Abstract
Objective(s):
Diclofenac (Diclo) is a therapeutic agent used in the treatment of pain and inflammatory diseases, but it is also toxic to the human body. Morin is a flavonoid found naturally in plants and has many biological and pharmacological activities, including anti-inflammatory, anti-oxidant, and anticancer activities. This study aimed to investigate the efficacy of Morin in Diclo-induced testicular toxicity.
Materials and Methods:
Morin (50 mg/kg and 100 mg/kg) was administered orally for five days, while Diclo was administered intraperitoneally at 50 mg/kg on days 4 and 5. Biochemical, molecular, and histological methods were used to investigate oxidative stress, inflammation, apoptosis, and endoplasmic reticulum (ER) stress damage indicators in testicular tissue.
Results:
Morin treatment attenuated Diclo-induced oxidative stress damage by increasing anti-oxidant levels (SOD, CAT, GPx, GSH, Nrf-2, HO-1, and NQO1) and decreasing MDA levels, an indicator of lipid peroxidation. Morin reduced levels of the inflammatory mediators NF-κB protein. Increases in apoptotic Bax and Caspase-3 by Diclo were reduced by Morin, while decreased antiapoptotic Bcl-2 level was increased. Morin reduced Diclo-induced ER stress injury by decreasing ATF-6, PERK, IRE1, GRP-78, and CHOP levels. Also, Diclo decreased COX-2 levels.
Conclusion:
Overall, Morin may be an effective treatment of choice for testicular tissue damage associated with Diclo toxicity and may reduce the level of damage.
Key Words: Apoptosis, Diclofenac, Endoplasmic reticulum – stress, Inflammation, Morin, Oxidative stress
Introduction
The most commonly used drug derivatives in treating pain and inflammation in the clinic are non-steroidal anti-inflammatory drugs (NSAIDs), and diclofenac (Diclo) has an essential place among them (1). Millions of people use Diclo to treat pain, inflammation, degenerative joint disease, rheumatoid arthritis, dysmenorrhea, and trauma. The amount of Diclo consumed globally in a year is approximately 940 tons (2). Diclo is a weak acid that specifically inhibits the cyclooxygenase-2 (COX-2) enzyme. The peak concentration of Diclo in plasma occurs between 10–120 min, depending on the dose and form of administration and individual patient parameters such as gastrointestinal pH (3). Testicular tissue is one of the target tissues in Diclo toxicity due to its high oxygen consumption, high polyunsaturated fatty acids, and low anti-oxidant capacity compared to other tissues in the body (4). It is now a known fact that NSAIDs also adversely affect reproductive functions. Like other NSAIDs, Diclo can have a toxic effect by causing degenerative changes in the testis, epididymis, and accessory sex glands. Diclo causes oxidative stress and fragmentation of genomic DNA because it accelerates the synthesis of reactive oxygen species (ROS) (5). Abnormal spermatozoa resulting from high levels of ROS production is one of the etiologies of infertility, a defect in the male reproductive system. Lipid peroxidation in the membrane of sperm cells is the basis of ROS-induced damage (6). Therefore, studies have reported that natural anti-oxidant compounds - especially herbal active ingredients - may be effective in testicular toxicity caused by toxic agents (7).
Nutrients with anti-oxidant properties have been actively investigated in studies to reduce the toxic effects of drugs (8). Among these anti-oxidants, flavonoids are high-anti-oxidant compounds in plant and bee products (9, 10). Morin (3,5,7,2′,4′-pentahydroxyflavone) is a natural bioflavonoid with anti-oxidant, anti-inflammatory, anti-diabetic, anti-carcinogenic, neuroprotective, and antiproliferative effects (11). Morin shows its anti-oxidant properties by counteracting ROS-induced damage (12). In addition to all these properties, the most significant feature of Morin that distinguishes it from other anti-oxidants is that it has limited toxic effects at high doses in studies on experimental animals (13).
The present study was designed to examine the efficacy of Morin against Diclo-induced rat testicular toxicity. To determine this efficacy, oxidative stress, inflammation, endoplasmic reticulum (ER) stress, and apoptotic damage parameters were examined.
Materials and Methods
Chemicals
Diclo (Abdi Ibrahim, 75 mg/3 ml) and Morin (Sigma, 302.24 g/mol; CAS no: 654055-01-3) were purchased commercially. The other chemicals used in this study were obtained from Sigma–Aldrich Co. (St. Louis, MO, USA). Morin was dissolved in physiological saline.
Animals and groups
In the experiment, 35 male Wistar albino rats weighing 220–250 g and aged 10–12 weeks were used. The animals were kept in cages in a controlled room with a constant temperature of 24-25 °C and a twelve-hour dark-light cycle (07:00-19:00 light; 19:00-07:00 dark). They were given unlimited access to water and standard chow. Experiments were started after the rats were allowed to rest in their cages for a week and adapted to the environment. Rats were obtained from the KONÜDAM Experimental Medicine Application and Research Center (Konya/Türkiye). Rats were randomly divided into five groups (n=7);
1: Control Group: Saline was administered orally daily for 5 days.
2: Morin Group: 100 mg/kg orally once daily for five days.
3: Diclofenac Group (Diclo): Diclo 50 mg/kg was administered intraperitoneally on days 4 and 5.
4: Diclofenac + Morin 50 mg/kg (Diclo+Morin 50): Diclo 50 mg/kg was administered intraperitoneally on days 4 and 5. Morin was administered orally at 50 mg/kg for 5 days.
5: Diclofenac + Morin 100 mg/kg (Diclo+Morin 100): Diclo 50 mg/kg was administered intraperitoneally on days 4 and 5. Morin 100 mg/kg was administered orally once daily for 5 days.
Studies in the literature have been used to determine the doses of Diclo and Morin (12, 14).
Sample collection
Twenty-four hours after the last administration (day 6), the animals were decapitated under mild sevoflurane anesthesia. Testicular tissues were removed and cleaned from surrounding tissues. A testicle was placed in liquid nitrogen for biochemical, molecular, and western blot analysis. The other specimen was placed in 10% formaldehyde for histopathological analysis.
Examination of oxidative stress in testicular tissues
A homogenizer (Tissue Lyser II, Qiagen, The Netherlands) was used to prepare homogenates from testicular tissues by placing the tissues in a 1.15% KCl solution. Glutathione peroxidase (GPx) activity was determined using the Lawrence & Burk method (15), superoxide dismutase (SOD) activity was determined using the Sun et al. method (16), catalase (CAT) activity was determined using the Aebi method (17), glutathione (GSH) level was determined using the Sedlak & Lindsay method (18). MDA level was determined using the Placer et al. method (19). The protein content of testicular tissues was determined using the Lowry et al. method (20).
