazilian family with Cowden syndrome. J Investig Dermatol 118(4):639–644 [DOI] [PubMed] [Google Scholar]
- Chung MJ, Jung SH, Lee BJ, Kang MJ, Lee DG (2004) Inactivation of the PTEN gene protein product is associated with the invasiveness and metastasis, but not angiogenesis, of breast cancer. Pathol Int 54(1):10–15 [DOI] [PubMed] [Google Scholar]
- Davies MP, Gibbs FE, Halliwell N, Joyce KA, Roebuck MM, Rossi ML, Salisbury J, Sibson DR, Tacconi L, Walker C (1999) Mutation in the PTEN/MMAC1 gene in archival low grade and high grade gliomas. Br J Cancer 79(9–10):1542–1548 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Depowski PL, Rosenthal SI, Ross JS (2001) Loss of expression of the PTEN gene protein product is associated with poor outcome in breast cancer. Mod Pathol 14(7):672–676 [DOI] [PubMed] [Google Scholar]
- Garcia JM, Silva J, Pena C, Garcia V, Rodriguez R, Cruz MA, Cantos B, Provencio M, Espana P, Bonilla F (2004) Promoter methylation of the PTEN gene is a common molecular change in breast cancer. Genes Chromosom Cancer 41(2):117–124 [DOI] [PubMed] [Google Scholar]
- Guenard F, Labrie Y, Ouellette G, Beauparlant CJ, Bessette P, Chiquette J, Laframboise R, Lepine J, Lesperance B, Pichette R et al (2007) Germline mutations in the breast cancer susceptibility gene PTEN are rare in high-risk non-BRCA1/2 French Canadian breast cancer families. Fam Cancer 6(4):483–490 [DOI] [PubMed] [Google Scholar]
- Lee JO, Yang H, Georgescu MM, Di Cristofano A, Maehama T, Shi Y, Dixon JE, Pandolfi P, Pavletich NP (1999) Crystal structure of the PTEN tumor suppressor: implications for its phosphoinositide phosphatase activity and membrane association. Cell 99(3):323–334 [DOI] [PubMed] [Google Scholar]
- Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R et al (1997) PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275(5308):1943–1947 [DOI] [PubMed] [Google Scholar]
- Lu Y, Yu Q, Liu JH, Zhang J, Wang H, Koul D, McMurray JS, Fang X, Yung WK, Siminovitch KA et al (2003) Src family protein-tyrosine kinases alter the function of PTEN to regulate phosphatidylinositol 3-kinase/AKT cascades. J Biol Chem 278(41):40057–40066 [DOI] [PubMed] [Google Scholar]
- Marsh DJ, Coulon V, Lunetta KL, Rocca-Serra P, Dahia PL, Zheng Z, Liaw D, Caron S, Duboue B, Lin AY, Richardson AL et al (1998) Mutation spectrum and genotype-phenotype analyses in Cowden disease and Bannayan-Zonana syndrome, two hamartoma syndromes with germline PTEN mutation. Hum Mol Genet 7(3):507–515 [DOI] [PubMed] [Google Scholar]
- Perren A, Weng LP, Boag AH, Ziebold U, Thakore K, Dahia PL, Komminoth P, Lees JA, Mulligan LM, Mutter GL et al (1999) Immunohistochemical evidence of loss of PTEN expression in primary ductal adenocarcinomas of the breast. Am J Pathol 155(4):1253–1260 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rhei E, Kang L, Bogomolniy F, Federici MG, Borgen PI, Boyd J (1997) Mutation analysis of the putative tumor suppressor gene PTEN/MMAC1 in primary breast carcinomas. Cancer Res 57(17):3657–3659 [PubMed] [Google Scholar]
- Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis T et al (1997) Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 15(4):356–362 [DOI] [PubMed] [Google Scholar]
- Tate G, Suzuki T, Mitsuya T (2007) Mutation of the PTEN gene in a human hepatic angiosarcoma. Cancer Genet Cytogenet 178(2):160–162 [DOI] [PubMed] [Google Scholar]
- Wang L, Hoque A, Luo RZ, Yuan J, Lu Z, Nishimoto A, Liu J, Sahin AA, Lippman SM, Bast RC Jr et al (2003) Loss of the expression of the tumor suppressor gene ARHI is associated with progression of breast cancer. Clin Cancer Res 9(10 Pt 1):3660–3666 [PubMed] [Google Scholar]
- Wang L, Wang WL, Zhang Y, Guo SP, Zhang J, Li QL (2007) Epigenetic and genetic alterations of PTEN in hepatocellular carcinoma. Hepatol Res 37(5):389–396 [DOI] [PubMed] [Google Scholar]
- Yaginuma Y, Yamashita T, Ishiya T, Morizaki A, Katoh Y, Takahashi T, Hayashi H, Ishikawa M (2000) Abnormal structure and expression of PTEN/MMAC1 gene in human uterine cancers. Mol Carcinog 27(2):110–116 [DOI] [PubMed] [Google Scholar]
- Yoshimoto M, Cunha IW, Coudry RA, Fonseca FP, Torres CH, Soares FA, Squire JA (2007) FISH analysis of 107 prostate cancers shows that PTEN genomic deletion is associated with poor clinical outcome. Br J Cancer 97(5):678–685 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu L, Loo WT, Louis WC (2007) PTEN and VEGF: possible predictors for sentinel lymph node micro-metastasis in breast cancer. Biomed Pharmacother 61(9):558–561 [DOI] [PubMed] [Google Scholar]