Gene expression analysis
QIAzol Lysis Reagent (79306; Qiagen) was used for total RNA isolation from testicular tissues in all groups. All procedures for RNA isolation were performed according to the manufacturer’s instructions. An iScript cDNA Synthesis Kit (Bio-Rad) was used to obtain cDNA from RNA, and the manufacturer’s instructions were followed step by step. The cDNAs obtained were used to determine the relative mRNA transcript levels of COX-2, Bcl-2-associated X (Bax), B-cell lymphoma 2 (Bcl-2), cysteine-aspartic acid protease-3 (Caspase-3), Activating transcription factor 6 (ATF-6), Protein Kinase RNA-Like ER Kinase (PERK), Inositol-requiring enzyme 1 (IRE1), Glucose-regulated protein (GRP-78), C/EBP homologous protein (CHOP), Nuclear factor erythroid 2-related factor 2 (Nrf-2), Heme oxygenase-1 (HO-1), and NAD(P)H Quinone Dehydrogenase 1 (NQO1) primer sequences are presented in Table 1. In these procedures, cDNAs reacted with iTaq Universal SYBR Green Supermix (BIO-RAD) and primers for the respective genes in Rotor-Gene Q (Qiagen). The manufacturer’s instructions were followed when preparing the reaction cycles. After the cycles were completed, the CT values obtained from the device were normalized to ß-Actin using the 2 −ΔΔC T method (21).
Table 1.
Primer sequences of rat
| Gene | Sequences (5’-3’) | Product length | Accession No |
|---|---|---|---|
| Nrf2 | F: TTTGTAGATGACCATGAGTCGC R: TCCTGCCAAACTTGCTCCAT |
161 | NM_031789.2 |
| HO-1 | F: ATGTCCCAGGATTTGTCCGA R: ATGGTACAAGGAGGCCATCA |
144 | NM_012580.2 |
| NQO1 | F: CTGGCCAATTCAGAGTGGCA R: GATCTGGTTGTCGGCTGGAA |
304 | NM_017000.3 |
| COX-2 | F: AGGTTCTTCTGAGGAGAGAG R: CTCCACCGATGACCTGATAT |
240 | NM_017232.3 |
| ATF-6 | F: TCAACTCAGCACGTTCCTGA R: GACCAGTGACAGGCTTCTCT |
130 | NM_001107196.1 |
| PERK | F: GATGCCGAGAATCATGGGAA R: AGATTCGAGAAGGGACTCCA |
198 | NM_031599.2 |
| IRE1 | F: GCAGTTCCAGTACATTGCCATTG R: CAGGTCTCTGTGAACAATGTTGA |
163 | NM_001191926.1 |
| GRP78 | F: CATGCAGTTGTGACTGTACCAG R: CTCTTATCCAGGCCATATGCAA |
143 | NM_013083.2 |
| CHOP | F: GAAGCCTGGTATGAGGATCT R: GAACTCTGACTGGAATCTGG |
209 | NM_001109986.1 |
| Bax | F: TTTCATCCAGGATCGAGCAG R: AATCATCCTCTGCAGCTCCA |
154 | NM_017059.2 |
| Bcl-2 | F: GACTTTGCAGAGATGTCCAG R: TCAGGTACTCAGTCATCCAC |
214 | NM_016993.2 |
| Caspase-3 | F: ACTGGAATGTCAGCTCGCAA R: GCAGTAGTCGCCTCTGAAGA |
270 | NM_012922.2 |
| -Actin | F: CAGCCTTCCTTCCTGGGTATG R: AGCTCAGTAACAGTCCGCCT |
360 | NM_031144.3 |
Western blot analysis
Western blot analyses were performed on testicular tissues, similar to the method previously performed in our laboratory (22). In summary, some samples taken from the testicular tissues, which were pulverized by crushing them in a mortar with liquid nitrogen, were homogenized in RIPA buffer and then centrifuged (16000 g, 20 min). The total protein level was measured from the obtained supernatants using the protein BCA assay kit (Thermo Fischer). Supernatants treated with Laemmli sample buffer were separated on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis containing 30 μg of protein in each well. After the proteins with determined molecular sizes were transferred to PVDF membranes, the membrane was blocked with 4% Bovine serum albumin (BSA) (dissolved in phosphate-buffered saline containing 0.1% tween (PBS-T)) for 90 min. After this process, primary antibodies were added and incubated overnight. It was then incubated with goat anti-mouse IgG secondary antibody conjugated to HRP for 90 min (1:2,000 dilution). At the end of the period, the membranes were washed with PBS-T (5 times, 5 min each time). Densitometric analysis was performed in the ImageLab program (Bio-Rad, Hercules, USA) using BioRad Clarity Max ECL substrate (Bio-Rad, Hercules, USA) to visualize the bands. At least three repeated measurements were taken for each sample.
Histopathological evaluations
Testicular tissues were kept in 10% neutral buffered formalin for approximately 72 hr for fixative purposes. Testicular tissues were kept overnight under running water and dehydrated by passing through an ascending series of alcohols. They were then made transparent in xylene and kept in molten paraffin. Paraffin-embedded tissues were sectioned at a thickness of 5 μm using a microtome and stained with hematoxylin and eosin (H&E). The stained testicular tissues were examined using a binocular Olympus Cx43 light microscope (Olympus Inc., Tokyo, Japan) and photographed with an EP50 camera (Olympus Inc., Tokyo, Japan). According to histopathologic findings (tubular wall thickness, edema in intertubular spaces, degeneration and necrosis in spermatogonia, number of spermatozoa in the lumen), sections were classified as absent (-), mild (+), moderate (+ + ) and severe (+ + +).
Statistical analysis
Data were analyzed using IBM SPSS. Statistical values were determined based on mean ± standard deviation. One-way ANOVA/Tukey’s post hoc tests were used for multiple comparisons. In real-time PCR analyses, each sample was run in triplicate, and results are presented as mean ± SD. P<0.05 was considered statistically significant.
Effect of Diclo and Morin on oxidative stress parameters
To determine oxidative stress damage, lipid peroxidation indicator MDA was measured as an oxidant, and SOD, CAT, GPX enzyme activity, and GSH level were measured as anti-oxidants (Figure 1). Compared to the control group, MDA increased (P<0.001), while all anti-oxidants decreased in the Diclo group (P<0.001). When Morin was applied together with Diclo, these changes were reversed. Compared to the Diclo group, all these changes are more prominent at 100 mg/kg in morin co-treatment (P<0.001).
Figure 1.
Effects of diclofenac and Morin administrations on MDA and GSH levels and SOD, GPx, and CAT activity in testicular tissue of rats
MDA: Malondialdehyde, GSH: Glutathione, SOD: Superoxide dismutase, GPx: Glutathione peroxidase, CAT: Catalase. Statistical significance (Control vs others: *P<0.05, **P<0.01, and ***P<0.001, Diclo vs others: #P<0.05, ##P<0.01, and ###P<0.001, Diclo+Morin 50 vs Diclo+Morin 100: *P<0.05,**P<0.01, and ***P<0.001) was analyzed using One Way ANOVA
Effect of Diclo and Morin on Nrf-2, HO-1, and NQO1 mRNA transcription levels
There was a decrease in Nrf-2, HO-1, and NQO1 mRNA transcription levels in the Diclo group compared to the control group (P<0.001). With morin co-treatment, this situation changed, and an increase occurred compared to Diclo (P<0.001). Morin at 100 mg/kg was more effective (P<0.001 for Nrf-2 and HO-1; P<0.01 for NQO1) (Figure 2).
Figure 2.
Effects of Diclo and Morin administrations on Nrf-2, HO-1, and NQO1 mRNA transcription levels in testicular tissue of rats
Nrf-2: Nuclear factor erythroid 2-related factor 2, HO-1: Heme oxygenase-1, and NQO1: NAD(P)H Quinone Dehydrogenase 1. Statistical significance (Control vs others: *P<0.05, **P<0.01, and ***P<0.001, Diclo vs others: #P<0.05, ##P<0.01, and ###P<0.001, Diclo+Morin 50 vs Diclo+Morin 100: *P<0.05, **P<0.01, and ***P<0.001) was analyzed using One Way ANOVA.
Effect of Diclo and Morin on ATF-6, PERK, IRE1, GRP-78, and CHOP mRNA transcription levels
To determine the level of ER damage, ATF-6, PERK, IRE1, GRP-78, and CHOP mRNA transcription levels were measured (Figure 3). All these parameters increased in the Diclo group compared to the control group (P<0.001). On the other hand, Morin treatment reversed this situation and reduced the level of these parameters. In particular, this reduction was much more effective in the 100 mg/kg dose of Morin than in the Diclo group (P<0.001).
Figure 3.
Effects of diclofenac and Morin administrations on ATF-6, PERK, IRE1, GRP-78, and CHOP mRNA transcription levels in testicular tissue of rats
ATF-6: Activating transcription factor 6, PERK: Protein Kinase RNA-Like ER Kinase, IRE1: Inositol-requiring enzyme 1, GRP-78: Glucose-regulated protein, CHOP: C/EBP homologous protein. Statistical significance (Control vs others: *P<0.05, **P<0.01, and ***P<0.001, Diclo vs others: #P<0.05, ##P<0.01, and ###P<0.001, Diclo+Morin 50 vs Diclo+Morin 100: *P<0.05, **P<0.01, and***P<0.001) was analyzed using One Way ANOVA.
Effect of Diclo and Morin on Bax, Bcl-2, and caspase-3 mRNA transcription levels
To determine the level of apoptotic damage, Bax (apoptotic), Bcl-2 (antiapoptotic), and caspase-3 (apoptotic) mRNA transcription levels were measured (Figure 4). Bax and caspase-3 increased while Bcl-2 decreased in the Diclo group compared to the control group (P<0.001). With Morin application with Diclo, this situation moved in the opposite direction, and Bax and caspase-3 decreased while Bcl-2 increased (P<0.001 at both doses). Morin was more effective at 100 mg/kg with varying significance.
Figure 4.
Effects of diclofenac and Morin administrations on Bax, Bcl-2, and caspase-3 mRNA transcription levels in testicular tissue of rats
Bax: Bcl-2-associated X, Bcl-2: B-cell lymphoma 2, caspase-3: cysteine-aspartic acid protease-3. Statistical significance (Control vs others: *P<0.05, **P<0.01, and ***P<0.001, Diclo vs others: #P<0.05, ##P<0.01, and ###P<0.001, Diclo+Morin 50 vs Diclo+Morin 100: *P<0.05, **P<0.01, and ***P<0.001) was analyzed using One Way ANOVA.
Effect of Diclo and Morin on COX-2 mRNA transcription levels
Since Diclo is a selective inhibitor of COX-2, testicular tissue COX-2 mRNA transcription level was also measured (Figure 5). Indeed, COX-2 was reduced in the Diclo group compared to the control group (P<0.001). COX-2 mRNA transcription levels increased with Morin administration (50 mg/kg: P<0.05; 100 mg/kg: P<0.001). Morin was more effective at 100 mg/kg than 50 mg/kg (P<0.001).
Figure 5.
Effects of diclofenac and Morin administrations on COX-2 mRNA transcription levels in testicular tissue of rats

COX-2: Cyclooxygenase-2. Statistical significance (Control vs others: *P<0.05, **P<0.01, and ***P<0.001, Diclo vs others: #P<0.05, ##P<0.01, and ###P<0.001, Diclo+Morin 50 vs Diclo+Morin 100: *P<0.05, **P<0.01, and ***P<0.001) was analyzed using One Way ANOVA.
Effect of Diclo and Morin on NF-κB, caspase-3, and Bax protein levels
NF-κB, caspase-3, and Bax protein levels were also analyzed from testicular tissues (Figure 6). Inflammation marker (NF-κB) and apoptotic factors (caspase-3 and Bax) increased in the Diclo group compared to the control group (P<0.001). Compared to the Diclo group, Morin 50 mg/kg decreased NF-κB (P<0.001), Bax (P<0.001), and caspase-3 (P<0.05), whereas this decrease was more pronounced in the 100 mg/kg (P<0.001).
Figure 6.
Effects of diclofenac and Morin administrations on NF-κB, caspase-3, and Bax protein levels in testicular tissue of rats
NF-κB: Nuclear Factor kappa B, caspase-3: cysteine-aspartic acid protease-3, Bax: Bcl-2-associated X. Statistical significance (Control vs others: *P<0.05, **P<0.01, and ***P<0.001, Diclo vs others: #P<0.05, ##P<0.01, and ###P<0.001, Diclo+Morin 50 vs Diclo+Morin 100: *P<0.05,**P<0.01, and ***P<0.001) was analyzed using One Way ANOVA.
Histopathology findings
Histopathologic findings are summarized in Figure 7 and Table 2. When the testicular tissue findings of the control and Morin group were evaluated, the morphology and wall thickness of the seminiferous tubules were regular, and the number of spermatozoa in the lumen was high (Figure 7Aa, 7Bb). However, the tubule walls of the sections belonging to the Diclo group were thinned, and tubular atrophy and severe edema in the intertubular area were observed. In addition, loss of tubule cells, necrotic and degenerative changes in spermatogonia, and a severe decrease in the number of spermatozoa in the lumens were observed (Figure 7Cc). In the Diclo+Morin 50 and Diclo+Morin 100 groups, mild degeneration of spermatogonia, mild edema in the intertubular area in the low dose treatment group, no edema in the high dose group and spermatozoa in the tubule lumens were increased compared to the Diclo group. In addition, the thickening of the seminiferous tubule walls was observed (Figure 7Dd, 7Ee).
Figure 7.
Representative light micrographs from H&E-stained testicular tissue sections in groups
Control group (A,a) and Morin group (B,b): normal histologic appearance of testicular tissue; Diclo group: thinning of seminiferous tubule wall (curved arrow), necrosis and degeneration of spermatogonium (arrowhead), severe edema in interstitial spaces (asterisk) (C,c); Diclo+Morin 50 group: mild edema in interstitial spaces (asterisk) (D, d); Diclo+Morin 100; congestion (arrow) (E, e). H&E, Bar; top row: 100 μm, bottom row: 20 μm
Table 2.
Effect of diclofenac and Morin on testicular histological parameters
| Gene | Sequences (5’-3’) | Product length | Accession No |
|---|---|---|---|
| Nrf2 | F: TTTGTAGATGACCATGAGTCGC R: TCCTGCCAAACTTGCTCCAT |
161 | NM_031789.2 |
| HO-1 | F: ATGTCCCAGGATTTGTCCGA R: ATGGTACAAGGAGGCCATCA |
144 | NM_012580.2 |
| NQO1 | F: CTGGCCAATTCAGAGTGGCA R: GATCTGGTTGTCGGCTGGAA |
304 | NM_017000.3 |
| COX-2 | F: AGGTTCTTCTGAGGAGAGAG R: CTCCACCGATGACCTGATAT |
240 | NM_017232.3 |
| ATF-6 | F: TCAACTCAGCACGTTCCTGA R: GACCAGTGACAGGCTTCTCT |
130 | NM_001107196.1 |
| PERK | F: GATGCCGAGAATCATGGGAA R: AGATTCGAGAAGGGACTCCA |
198 | NM_031599.2 |
| IRE1 | F: GCAGTTCCAGTACATTGCCATTG R: CAGGTCTCTGTGAACAATGTTGA |
163 | NM_001191926.1 |
| GRP78 | F: CATGCAGTTGTGACTGTACCAG R: CTCTTATCCAGGCCATATGCAA |
143 | NM_013083.2 |
| CHOP | F: GAAGCCTGGTATGAGGATCT R: GAACTCTGACTGGAATCTGG |
209 | NM_001109986.1 |
| Bax | F: TTTCATCCAGGATCGAGCAG R: AATCATCCTCTGCAGCTCCA |
154 | NM_017059.2 |
| Bcl-2 | F: GACTTTGCAGAGATGTCCAG R: TCAGGTACTCAGTCATCCAC |
214 | NM_016993.2 |
| Caspase-3 | F: ACTGGAATGTCAGCTCGCAA R: GCAGTAGTCGCCTCTGAAGA |
270 | NM_012922.2 |
| -Actin | F: CAGCCTTCCTTCCTGGGTATG R: AGCTCAGTAACAGTCCGCCT |
360 | NM_031144.3 |
Discussion
Studies on Diclo, one of the NSAIDs, have reported harmful effects on human and experimental animal organs and tissues (23). Widely used and effective in the treatment of inflammation and pain, Diclo also has serious side effects (24). Oxidative stress has been reported to be one of the factors causing Diclo toxicity (25). Morin is a natural flavonoid found in plants of the Moraceae family and is well tolerated even with long-term use (26). Morin has a protective effect by reducing apoptosis and ROS production (27). In this study, the effects of Morin on Diclo-induced testicular toxicity were investigated.
In physiological conditions of healthy cells, there is a balance between oxidants such as ROS and anti-oxidants. However, oxidative stress may occur due to the imbalance between this balance factor shifting to the side of oxidants (28,29). The increase in free radicals leads to lipid peroxidation in the cell. Because lipid density is high in the cell membrane (7, 30). MDA is the most prominent indicator of lipid peroxidation caused by oxidative stress (31, 32). The body forms a defense system against oxidative stress damage by activating various anti-oxidant enzymes such as SOD, CAT, and GPx and non-enzymatic anti-oxidants such as GSH (33-35). In studies conducted with NSAIDs, it was found that ROS levels increased (36, 37). Testicular tissue is highly susceptible to oxidative stress as both spermatogenesis and steroidogenesis are affected by ROS (38, 39). In rats, Diclo caused a decrease in anti-oxidant defense systems SOD, CAT, and GPx activities and GSH levels in the testis and epididymis. Thus, Diclo inhibits anti-oxidant defense systems in the testis and epididymis and may trigger oxidant levels to reach dangerous levels and oxidative stress damage (2). In the present study, Diclo contributed to oxidative stress damage by decreasing anti-oxidant defense systems SOD, CAT, GPx activities, and GSH levels. On the other hand, Diclo increased the oxidant MDA level. Morin treatment decreased oxidative stress damage by increasing SOD, CAT GPX activities, and GSH levels and decreasing MDA levels. Morin at a dose of 100 mg/kg further reduced oxidative damage. Co-administration of Morin reduced Diclo-induced oxidative damage in testicular tissues in a dose-dependent manner.
Another indicator of oxidative stress damage is the Nrf2/HO-1 signaling pathway (40, 41). Nrf-2 is a transcription factor in defense against cell oxidative stress damage (42). With the increase in oxidative stress, Nrf-2, located in the cytoplasm, separates from the complex it forms with Keap-1 and translocates towards the nucleus (43). It then stimulates the transcription of enzymes such as HO-1 and NQO1 (44, 45). HO-1 is effective against ROS-induced oxidative stress damage in tissues, while NQO1 involves protection against both natural and exogenous quinones, maintenance of endogenous anti-oxidants, and stabilization of p53 protein (34). Varışlı et al. (1) reported that Diclo suppressed Nrf-2, HO-1, and NQO1 mRNA transcription in different tissues in their study. A study (46) reported that Morin increased Nrf-2 and HO-1 mRNA transcription levels in different tissues. In the present study, Diclo decreased Nrf-2, HO1, and NQO1 mRNA transcription levels in testicular tissue and decreased the level of anti-oxidant defense through this pathway. On the other hand, this situation was reversed with Morin administration, and Nrf-2, HO1, and NQO1 mRNA transcription levels increased. Thus, Morin reduced Diclo-induced oxidative stress damage in testicular tissue via the Nrf-2 pathway.
COX-2 is a factor involved in many physiological processes. In these processes, different mediators (growth factors, lipopolysaccharide, interleukin-1β, and tumor necrosis factor-alpha) affect COX-2 expression (47). It is now well known that Diclo has a selective inhibitory effect on COX-2 (48). The present study also measured COX-2 mRNA transcription level to determine Diclo effects in testicular tissue. Indeed, the COX-2 mRNA transcription level was significantly decreased in the Diclo-treated group. This may also prove that Diclo is effective in testicular tissue.
Apoptosis (programmed cell death) is a biological process that enables the organism to eliminate cells that are damaged in developmental stages, in the maintenance of homeostasis, or in pathological conditions that need to be removed from the body (49-51). Bax and Bcl-2 are strong indicators for apoptosis and are one of the decisive steps in apoptosis (52). A shift in the Bax/Bcl-2 balance in favor of Bax leads to a shift of cytochrome c from the mitochondria towards the stasis and subsequent stimulation of caspase-3 activation (22). Caspase-3, which has a significant role in the apoptotic process, is also known as executioner caspase and has apoptotic properties (53, 54). Researchers (55) reported that Diclo triggered apoptosis by causing caspase-3 activation in different tissues. Varışlı et al. (8) reported that Morin exhibited antiapoptotic properties by decreasing Bax and caspase-3 mRNA transcription levels and increasing Bcl-2 mRNA transcription levels in rat testicular tissues. This study determined that Diclo administration in rat testicular tissues showed apoptotic effect by increasing Bax and caspase-3 mRNA transcription levels, which are apoptotic factors, and decreasing Bcl-2 mRNA transcription level, which is antiapoptotic. In the present study, Bax and caspase-3 protein levels were increased in the Diclo group in rat testicular tissues, which may prove that Diclo also affects protein levels. Morin co-administration with Diclo reversed this situation and exhibited antiapoptotic properties at both mRNA transcription and protein levels.
Increased oxidative damage also triggers ER stress injury. ER is a cellular organelle involved in many significant functions (protein synthesis, folding and maturation, and calcium homeostasis) (56). Among the causes of ER stress is the accumulation of unfolded or misfolded proteins in the ER lumen due to an imbalance following physiological or pathological processes (57). ATF-6, PERK, IRE1, GRP78, and CHOP are the most important markers of ER stress damage and increase ER stress (58, 59). In the present study, Diclo caused ER stress by increasing ATF-6, PERK, IRE1, GRP78, and CHOP mRNA transcript levels in rat testicular cells. On the other hand, Morin decreased ER stress damage by decreasing the levels of these parameters.
Increased levels of ROS can cause toxic damage to tissues and promote inflammatory responses (60, 61). The increase of oxygen radicals damages cellular activities by affecting NF-κB pathways (62, 63). NF-κB causes damage to spermatogenesis by increasing both oxidative damage and the release of pro-inflammatory cytokines (8, 64). In this study, NF-κB protein levels increased in response to Diclo toxicity. With morin administration, this situation was reversed; NF-κB protein levels decreased, and inflammatory damage in testicular tissue decreased.
Oxidative stress can also cause damage to testicular tissue Leydig cells and negatively affect the process of spermatogenesis (65). Sertoli cells are the cells involved in the process of spermatogenesis. Leydig cells are responsible for androgen production. When these cells are affected by chemical factors, the hormonal balance can be disrupted, which can have a negative impact on male fertility (66). Decreased testicular cell population dynamics and abnormal testis histology attest to Diclo-induced toxicity. Diclo toxicity may disrupt the microenvironment of Sertoli cells due to degeneration, vacuolation, and apoptosis of spermatogonia, primary spermatocytes, secondary spermatocytes, and spermatids (67). In the present study, thinning of tubule walls, tubular atrophy, and severe edema in the intertubular area were observed in the testicular tissues of the Diclo-treated group. In addition, loss of tubule cells, necrotic and degenerative changes in spermatogonia, and a severe decrease in the number of spermatozoa in the lumens were observed. Morin treatment reduced these damages.
Conclusion
Morin showed an ameliorative effect on Diclo-induced testicular toxicity in the present study. In this context, the protective effect of Morin against Diclo-induced testicular toxicity may be mediated by its attenuating effect on oxidative stress injury, inflammatory injury, apoptotic injury, and ER stress injury.
Acknowledgment
We want to thank Prof Dr Mehmet Tuğrul Yılmaz, İbrahim Yıldız, and the KONUDAM team for their support.
Authors’ Contributions
All authors contributed to the study’s conception and design. H Ş, N A, C G, S K, M İ, and FM K performed material preparation, data collection, and analysis. H Ş wrote the first draft of the manuscript, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Conflicts of Interest
The authors declare no competing interests.
Declaration
We have not used any AI tools or technologies to prepare this manuscript.
Ethical Approval
Ethics committee approval was received for this study from Necmettin Erbakan University KONUDAM Experimental Medicine Research and Study Center (No: 2022/63, Date: 30.12.2022). All experimental animal practices were conducted using the National Research Council’s Guide for the Care and Use of Laboratory Animals.
Consent to Publish
The authors gave their explicit consent to publish the manuscript. Hasan Şimşek can be contacted to seek further clarification and information.
Funding
This research received no specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
References
- 1.Varışlı B, Caglayan C, Kandemir FM, Gür C, Ayna A, Genç A, et al. Chrysin mitigates diclofenac-induced hepatotoxicity by modulating oxidative stress, apoptosis, autophagy and endoplasmic reticulum stress in rats. Mol Biol Rep. 2023;50:433–442. doi: 10.1007/s11033-022-07928-7. [DOI] [PubMed] [Google Scholar]
- 2.Owumi SE, Aliyu-Banjo NO, Odunola OA. Selenium attenuates diclofenac-induced testicular and epididymal toxicity in rats. Andrologia. 2020;52:e13669. doi: 10.1111/and.13669. [DOI] [PubMed] [Google Scholar]
- 3.Amanullah A, Upadhyay A, Dhiman R, Singh S, Kumar A, Ahirwar DK, et al. Development and challenges of diclofenac-based novel therapeutics: Targeting cancer and complex diseases. Cancers. 2022;14:4385–4403. doi: 10.3390/cancers14184385. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Waly H, Abd-Elkareem M, Raheem SA, Abou Khalil NS. Berberine protects against diclofenac sodium-induced testicular impairment in mice by its anti-oxidant and anti-apoptotic activities. Iran J Basic Med Sci. 2022;25:767–774. doi: 10.22038/IJBMS.2022.62811.13895. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Mousa AA, Elweza AE, Elbaz HT, Tahoun EAE, Shoghy KM, Elsayed I. Eucalyptus globulus protects against diclofenac sodium induced hepatorenal and testicular toxicity in male rats. J Tradit Complement Med. 2020;10:521–528. doi: 10.1016/j.jtcme.2019.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Tella T, Adegbegi A, Emeninwa C, Odola A, Ayangbenro A, Adaramoye O. Evaluation of the anti-oxidative potential of diisopropyldithiocarbamates sodium salt on diclofenac-induced toxicity in male Albino rats. Toxicol Rep. 2022;9:828–833. doi: 10.1016/j.toxrep.2022.03.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.İleriturk M, Kandemir O, Akaras N, Simsek H, Genc A, Kandemir FM. Hesperidin has a protective effect on paclitaxel-induced testicular toxicity through regulating oxidative stress, apoptosis, inflammation and endoplasmic reticulum stress. Reprod Toxicol. 2023;118:108369. doi: 10.1016/j.reprotox.2023.108369. [DOI] [PubMed] [Google Scholar]
- 8.Varışlı B, Caglayan C, Kandemir FM, Gür C, Bayav İ, Genç A. The impact of Nrf2/HO-1, caspase-3/Bax/Bcl2 and ATF6/IRE1/PERK/GRP78 signaling pathways in the ameliorative effects of morin against methotrexate-induced testicular toxicity in rats. Mol Biol Rep. 2022;49:9641–9649. doi: 10.1007/s11033-022-07873-5. [DOI] [PubMed] [Google Scholar]
- 9.Gencer S, Gür C, İleritürk M, Küçükler S, Akaras N, Şimşek H, et al. The ameliorative effect of carvacrol on sodium arsenite-induced hepatotoxicity in rats: Possible role of Nrf2/HO-1, RAGE/NLRP3, Bax/Bcl-2/Caspase-3, and Beclin-1 pathways. J Biochem Mol Toxicol. 2024;38:e23863. doi: 10.1002/jbt.23863. [DOI] [PubMed] [Google Scholar]
- 10.Kankılıç NA, Küçükler S, Gür C, Akarsu SA, Akaras N, Şimşek H, et al. Naringin protects against paclitaxel-induced toxicity in rat testicular tissues by regulating genes in pro-inflammatory cytokines, oxidative stress, apoptosis, and JNK/MAPK signaling pathways. J Biochem Mol Toxicol. 2024;38:e23751. doi: 10.1002/jbt.23751. [DOI] [PubMed] [Google Scholar]
- 11.Kuzu M, Kandemir FM, Yildirim S, Kucukler S, Caglayan C, Turk E. Morin attenuates doxorubicin-induced heart and brain damage by reducing oxidative stress, inflammation and apoptosis. Biomed Pharmacother. 2018;106:443–453. doi: 10.1016/j.biopha.2018.06.161. [DOI] [PubMed] [Google Scholar]
- 12.Gur C, Kandemir FM, Darendelioglu E, Caglayan C, Kucukler S, Kandemir O, et al. Morin protects against acrylamide-induced neurotoxicity in rats: An investigation into different signal pathways. Environ Sci Pollut Res. 2021;28:49808–49819. doi: 10.1007/s11356-021-14049-4. [DOI] [PubMed] [Google Scholar]
- 13.Hussein MM, Gad E, Ahmed MM, Arisha AH, Mahdy HF, Swelum AAA, et al. Amelioration of titanium dioxide nanoparticle reprotoxicity by the anti-oxidants morin and rutin. Environ Sci Pollut Res. 2019;26:29074–29084. doi: 10.1007/s11356-019-06091-0. [DOI] [PubMed] [Google Scholar]
- 14.S JP, Evan Prince S. Diclofenac-induced renal toxicity in female Wistar Albino rats is protected by the pre-treatment of aqueous leaves extract of Madhuca longifolia through suppression of inflammation, oxidative stress and cytokine formation. Biomed Pharmacother. 2018;98:45–51. doi: 10.1016/j.biopha.2017.12.028. [DOI] [PubMed] [Google Scholar]
- 15.Lawrence RA, Burk RF. Glutathione peroxidase activity in selenium-deficient rat liver. Biochem Biophys Res Commun . 1976;71:952–958. doi: 10.1016/0006-291x(76)90747-6. [DOI] [PubMed] [Google Scholar]
- 16.Sun YI, Oberley LW, Li Y. A simple method for clinical assay of superoxide dismutase. Clin Chem. 1988;34:497–500. [PubMed] [Google Scholar]
- 17.Aebi H. Catalase in vitro. Methods Enzymol. 1984;105:121–1266. doi: 10.1016/s0076-6879(84)05016-3. [DOI] [PubMed] [Google Scholar]
- 18.Sedlak J, Lindsay RH. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman’s reagent. Anal Biochem. 1968;25:192–205. doi: 10.1016/0003-2697(68)90092-4. [DOI] [PubMed] [Google Scholar]
- 19.Placer ZA, Cushman LL, Johnson BC. Estimation of product of lipid peroxidation (malonyl dialdehyde) in biochemical systems. Anal Biochem. 1966;16:359–364. doi: 10.1016/0003-2697(66)90167-9. [DOI] [PubMed] [Google Scholar]
- 20.Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–275. [PubMed] [Google Scholar]
- 21.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 22.İleriturk M, Kandemir O, Kandemir FM. Evaluation of protective effects of quercetin against cypermethrin-induced lung toxicity in rats via oxidative stress, inflammation, apoptosis, autophagy, and endoplasmic reticulum stress pathway. Environ Toxicol. 2022;37:2639–2650. doi: 10.1002/tox.23624. [DOI] [PubMed] [Google Scholar]
- 23.Ezihe CO, Solomon Tsekohol AGU, Nathaniel Daniel RABO, OCHIGBO VI. Hydroethanolic leaf extract of erythrina senegalensis attenuates diclofenac sodium-ınduced testicular and epididymal perturbation in male wistar rats. Sch Int J Biochem. 2023;6:60–69. [Google Scholar]
- 24.Alabi QK, Akomolafe RO. Kolaviron diminishes diclofenac-induced liver and kidney toxicity in Wistar rats via suppressing inflammatory events, upregulating anti-oxidant defenses, and improving hematological indices. Dose-Response. 2020;18:1559325819899256. doi: 10.1177/1559325819899256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Elshopakey GE, Elazab ST. Cinnamon aqueous extract attenuates diclofenac sodium and oxytetracycline mediated hepato-renal toxicity and modulates oxidative stress, cell apoptosis, and inflammation in male albino rats. Vet Sci. 2021;8:9–27. doi: 10.3390/vetsci8010009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Mohammadi N, Asle-Rousta M, Rahnema M, Amini R. Morin attenuates memory deficits in a rat model of Alzheimer’s disease by ameliorating oxidative stress and neuroinflammation. Eur J Pharmacol. 2021;910:174506. doi: 10.1016/j.ejphar.2021.174506. [DOI] [PubMed] [Google Scholar]
- 27.Salem HA, Elsherbiny N, Alzahrani S, Alshareef HM, Abd Elmageed ZY, Ajwah SM, et al. Neuroprotective effect of morin hydrate against attention-deficit/hyperactivity disorder (ADHD) induced by MSG and/or protein malnutrition in rat pups: Effect on oxidative/monoamines/inflammatory balance and apoptosis. Pharmaceuticals. 2022;15:1012–1035. doi: 10.3390/ph15081012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Banihani SA. Effect of diclofenac on semen quality: A review. Andrologia. 2021;53:e14021. doi: 10.1111/and.14021. [DOI] [PubMed] [Google Scholar]
- 29.Ozyigit F, Deger AN, Kocak FE, Ekici MF, Simsek H, Arık O. Protective effects of hesperidin in gastric damage caused by experimental ischemia-reperfusion injury model in rats. Acta Cir Bras. 2024;39:e391124. doi: 10.1590/acb391124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Keleş O, Can S, Cigsar G, Colak S, Erol H, Akaras N, et al. Hepatoprotective effects of B-1, 3-(D)-glucan on bortezomib-induced toxicity in male rats: Role of oxidative stress and inflammation. Biomed Pharmacother. 2023;157:113997. [Google Scholar]
- 31.Erisir M, Kandemir FM, Yüksel M. The effects of caesarean section on lipid peroxidation and some anti-oxidants in the blood of newborn calves. Veterinarski Arhiv. 2013;83:153–159. [Google Scholar]
- 32.Kandemir FM, Ozkaraca M, Küçükler S, Caglayan C, Hanedan B. Preventive effects of hesperidin on diabetic nephropathy induced by streptozotocin via modulating TGF-β1 and oxidative DNA damage. Toxin Rev. 2018;37:287–293. [Google Scholar]
- 33.Akaras N, Gur C, Kucukler S, Kandemir FM. Zingerone reduces sodium arsenite-induced nephrotoxicity by regulating oxidative stress, inflammation, apoptosis and histopathological changes. Chem Biol Interac. 2023;374:110410. doi: 10.1016/j.cbi.2023.110410. [DOI] [PubMed] [Google Scholar]
- 34.Şimşek H, Akaras N, Gür C, Küçükler S, Kandemir FM. Beneficial effects of chrysin on cadmium-induced nephrotoxicity in rats: Modulating the levels of Nrf2/HO-1, RAGE/NLRP3, and caspase-3/Bax/Bcl-2 signaling pathways. Gene. 2023;875:147502. doi: 10.1016/j.gene.2023.147502. [DOI] [PubMed] [Google Scholar]
- 35.Aksakal E, Akaras N, Tanboga IH, Kurt M, Halici Z, Odabasoglu F, Unal B. Relationship between oxidative stress and cardiomyopathic changes in ovariectomized rats. Cardiology. 2011;119:235–241. doi: 10.1159/000333003. [DOI] [PubMed] [Google Scholar]
- 36.Zeren S, Bayhan Z, Kocak FE, Kocak C, Akcılar R, Bayat Z, et al. Gastroprotective effects of sulforaphane and thymoquinone against acetylsalicylic acid-induced gastric ulcer in rats. J Surg Res. 2016;203:348–359. doi: 10.1016/j.jss.2016.03.027. [DOI] [PubMed] [Google Scholar]
- 37.Simsek H, Akaras N. Acacetin ameliorates acetylsalicylic acid-induced gastric ulcer in rats by interfering with oxidative stress, inflammation, and apoptosis. Int J Med Biochem. 2023;6:96–103. [Google Scholar]
- 38.Akaras N, Abuc OO, Koc K, Bal T, Geyikoglu F, Atilay H, et al. (1→ 3)-β-d-glucan enhances the toxicity induced by Bortezomib in rat testis. J Food Biochem. 2020;44:e13155. doi: 10.1111/jfbc.13155. [DOI] [PubMed] [Google Scholar]
- 39.Akarsu SA, Gür C, İleritürk M, Akaras N, Küçükler S, Kandemir FM. Effect of syringic acid on oxidative stress, autophagy, apoptosis, inflammation pathways against testicular damage induced by lead acetate. J Trace Elem Med Biol. 2023;80:127315. doi: 10.1016/j.jtemb.2023.127315. [DOI] [PubMed] [Google Scholar]
- 40.Gur C, Kandemir FM, Caglayan C, Satıcı E. Chemopreventive effects of hesperidin against paclitaxel-induced hepatotoxicity and nephrotoxicity via amendment of Nrf2/HO-1 and caspase-3/Bax/Bcl-2 signaling pathways. Chem Biol Interact. 2022;365:110073. doi: 10.1016/j.cbi.2022.110073. [DOI] [PubMed] [Google Scholar]
- 41.Kankılıç NA, Şimşek H, Akaras N, Gür C, İleritürk M, Küçükler S, et al. Protective effects of naringin on colistin-induced damage in rat testicular tissue: Modulating the levels of Nrf-2/HO-1, AKT-2/FOXO1A, Bax/Bcl2/Caspase-3, and Beclin-1/LC3A/LC3B signaling pathways. J Biochem Mol Toxicol. 2024;38:e23643. doi: 10.1002/jbt.23643. [DOI] [PubMed] [Google Scholar]
- 42.Kankılıç NA, Şimşek H, Akaras N, Gür C, Küçükler S, İleritürk M, et al. The ameliorative effects of chrysin on bortezomib-induced nephrotoxicity in rats: Reduces oxidative stress, endoplasmic reticulum stress, inflammation damage, apoptotic and autophagic death. Food Chem Toxicol. 2024;190:114791. doi: 10.1016/j.fct.2024.114791. [DOI] [PubMed] [Google Scholar]
- 43.Akaras N, Gür C, Caglayan C, Kandemir FM. Protective effects of naringin against oxaliplatin-induced testicular damage in rats: Involvement of oxidative stress, inflammation, endoplasmic reticulum stress, apoptosis, and histopathology. Iran J Basic Med Sci. 2024;27:466–474. doi: 10.22038/IJBMS.2024.73824.16048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Gur C, Akarsu SA, Akaras N, Tuncer SC, Kandemir FM. Carvacrol reduces abnormal and dead sperm counts by attenuating sodium arsenite-induced oxidative stress, inflammation, apoptosis, and autophagy in the testicular tissues of rats. Environ Toxicol. 2023;38:1265–1276. doi: 10.1002/tox.23762. [DOI] [PubMed] [Google Scholar]
- 45.Semis HS, Gur C, Ileriturk M, Kandemir FM, Kaynar O. Evaluation of therapeutic effects of quercetin against Achilles tendinopathy in rats via oxidative stress, inflammation, apoptosis, autophagy, and metalloproteinases. Am J Sports Med. 2022;50:486–498. doi: 10.1177/03635465211059821. [DOI] [PubMed] [Google Scholar]
- 46.Kızıl HE, Caglayan C, Darendelioğlu E, Ayna A, Gür C, Kandemir FM, et al. Morin ameliorates methotrexate-induced hepatotoxicity via targeting Nrf2/HO-1 and Bax/Bcl2/caspase-3 signaling pathways. Mol Biol Rep. 2023;50:3479–3488. doi: 10.1007/s11033-023-08286-8. [DOI] [PubMed] [Google Scholar]
- 47.Şimşek H, Küçükler S, Gür C, İleritürk M, Aygörmez S, Kandemir FM. Protective effects of zingerone against sodium arsenite-induced lung toxicity: A multi-biomarker approach. Iran J Basic Med Sci. 2023;26:1098–1106. doi: 10.22038/IJBMS.2023.71905.15623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Mostafa RE, El-Marasy SA, Jaleel GAA, Bakeer RM. Protective effect of royal jelly against diclofenac-induced hepato-renal damage and gastrointestinal ulcerations in rats. Heliyon. 2020;6:e03330. doi: 10.1016/j.heliyon.2020.e03330. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Akcılar R, Akcılar A, Koçak C, Koçak FE, Bayat Z, Şimşek H, et al. Effects of Ukrain on intestinal apoptosis caused by ischemia-reperfusion injury in rats. Int J Clin Exp Med. 2015;8:22158–22166. [PMC free article] [PubMed] [Google Scholar]
- 50.Güçlü A, Erken HA, Erken G, Dodurga Y, Yay A, Özçoban Ö, et al. The effects of ozone therapy on caspase pathways, TNF-α, and HIF-1α in diabetic nephropathy. Int Urol Nephrol. 2016;48:441–450. doi: 10.1007/s11255-015-1169-8. [DOI] [PubMed] [Google Scholar]
- 51.Ekinci Akdemir FN, Yildirim S, Kandemir FM, Aksu EH, Guler MC, Kiziltunc Ozmen H, et al. The anti-apoptotic and anti-oxidant effects of eugenol against cisplatin-induced testicular damage in the experimental model. Andrologia. 2019;51:e13353. doi: 10.1111/and.13353. [DOI] [PubMed] [Google Scholar]
- 52.Ileriturk M, Ileriturk D, Kandemir O, Akaras N, Simsek H, Erdogan E, et al. Naringin attenuates oxaliplatin-induced nephrotoxicity and hepatotoxicity: A molecular, biochemical, and histopathological approach in a rat model. J Biochem Mol Toxicol. 2024;38:e23604. doi: 10.1002/jbt.23604. [DOI] [PubMed] [Google Scholar]
- 53.Şimşek H, Demiryürek Ş, Demir T, Atabay HD, Çeribasi AO, Bayraktar R, et al. Assessment of expressions of Bcl-XL, b-FGF, Bmp-2, Caspase-3, PDGFR-α, Smad1 and TGF-β1 genes in a rat model of lung ischemia/reperfusion. Iran J Basic Med Sci. 2016;19:209–214. [PMC free article] [PubMed] [Google Scholar]
- 54.Şimşek H, Gür C, Küçükler S, İleritürk M, Akaras N, Öz M, et al. Carvacrol reduces mercuric chloride-induced testicular toxicity by regulating oxidative stress, inflammation, apoptosis, autophagy, and histopathological changes. Biol Trace Elem Res. 2024;202:4605–4617. doi: 10.1007/s12011-023-04022-2. [DOI] [PubMed] [Google Scholar]
- 55.Orabi SH, Abd Eldaium D, Hassan A, El Sabagh HS, Abd Eldaim MA. Allicin modulates diclofenac sodium induced hepatonephro toxicity in rats via reducing oxidative stress and inflammatory biomarkers. Environ Toxicol. 2023;38:2214–2224. doi: 10.1016/j.etap.2019.103306. [DOI] [PubMed] [Google Scholar]
- 56.Akaras N, Ileriturk M, Gur C, Kucukler S, Oz M, Kandemir FM. The protective effects of chrysin on cadmium-induced pulmonary toxicity; a multi-biomarker approach. Environ Sci Pollut Res. 2023;30:89479–89494. doi: 10.1007/s11356-023-28747-8. [DOI] [PubMed] [Google Scholar]
- 57.Cakmak F, Kucukler S, Gur C, Comakli S, Ileriturk M, Kandemir FM. Morin provides therapeutic effect by attenuating oxidative stress, inflammation, endoplasmic reticulum stress, autophagy, apoptosis, and oxidative DNA damage in testicular toxicity caused by ifosfamide in rats. Iran J Basic Med Sci. 2023;26:1227–1236. doi: 10.22038/IJBMS.2023.71702.15580. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Gur C, Kandemir FM. Molecular and biochemical investigation of the protective effects of rutin against liver and kidney toxicity caused by malathion administration in a rat model. Environ Toxicol. 2023;38:555–565. doi: 10.1002/tox.23700. [DOI] [PubMed] [Google Scholar]
- 59.Şimşek H, Küçükler S, Gür C, Akaras N, Kandemir FM. Protective effects of sinapic acid against lead acetate-induced nephrotoxicity: A multi-biomarker approach. Environ Sci Pollut Res. 2023;30:101208–101222. doi: 10.1007/s11356-023-29410-y. [DOI] [PubMed] [Google Scholar]
- 60.Akcılar R, Akcılar A, Şimşek H, Koçak FE, Koçak C, Yümün G, et al. Hyperbaric oxygen treatment ameliorates lung injury in paraquat intoxicated rats. Int J Clin Exp Pathol. 2015;8:13034–13042. [PMC free article] [PubMed] [Google Scholar]
- 61.Taştan Bal T, Akaras N, Demir Ö, Ugan RA. Protective effect of astaxanthin and metformin in the liver of rats in which the polycystic ovary syndrome model was formed by giving letrozole. Iran J Basic Med Sci. 2023;26:688–694. doi: 10.22038/IJBMS.2023.68032.14872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Akaras N, Bal T, Atilay H, Selli J, Halici MB. Protective effects of agomelatine on testicular damage caused by bortezomib. Biotech Histochem. 2017;92:552–559. doi: 10.1080/10520295.2017.1350748. [DOI] [PubMed] [Google Scholar]
- 63.Semis HS, Kandemir FM, Kaynar O, Dogan T, Arikan SM. The protective effects of hesperidin against paclitaxel-induced peripheral neuropathy in rats. Life Sci. 2021;287:120104. doi: 10.1016/j.lfs.2021.120104. [DOI] [PubMed] [Google Scholar]
- 64.Yılmaz S, Küçükler S, Şimşek H, Aygörmez S, Kandemir FM. Naringin protects against colistin-induced sciatic nerve damage by reducing oxidative stress, apoptosis and inflammation damage. J Exp Clin Med. 2024;41:53–59. [Google Scholar]
- 65.Motawi TK, Ahmed SA, El-Boghdady NA, Metwally NS, Nasr NN. Protective effects of betanin against paracetamol and diclofenac induced neurotoxicity and endocrine disruption in rats. Biomarkers. 2019;24:645–651. doi: 10.1080/1354750X.2019.1642958. [DOI] [PubMed] [Google Scholar]
- 66.El-Megharbel SM, Al-Salmi FA, Al-Harthi S, Alsolami K, Hamza RZ. Chitosan/selenium nanoparticles attenuate diclofenac sodium-induced testicular toxicity in male rats. Crystals. 2021;11:1477–1488. [Google Scholar]
- 67.Vyas A, Purohit A, Ram H. Assessment of dose-dependent reproductive toxicity of diclofenac sodium in male rats. Drug Chem Toxicol. 2019;42:478–486. doi: 10.1080/01480545.2017.1421659. [DOI] [PubMed] [Google Scholar]






