Characterization of the genome editing with miniature DNA nucleases TnpB and IscB in Escherichia coli strains

Hongjie Tang; Jie Gao; Hengyi Wang; Mingjun Sun; Suyi Zhang; Chuan Song; Qi Li

doi:10.1038/s42003-025-07521-1

. 2025 Feb 19;8:261. doi: 10.1038/s42003-025-07521-1

Characterization of the genome editing with miniature DNA nucleases TnpB and IscB in Escherichia coli strains

Hongjie Tang ¹, Jie Gao ¹, Hengyi Wang ¹, Mingjun Sun ¹, Suyi Zhang ^2,³, Chuan Song ^2,³, Qi Li ^1,^✉

PMCID: PMC11840021 PMID: 39972101

Abstract

DNA endonucleases TnpB and IscB are emerging candidates for combating drug-resistant bacteria, particularly Escherichia coli, due to their specificity in targeting DNA and smaller size. However, the genome-editing of TnpB/IscB in E. coli remains unclear. This study characterized the genome editing of TnpB/IscB in different E. coli strains. First, the toxicity and cleavage results indicated TnpB was effective only in MG1655, whereas IscB and enIscB demonstrated functionality in ATCC9637/BL21(DE3). Subsequently, a genome-editing tool was established in MG1655 by using TnpB (as a thermophilic programmable endonuclease), achieving up to 100% editing efficiency, while IscB/enIscB achieved editing in ATCC9637/BL21(DE3). Additionally, the editing plasmids were successfully cured. Finally, the mechanism underlying the escape of E. coli during TnpB/IscB editing was elucidated. Overall, this study successfully applied TnpB/IscB/enIscB to genome editing in E. coli, which will expand the genetic manipulation toolbox in E. coli and facilitate the development of the antimicrobial drugs.

Subject terms: CRISPR-Cas9 genome editing, Antimicrobial resistance

Characterization of the genome editing capabilities of the miniature TnpB and IscB proteins in various Escherichia coli strains provides insights into the escaping mechanisms of E. coli with the editing of TnpB and IscB.

Introduction

The emergence of microbial drug resistance has become a global concern due to its impact on healthcare systems^1–3. Escherichia coli is among the most prevalent drug-resistant microorganisms, highlighting the urgent need to develop new antimicrobial drugs to combat it^4–7. Although developing novel antibiotics is a common strategy, this approach does not adequately address the emerging drug resistance problems^8–11. Recent advances have introduced RNA-guided DNA nucleases as a promising strategy for eliminating drug-resistant microorganisms, owing to their high specificity for targeting DNA and efficient genome editing capabilities^12–15. Among these, CRISPR-Cas9 (Clustered regularly interspaced short palindromic repeats, CRISPR; CRISPR associated nuclease, Cas9) has been reported to be used for eliminating specific strains^16–21. However, the size of the Cas9 protein (1053–1368 amino acids, aa) poses a significant challenge for effective delivery to target cells. Therefore, there is an urgent need to identify smaller RNA-guided DNA nucleases to target drug-resistant microorganisms, providing valuable insights for the development of antimicrobial drug.

Recent research has identified two smaller RNA-guided DNA nucleases, including TnpB (Transposon-associated transposase B, 400 aa) and IscB (Insertion sequences Cas9-like B, 500 aa), both encoded by the IS200/IS605 superfamily transposons, which are hypothesized to be the ancestors of Cas12 and Cas9 respectively^22,23. Notably, both TnpB and IscB proteins utilize a single, long non-coding RNA (referred to as ωRNA) for RNA-guided cleavage of double-stranded DNA (dsDNA)^24,25.

TnpB has been reported to mediate DNA cleavage similarly to Cas12, cleaving target DNA complementary to the ωRNA guide sequence through a single RuvC domain and typically requires a 5-nucleotide (nt) target-adjacent motif (TAM) to recognize the 20 bp target DNA²⁶. Previous studies discovered that the TnpB protein encoded by prokaryotic IS200/IS605 transposons can cleave target DNA under the guidence of RNA and has been utilized for genome editing in human cells^26,27. Phylogenetic analysis has revealed the relationships of TnpB across six bacterial species by utilizing genomes with high assembly levels²⁸. Further studies have demonstrated that TnpB from Deinococcus radiodurans ISDra2 recognizes and cleaves dsDNA via its RuvC domain^24,29. Five hyper-compat editors within human cells were identified through the establishment of high-throughput screening of TnpB³⁰. Moreover, TnpB derived from Sulfolobus islandicus was characterized as a thermophilic programmable endonuclease, successfully applied for genome editing in Pediococcus acidilactici and Sulfolobus islandicus³¹. It has also been shown that TnpB can successfully optimize its mRNA into ωRNA³². Recent study reported that precise genome editing and phenotypic correction in a tyrosinemia mouse model can be achieved by using a transposon-linked TnpB-ωRNA system³³. Additionally, TnpB derived from thermophilic archaea exhibited flexible TAM requirements, which improve genome editing efficiency in its natural host³⁴. Finally, TnpB obtained from a Firmicutes bacterium has demonstrated the dsDNA cleavage activity³⁵.

The IscB protein is widely distributed among prokaryotes and is approximately two-fifths the size of Cas9 (500 aa). The study on the IscB protein derived from the human gut metagenome have shown that it shares a similar domain composition and architecture with Cas9³⁶, where the HNH domain cleaves the target DNA strand and the RuvC domain cuts the non-target DNA strand. Additionally, IscB requires a 3’ terminal TAM, usually 6-nt long, to recognize the 16 bp target DNA^25,37. Recent studies have reported the process by which the small IscB protein assembled with the ωRNA was revealed by analyzing the detailed architecture of the IscB-ωRNA complex^22,27. Furthermore, an enhanced IscB (enIscB) system carrying the four arginine mutations with the high efficiency in mammalian systems has been developed by optimizing the structure of the wild-type IscB³⁸.

The aforementioned studies have demonstrated the potential of two RNA-guided DNA nucleases for genome editing applications. Current research on TnpB, IscB, and enIscB mainly focused on genome editing in eukaryotic cells, with only one study reporting TnpB was applied in bacteria³¹, and the application of TnpB, IscB, and enIscB systems for genome editing in E. coli remains unexplored. In this study, commonly used E. coli strains, MG1655, ATCC9637, and BL21(DE3) were selected to explore the genome editing efficiencies of these three proteins. Simultaneously, the plasmid curing processes for the TnpB/IscB/enIscB-based genome editing systems were successfully implemented by using a two-step plasmid curing approach. Finally, we conducted a preliminary investigation into the mechanisms by which E. coli escaping under the editing by TnpB and IscB.

In summary, this study was the first to characterize the application of TnpB, IscB, and enIscB in E. coli strains, including MG1655, ATCC9637, and BL21(DE3). The smaller size of TnpB and IscB offers advantages over Cas9 or Cas12a in vector construction and potential delivery. These findings provide a research foundation for developing new antimicrobial drugs based on the RNA-guided DNA nucleases.

Results

TnpB-based genome editing tools worked in MG1655 but not in ATCC9637 and BL21(DE3)

As TnpB is the smallest programmable RNA-guided DNA nuclease currently available, the Sulfolobus islandicus-derived TnpB³¹ was initially explored for its genome editing efficiency in E. coli. Plasmids p15A-TnpB and pCK1 plasmid (control group, 10 kb) were transformed into E. coli MG1655, ATCC9637, or BL21(DE3), respectively (Fig. 1a), and the toxicity of the TnpB protein in E. coli was determined by measuring the transformation efficiency. The results demonstrated that the transformation efficiencies of p15A-TnpB (MolecularCloud number: MC_0101509) in MG1655 and BL21(DE3) were lightly less than pCK1 plasmid (control group), indicating that TnpB was less toxic to these strains (Fig. 1b, c). In contrast, a significant reduction in transformation efficiencies of p15A-TnpB was observed in ATCC9637 by counting the colony-forming units (CFU), with only approximately 10² CFU/μg plasmid DNA (Fig. 1b). Even if the copy number of TnpB was reduced, the transformation efficiency of pSC101-TnpB in ATCC9637 did not improve (Supplementary Fig. 1a, b). These results suggested that TnpB was toxic to ATCC9637, hindering its application for genome editing in this host. Thus, further cleavage activity tests for TnpB were conducted only in MG1655 and BL21(DE3).

Fig. 1 — a Schematic diagram illustrating the testing of p15A-TnpB toxicity in *E. coli* MG1655, ATCC9637, and BL21(DE3). b The calculation of toxicity of p15A-TnpB in *E. coli* MG1655, ATCC9637, and BL21(DE3). c The plating results for the verification of toxicity of p15A-TnpB in *E. coli* MG1655, ATCC9637, and BL21(DE3). d Workflow diagram for assessing the cleavage efficiencies of pSC101-TnpB/p15A-TnpB in *E. coli* MG1655 and BL21(DE3). e Genomic cleavage efficiencies in *E. coli* MG1655 and BL21(DE3) by using pSC101-TnpB. f Genomic cleavage efficiencies in *E. coli* MG1655 and BL21(DE3) by using p15A-TnpB. g Workflow for the gene deletion assay by using pSC101-TnpB or p15A-TnpB in *E. coli* MG1655. LHA represents the left homologous arm, and RHA represents the right homologous arm. h Targeted sites for gene deletion in *E. coli* MG1655. i PCR amplification results of the deletion of *maeB* and *umuDC* genes in *E. coli* MG1655 by using pSC101-TnpB. j DNA sequencing results of the deletion of *maeB* and *umuDC* genes in *E. coli* MG1655 by using pSC101-TnpB. k PCR amplification results of the deletion of *maeB* and *umuDC* genes in *E. coli* MG1655 by using p15A-TnpB. l DNA sequencing results of the deletion of *maeB* and *umuDC* genes in MG1655 by using pSC101-TnpB. b, e, f n = 3 independent experiments. Error bars represent mean ± SEM. Statistical significance was determined by using one-way ANOVA analysis: ns (not significant); *(p < 0.05); **(p < 0.01).

RNA-guided DNA nucleases cleave target DNA to form a double-strand break (DSB). However, most current genome editing tools in bacteria rely on exogenous homologous arms to repair the DSB through homologous recombination^39,40. Based on this principle, the cleavage activities of TnpB in MG1655 or BL21(DE3) were therefore tested without providing repair homologous arms. First, we tested the cleavage activity of TnpB by using plasmid DNA containing a 20 bp target DNA sequence with a TAM at its 5’-end (5’-TTTAA-3’). The pωRNA-TnpB-maeB or pωRNA-TnpB-umuDC plasmids, which target the maeB or umuDC genes and the pCK2 plasmid (control group, 2.5 kb), were transformed into MG1655 and BL21(DE3) carrying pSC101-TnpB or p15A-TnpB (Fig. 1d). Notably, the transformation efficiency of pωRNA-TnpB-maeB or pωRNA-TnpB-umuDC in MG1655 harboring pSC101-TnpB or p15A-TnpB was approximately 10² CFU/μg plasmid DNA, which represented a four-order magnitude drop compared to the control plasmid. In contrast, in BL21(DE3), transformation efficiencies were similar to the control plasmid, with approximately 10⁶ CFU/μg plasmid DNA (Fig. 1e, f and Supplementary Fig. 2). These findings suggested that TnpB was active in cleaving genomic DNA of MG1655, but not in BL21(DE3). Consequently, the gene deletion efficiency of TnpB was measured only in MG1655.

To repair the DSB formed by TnpB excision in MG1655, the upstream and downstream repair homologous arms (in linear dsDNA form) for the maeB or umuDC genes, along with the corresponding pωRNA-TnpB-targetX plasmids, were co-electroporated into MG1655 carrying pSC101-TnpB or p15A-TnpB. Approximately 15 colonies were randomly selected from the plates for verification by colony PCR. However, no positive colonies were identified (Supplementary Fig. 3). It was speculated that the double-stranded form of the homologous arms in MG1655 carrying pSC101-TnpB or p15A-TnpB might have been unstable, leading to its degradation. Thus, the homologous arms were inserted into pωRNA-TnpB-maeB or pωRNA-TnpB-umuDC to generate plasmids pωRNA-TnpB-maeB-THR or pωRNA-TnpB-umuDC-THR, respectively. These plasmids were also electroporated into MG1655 containing pSC101-TnpB or p15A-TnpB, respectively (Fig. 1g, h). Again, 15 colonies were randomly selected for colony PCR verification. Fortunately, both maeB and umuDC genes were successfully deleted with efficiencies of 30% and 100%, respectively. The PCR products were further sequenced to confirm successful editing (Fig. 1i–l). Additionally, we conducted a replicate experiment, selecting another 69 colonies randomly to validate the accuracy of these data statistics. The results showed that the editing efficiency of the maeB gene was approximately 50% in MG1655 carrying pSC101-TnpB (Supplementary Fig. 4), the result consistent with the original findings. Overall, these results showed that gene deletion in E. coli MG1655 can be achieved by using TnpB, but the homologous arms need to be provided in the form of plasmids rather than linear dsDNA.

Efficient genome editing could be achieved in ATCC9637 and BL21(DE3) by using IscB but not in MG1655

The results showed that TnpB-based genome editing is only viable in MG1655, indicating a limitation in TnpB application. Therefore, our attention was moved to the IscB protein, which is derived from the human intestinal microbiome³⁸, and it also has a small size (500 aa). We aimed to explore whether IscB could bridge the gap left by TnpB. First, the pSC101-IscB plasmid and the pCK1 plasmid were introduced into E. coli MG1655, ATCC9637, and BL21(DE3). After assessing the transformation efficiency, the results showed that the transformation efficiencies of pSC101-IscB in ATCC9637 and BL21(DE3) were lightly less than the pCK1 plasmid, indicating that IscB protein was less toxic to these strains (Fig. 2a). In contrast, the transformation efficiency in MG1655 was decreased by 4 orders of magnitude compared to the pCK1 plasmid, indicating that IscB was toxic to MG1655 (Fig. 2a and Supplementary Fig. 1c). Based on these observations, subsequent testings of the cleavage activities of IscB were carried out only in ATCC9637 and BL21(DE3).

Fig. 2 — a The verification of the toxicity of pSC101-IscB/p15A-IscB in *E. coli* MG1655, ATCC9637, and BL21(DE3). b Genome cleavage efficiencies in *E. coli* ATCC9637 and BL21(DE3) by using pSC101-IscB/p15A-IscB. c Schematic diagram of pSC101-IscB/p15A-IscB-mediated gene editing in *E. coli* ATCC9637 and BL21(DE3). LHA represents the left homologous arm, and RHA represents the right homologous arm. d Target sites of different genes in *E. coli* ATCC9637 and BL21(DE3). e Gene deletion efficiencies of pSC101-IscB or p15A-IscB in *E. coli* ATCC9637. f Gene deletion efficiencies of pSC101-IscB or p15A-IscB in *E. coli* BL21(DE3). g Colony PCR results showing the deletion of the *rpoS, maeB, and umuDC* genes in ATCC9637 using pSC101-IscB. h Colony PCR results showing the deletion of the *rpoS, maeB, and umuDC* genes in BL21(DE3) by using pSC101-IscB. i PCR amplification results demonstrating the deletion of the *rpoS, maeB, and umuDC* genes in ATCC9637 by using p15A-IscB. j PCR amplification results demonstrating the deletion of the *rpoS, maeB, and umuDC* genes in BL21(DE3) by using p15A-IscB. a, b Error bars represent mean ± SEM (n = 3). Statistical significance was determined by using one-way ANOVA analysis: ns (not significant); *(p < 0.05); **(p < 0.01); ***(p < 0.001).

We first evaluated the cleavage activity of IscB by using plasmid DNA containing a 16 bp target DNA sequence with a TAM (5’-CAGGAA-3’) at its 3’-end. Similarly, the pωRNA-IscB-rpoS, pωRNA-IscB-maeB, or pωRNA-IscB-umuDC plasmids which anchor the rpoS, maeB, or umuDC genes, along with the pCK2 plasmid were electroporated into ATCC9637 and BL21(DE3) harboring pSC101-IscB. The transformation efficiencies of the pωRNA-IscB-rpoS, pωRNA-IscB-maeB, or pωRNA-IscB-umuDC plasmids in ATCC9637 and BL21(DE3) harboring pSC101-IscB were approximately 10² CFU/μg plasmid DNA, significantly lower than the control (Fig. 2b and Supplementary Fig. 5a). These findings indicated that the IscB protein could cleave the target genes in ATCC9637 and BL21(DE3). Subsequently, the gene deletion efficiencies of IscB in these two strains were further tested.

The repair homologous arms of the rpoS, maeB, or umuDC genes (in linear dsDNA) along with the corresponding pωRNA-IscB-targetX plasmids were co-electroporated into ATCC9637 and BL21(DE3) containing pSC101-IscB to assess gene deletion efficiency (Fig. 2c, d). Approximately 15 colonies were randomly selected for PCR verification. The results showed that the maeB and umuDC genes were deleted with efficiencies of 50% and 80%, respectively, in both E. coli strains, while the editing efficiency of the rpoS gene ranged from 30% to 60% (Fig. 2e–h and Supplementary Fig. 6a, b). Additionally, we replicated the deletion experiments for the maeB gene in E. coli ATCC9637 and BL21(DE3) containing pSC101-IscB to ensure the accuracy of these data. Another 69 colonies were randomly selected for PCR verification, revealing editing efficiencies of approximately 40% in ATCC9637 and 50% in BL21(DE3) for the maeB site (Supplementary Fig. 7, 8), consistent with the original editing efficiencies observed in these strains. Overall, these results showed that IscB can facilitate genome editing in ATCC9637 and BL21(DE3) by using linear homologous donor DNA.

Based on our previous research, it was found that increasing the copy number of Cas9 could improve genome editing efficiency in E. coli⁴¹. Thus, we hypothesized that increasing the copy number of IscB might similarly impact genome editing efficiency in E. coli. Subsequently, IscB was placed on a p15A backbone with a higher copy number (10 copies). The p15A-IscB plasmid and the pCK1 plasmid were then transformed into ATCC9637 and BL21(DE3) to assess the toxicity of IscB. The results showed that the transformation efficiencies of p15A-IscB in ATCC9637 and BL21(DE3) were approximately 10⁵ CFU/μg plasmid DNA, comparable to the transformation efficiency of pSC101-IscB (Fig. 2a and Supplementary Fig. 1c). Then, the pωRNA-IscB-rpoS, pωRNA-IscB-maeB, or pωRNA-IscB-umuDC plasmids, targeting the rpoS, maeB, or umuDC genes, along with the pCK2 plasmid were transformed into ATCC9637 and BL21(DE3) containing p15A-IscB. It was found that all three genes could be cleaved using p15A-IscB, with transformation efficiencies of both pωRNA-IscB-maeB and pωRNA-IscB-umuDC approximately 10² CFU/μg plasmid DNA. However, the transformation efficiency for pωRNA-IscB-rpoS was reduced by 6 orders of magnitude compared to the control, with the transformation efficiency of 0 (Fig. 2b and Supplementary Fig. 5b). These results showed that the cleavage efficiency of the rpoS gene could be improved through using a high-copy number plasmid to express gene encoding IscB.

Furthermore, the repair homologous arms of the rpoS, maeB, or umuDC genes, along with the corresponding pωRNA-IscB-targetX plasmids were co-electroporated into ATCC9637 and BL21(DE3) harboring p15A-IscB (Fig. 2c). Results from DNA gel electrophoresis indicated that the editing efficiencies at the maeB and umuDC sites were approximately 30%, while the editing efficiency at the rpoS site ranged from 6% to 20% in these two E. coli strains (Fig. 2e, f, i, j and Supplementary Fig. 6c, d). Compared to the gene deletion efficiency observed with pSC101-IscB, these findings suggested that increasing the copy number of IscB does not significantly improve genome editing efficiency.

Genome editing in E. coli ATCC9637 and BL21(DE3) could also be achieved by using enIscB

A previous study optimized the IscB protein, resulting in an enIscB system, which significantly improved base-editing efficiency in eukaryotic cells (Fig. 3a)³⁸. This study aimed to evaluate whether enIscB could also improve genome editing efficiency in E. coli. The pSC101-enIscB plasmid and the pCK1 plasmid were transformed into the three E. coli strains. Toxicity testing showed that the transformation efficiencies of enIscB were similar to those observed with IscB. Specifically, the transformation efficiency of enIscB in MG1655 was 10² CFU/μg plasmid DNA, while in ATCC9637 and BL21(DE3) was approximately 10⁵ CFU/μg plasmid DNA (Fig. 3b and Supplementary Fig. 1d). Due to the lower transformation efficiency in MG1655, subsequent tests on cleavage activity of enIscB were carried only in ATCC9637 and BL21(DE3). To evaluate the cleavage activity, the pωRNA-IscB-rpoS, pωRNA-IscB-maeB, or pωRNA-IscB-umuDC plasmids and the pCK2 (control) plasmid were transformed into ATCC9637 or BL21(DE3) containing pSC101-enIscB. The results showed that the enIscB could efficiently cleave the rpoS, maeB, and umuDC genes in these three E. coli strains, with transformation efficiencies of 0, 10², and 10² CFU/μg plasmid DNA, respectively (Fig. 3c and Supplementary Fig. 9a).

Fig. 3 — a Schematic representation of the enIscB variant gene structure. b Verification of the toxicity of pSC101-enIscB/p15A-enIscB in *E. coli* MG1655, ATCC9637, and BL21(DE3). c Cleavage efficiencies of pSC101-enIscB/p15A-enIscB at different targeted genes in *E. coli* ATCC9637 and BL21(DE3). d Gene deletion efficiencies in *E. coli* ATCC9637 by using pSC101-enIscB or p15A-enIscB. e Gene deletion efficiencies in *E. coli* BL21(DE3) by using pSC101-enIscB or p15A-enIscB. b, c Error bars represent mean ± SEM (n = 3). The p-value was calculated by using one-way ANOVA analysis: *(p < 0.05); **(p < 0.01); ***(p < 0.001).

Next, the efficiency of genome editing was assessed by co-electroporating repair homologous arms (in the form of linear dsDNA) for the rpoS, maeB, and umuDC genes, along with their corresponding pωRNA-IscB-targetX plasmids, into ATCC9637 or BL21(DE3) containing pSC101-enIscB. Colony PCR was used to analyze the sizes of target bands. The results indicated successful editing of all three genes, with editing efficiencies for the rpoS gene reaching 70% in ATCC9637 and BL21 (DE3). In contrast, editing efficiencies for maeB and umuDC genes ranged from 10% to 40% (Fig. 3d, e and Supplementary Fig. 10a, b).

Based on the above results, we wondered whether increasing the copy number of enIscB could further enhance editing efficiency in E. coli. Thus, the enIscB gene was subsequently inserted into the p15A plasmid vector. The toxicity, cleavage efficiencies, and gene deletion assays for p15A-enIscB in ATCC9637 and BL21(DE3) followed the same procedures used previously. The transformation efficiencies for pωRNA-IscB-maeB and pωRNA-IscB-umuDC were 10² CFU/μg plasmid DNA, consistent with results obtained when enIscB copy number was increased (Fig. 3c and Supplementary Fig. 9b). Further analysis of gene deletion efficiencies with p15A-enIscB revealed successful deletion of the rpoS, maeB, and umuDC genes in ATCC9637 and BL21(DE3), with the editing efficiencies ranging from 6% to 30% across 15 randomly selected colonies (Fig. 3d, e and Supplementary Fig. 10c, d). These above results showed that the enIscB system possessed a comparable editing efficiency to the IscB system.

Plasmid elimination in TnpB/IscB/enIscB-based genome editing systems was achieved by a two-step plasmid curing strategy

Plasmids involved in genome editing must be removed to facilitate further phenotypic testing or additional rounds of genome editing. A two-step plasmid curing strategy was implemented, where the pωRNA plasmid series was eliminated first, followed by the curing of pTnpB/pIscB/penIscB plasmids (Fig. 4a). The maeB mutant of E. coli MG1655 containing pSC101-TnpB was used as an example. The edited MG1655 strain containing pSC101-TnpB was cultured overnight in liquid LB medium supplemented with kanamycin (50 µg/mL). After approximately 24 h of growth over two cycles, single colonies were isolated and screened on LB plates for sensitivity to spectinomycin (50 µg/mL) and resistance to kanamycin (50 µg/mL), confirming the loss of the pωRNA-TnpB-maeB-THR plasmid. Next, the pSC101-TnpB plasmid carried the levansucrase gene sacB, which encodes an enzyme that converts sucrose to levan, a compound that is highly toxic to E. coli⁴². The sacB gene was selected as the counterselective marker (Fig. 4a). The edited MG1655 strain was cultured on LB plates containing sucrose (10 g/L). Positive colonies were further tested for kanamycin sensitivity (50 µg/mL) to confirm the loss of the pSC101-TnpB plasmid.

Fig. 4 — a Overview of the two-step plasmid curing process. The pωRNA series plasmids were eliminated first, followed by curing of the pTnpB/pIscB/penIscB plasmids. The yellow box represents the *sacB* gene, which encodes a product that converts sucrose into levan, accumulating in the periplasm and exerting toxicity to *E. coli*. Thus, the *sacB* gene was used as a counter-selective marker. b Confirmation of the genotypes for *E. coli* MG1655Δ*maeB*, *E. coli* ATCC9637 Δ*maeB*, or *E. coli* BL21(DE3) Δ*maeB*. c Plating verification results for curing of the pωRNA series plasmids. d Plating verification results for plasmid curing of the pTnpB/pIscB/penIscB plasmids.

The plating results showed that the plasmid curing efficiency for pωRNA-TnpB-maeB-THR in MG1655 was 2 out of 66. In ATCC9637, the curing efficiency of pωRNA-IscB-maeB varied from 1 out of 66 to 2 out of 66. Similarly, the curing efficiency in BL21(DE3) was comparable, ranging from 1 out of 66 to 3 out of 66 (Fig. 4b, c and Table 1). The curing of pTnpB/pIscB/penIscB plasmids was also analyzed. Remarkably, all 66 strains containing the maeB mutation in MG1655 lost the pSC101-TnpB plasmid. Furthermore, the results of plasmid curing for pSC101-IscB/pSC101-enIscB in ATCC9637 and BL21(DE3) were similar, with curing efficiencies of 66 out of 66 for both strains (Fig. 4b, d and Table 1). These results showed the plasmids elimination of TnpB/IscB/enIscB-based genome editing systems can be accomplished successfully by using two-step plasmid curing strategy.

Table 1.

Summary of the applications of the pTnpB/pωRNA, pIscB/pωRNA, and penIscB/pωRNA systems for genome editing in E. coli MG1655, ATCC9637, and BL21(DE3)

Strains	Plasmids	Toxicity	Target	N20/N16	Editing efficiency	Plasmid curing efficiency
MG1655	pSC101-TnpB	less toxic	maeB	agcgcggatcggattcgtta	5/15	pωRNA: 2/66 pTnpB: 66/66
			umuDC	tgtcgtgctcgaaagaacgg	15/15
	p15A-TnpB	less toxic	maeB	agcgcggatcggattcgtta	3/15
			umuDC	tgtcgtgctcgaaagaacgg	15/15
	pSC101-IscB	toxic
	p15A-IscB	toxic
	pSC101-enIscB	toxic
	p15A-enIscB	toxic
ATCC9637	pSC101-TnpB	toxic
	p15A-TnpB	toxic
	pSC101-IscB	less toxic	rpoS	aaaggccttagtagaa	9/15
			maeB	cccgaaagtgctgacc	7/15	pωRNA: 2/66 pIscB: 66/66
			umuDC	gtttgcaccgacgaag	12/15
	p15A-IscB	less toxic	rpoS	aaaggccttagtagaa	1/15
			maeB	cccgaaagtgctgacc	5/15
			umuDC	gtttgcaccgacgaag	4/15
	pSC101-enIscB	less toxic	rpoS	aaaggccttagtagaa	10/15
			maeB	cccgaaagtgctgacc	2/15	pωRNA: 1/66 penIscB: 66/66
			umuDC	gtttgcaccgacgaag	4/15
	p15A-enIscB	less toxic	rpoS	aaaggccttagtagaa	2/15
			maeB	cccgaaagtgctgacc	1/15
			umuDC	gtttgcaccgacgaag	1/15
Bl21(DE3)	pSC101-TnpB	less toxic, but unsuccessful in cleavage
	p15A-TnpB	less toxic, but unsuccessful in cleavage
	pSC101-IscB	less toxic	rpoS	aaaggccttagtagaa	4/15
			maeB	cccgaaagtgctgacc	8/15	pωRNA:1/66 pIscB:66/66
			umuDC	gtttgcaccgacgaag	13/15
	p15A-IscB	less toxic	rpoS	aaaggccttagtagaa	3/15
			maeB	cccgaaagtgctgacc	4/15
			umuDC	gtttgcaccgacgaag	4/15
	pSC101-enIscB	less toxic	rpoS	aaaggccttagtagaa	8/15
			maeB	cccgaaagtgctgacc	3/15	pωRNA: 3/66 penIscB: 66/66
			umuDC	gtttgcaccgacgaag	6/15
	p15A-enIscB	less toxic	rpoS	aaaggccttagtagaa	4/15
			maeB	cccgaaagtgctgacc	3/15
			umuDC	gtttgcaccgacgaag	2/15

Open in a new tab

Preliminary uncovering the mechanisms of E. coli escaping from TnpB/IscB-based genome editing

Microorganisms may survive under the cleavage of RNA-guided DNA nucleases (called escapers). Understanding the factors contributing to these escapers can enhance the development of highly efficient antimicrobial strategies⁴³. To investigate the escape rate of E. coli during genome editing with TnpB/IscB, the maeB (non-essential gene) gene were selected as the targeted sites. As an example, the plasmid pωRNA-TnpB-maeB which targets the maeB gene and the control plasmid pCK2 were separately transformed into E. coli MG1655 containing the pSC101-TnpB. The escapers were isolated from LB agar plates plates containing kanamycin and spectinomycin, and the escape rate was determined. The results showed that the escape rate of maeB editing in MG1655 was approximately 10⁻⁴, similar to the escape rate observed in ATCC9637. In contrast, BL21(DE3) showed a lower escape rate of 2 × 10⁻⁵ (Fig. 5a).

Fig. 5 — a Cell survival fractions under targeting of the *maeB* site across different *E. coli* strains. b Sizes of pSC101-TnpB/pSC101-IscB and pωRNA series plasmids extracted from escapers obtained at the *maeB* site. Ck1 represents the original pSC101-TnpB/pSC101-IscB, and ck2 represents the original pωRNA-TnpB-*maeB/*pωRNA-IscB-*maeB*. c Mutation types and frequencies in the coding sequences of TnpB, IscB, and ωRNA from different escapers obtained at the *maeB* site. a The error bar represent mean ± SEM (n = 3). The p-value was calculated by using one-way ANOVA analysis: **(p < 0.01); ***(p < 0.001).

To explore the factors contributing to the escape of E. coli MG1655, ATCC9637, and BL21(DE3) under the editing of TnpB/IscB systems, the plasmid sizes of those expressing TnpB/IscB or ωRNA were analyzed. Ten escapers were randomly selected from the plates, pSC101-TnpB/pSC101-IscB plasmids and pωRNA were extracted, and the sizes of those plasmids were examined on an agarose gel along with the controls (ck1 was the original pSC101-TnpB/pSC101-IscB, and ck2 was the original pωRNA-TnpB-maeB/pωRNA-IscB-maeB). Although no size changes were observed for the pSC101-TnpB plasmid in MG1655, the pωRNA-TnpB-maeB plasmids in escapers 1, 2, 3, 4, 5, 7, 8, 9, and 10 were significantly smaller than the ck2 (Fig. 5b). Additionally, the significant size changes were detected in both pSC101-IscB and pωRNA series plasmids in ATCC9637 and BL21(DE3) (Fig. 5b). Subsequently, DNA sequencing of the TnpB, IscB, and ωRNA coding regions from the ten escapers targeting the maeB site revealed various mutations. In MG1655, point mutations in the TnpB coding sequence and large deletions in the ωRNA sequence were observed (Fig. 5c). In ATCC9637 and BL21(DE3), multiple mutation types were observed across all IscB and ωRNA sequences, with point mutations and small-sertion in the ωRNA sequence being predominant (Fig. 5c). Details on the exact mutation locations in the TnpB, IscB, and ωRNA sequences were provided in Supplementary Figs. 11–13. These results showed that mutations in the ωRNA coding sequence are the primary cause of escapers in E. coli under TnpB/IscB-meditated genome editing. It was also noteworthy that the majority of the mutation and insertion of ωRNA coding sequences were distributed at the 5’-end. Further investigation the escaping reasons into the mechanisms behind E. coli escape from the editing of TnpB/IscB may facilitate the establishment of TnpB/IscB-based genome editing tools and the development of TnpB/IscB-based new antimicrobial drugs. In addition, we also carried out a series of repeated testings to calculated the escape rate of maeB and umuDC in different E. coli strains. It was demonstrated that the escape rates of the maeB and umuDC sites were approximately 10⁻⁵ ~ 10⁻⁴ by using TnpB/IscB/enIscB systems (Supplementary Fig. 15).

Discussion

The growing problem of drug resistance in E. coli has been reported in several studies, highlighting the urgent need for novel strategies to combat these drug-resistant strains^5–7. While CRISPR-Cas9 has been explored for the targeted elimination of specific bacterial strains, the large size of Cas9 (1053–1368 aa) poses a significant challenge for efficient delivery, representing a major bottleneck in the development of CRISPR-Cas9-based antimicrobial agents. In contrast, TnpB and IscB which are ancestral proteins of Cas12 and Cas9, respectively, are significantly smaller, with only about two-fifths the size of Cas9. This smaller size provides a distinct advantage for cellular delivery, making TnpB and IscB promising candidates for developing the compact genome-editing tools.

Hence, given the significant advantages of smaller-sized TnpB, IscB, and enIscB proteins, they are considered a more effective strategy for addressing the problem of drug resistance in E. coli. In this study, common E. coli strains, including MG1655, ATCC9637, and BL21(DE3) were used as the research objects to test the application of TnpB, IscB, and enIscB. First, the toxicity of TnpB, IscB, and enIscB proteins in these three E. coli strains was determined by measuring transformation efficiencies (Supplementary Fig. 1a–d). The results indicated that the expression of the TnpB protein was toxic to ATCC9637, while the expression of IscB and enIscB proteins was toxic to MG1655. It was hypothesized that the introduction of TnpB, IscB, or enIscB proteins may activate the expression of certain genes that are typically repressed in the host⁴⁴. However, the mechanisms underlying the toxicity of TnpB, IscB, and enIscB proteins in these E. coli strains have not been well studied.

The RNA-guided DNA nucleases cleave bacterial genomic DNA to form a DSB, which are typically repaired through homologous recombination or nonhomologous end joining pathways^45–47. However, only a limited number of bacteria contain the NHEJ mechanism⁴⁸. Hence, most current genome editing tools in bacteria rely on exogenously providing the homologous arms to facilitate DSB repair via homologous recombination^39,40. In the absence of an exogenous repair template, DSB induced by DNA nucleases in bacteria are often irreparable, leading to cell death. This principle has been applied to the development of CRISPR-based antimicrobials⁴⁹. Subsequently, the cleavage efficiencies of TnpB, IscB, and enIscB were evaluated in corresponding E. coli strains, and transformation efficiencies were measured to determine the cleavage activities (Supplementary Figs. 2, 5). The results showed that TnpB exhibited cleavage activity in MG1655, while IscB and enIscB effectively cleaved target genes in ATCC9637 and BL21(DE3). Overall, IscB and enIscB proteins exhibited superior efficiencies for cleaving the E. coli genome compared to the TnpB protein. It was hypothesized that the cleavage activity of TnpB in E. coli may be influenced by temperature selection, as previous reports indicate that TnpB performs optimally between 65 and 75 °C³¹.

Furthermore, the gene deletion efficiencies of TnpB, IscB, and enIscB in E. coli were evaluated. The results showed that the TnpB could successfully achieved gene knockout in MG1655, with an editing efficiency of 100%. This finding was consistent with the editing efficiency of pEcCas-2.0 system in E. coli established by our previous study⁴¹. In contrast, gene deletion in ATCC9637 and BL21(DE3) was achieved by using IscB and enIscB, with efficiencies ranging from 13% to 87% (Table 1), thereby addressing the limitations observed with TnpB. Future research could optimize the application of TnpB, IscB and enIscB for genome editing by implementing conditionally induced promoters, adjusting the length of the homologous arm, or modifying the ωRNA sequence⁵⁰.

Previous research on Cas9 demonstrated that increasing its copy number could improve genome editing efficiency in E. coli⁴¹. Therefore, we aimed to optimize gene editing tools by increasing the copy number of IscB or enIscB. However, this approach had minimal impact on improving gene deletion efficiency. Although TnpB enabled successful gene deletion in E. coli MG1655, it required the use of plasmid-based homologous arms provided on plasmids. In contrast, IscB and enIscB allowed for more efficient editing when the homologous arms were supplied as a linear dsDNA, making the procedure less labor-intensive⁵¹. Interestingly, increasing the amounts of the homologous arms from 400 ng to 800 ng by using p15A-enIscB significantly improved gene deletion efficiency in E. coli, with the deletion efficiency increasing from 0 to 30% (Supplementary Fig. 14). Although the gene deletion efficiencies achieved with TnpB and IscB were comparable to those of Cas9-based tools, the smaller size of these DNA nucleases (500 aa) offers distinct advantages for delivery (Table 1). The results showed that the pωRNA series plasmids and pTnpB/pIscB/penIscB plasmids can be efficiently eliminated through a two-step plasmid curing strategy that takes approximately 4 days for a one-round curing process (Table 1). Notably, the plasmid curing efficiencies of the TnpB/IscB/enIscB-based genome editing system can accomplish a 100% success rate. Furthermore, the escape rate of E. coli strains under thr cleavage of TnpB/IscB was assessed. The escape mechanisms involved point mutations in the TnpB, IscB, and ωRNA coding sequences, along with small insertions and large deletions in the ωRNA coding sequence. Notably, the escape rates of maeB and umuDC sites were approximately 10⁻⁵ ~ 10⁻⁴ by using TnpB/IscB/enIscB in our study (Supplementary Fig. 15). The escape rates of above these sites were low compared to the previous study⁴¹. These insights into the escape mechanisms and findings provide a foundational understanding that could facilitate the applications of TnpB/IscB-based genome editing tools and contribute to the development of new antimicrobial drugs.

In summary, this study systematically characterized the application of TnpB, IscB, and enIscB in different E. coli strains. A TnpB-based genome editing tool was successfully established in E. coli MG1655. On the other hand, the genome editing in E. coli ATCC9637 and BL21(DE3) was achieved by using IscB and enIscB. Additionally, the editing plasmids for TnpB, IscB, and enIscB were successfully cured. The mechanisms underlying E. coli escape from the editing of TnpB/IscB editing were also investigated. Given the smaller size of TnpB, IscB, and enIscB compared to Cas9, they offer significant advantages for genome editing applications and provide promising new research ideas and methods for combating drug-resistant microorganisms. Further exploration and characterization of the TnpB and IscB families could broad their functional roles in compact CRISPR toolboxes for targeted genome manipulation and provide new perspectives in basic cell research.

Methods

Bacterial strains and culture methods

E. coli DH5α was selected as the cloning host for plasmid construction, while E. coli MG1655, BL21(DE3), and ATCC9637 strains were used in this study. These strains were cultured in LB medium containing 0.5% yeast extract, 1% [w/v] tryptone and 1% [w/v] NaCl maintained at 37 °C. When necessary, antibiotics were added to the LB medium at the following concentrations: chloramphenicol (25 μg/mL), kanamycin (50 μg/mL), and spectinomycin (100 μg/mL). Strains were preserved at −80 °C with 20% glycerol. The recovery process was carried out by streaking the stored culture onto an LB agar plate and then inoculating the isolated colony into LB broth. The strains used in this study are listed in Supplementary Table 1.

Reagents and enzymes

The restriction endonucleases used in this study were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Plasmid extraction kits were used from Tiangen (Tiangen Biotech Co., Ltd., Beijing, China), while DNA purification kits were obtained from Transgen (Beijing, China). DNA amplification was performed by using DNA polymerases KOD plus Neo (Toyobo Co., Ltd, Osaka, Japan) for high-fidelity applications and 2×Es Taq MasterMix (Dye) (Jiangsu Cowin Biotech Co., Ltd., Taizhou, China) for colony PCR. The plasmid assembly was performed by using the ClonExpress One Step Cloning Kit-C116/C112 (Vazyme Biotechnology Co., Ltd., Nanjing, China).

Plasmids construction

All plasmids and primers used in this study are listed in Supplementary Tables 1, 2. E. coli DH5α was chosen for the purpose of maintaining and constructing plasmids. The TnpB gene sequences were obtained from the plasmid pSisTnpB-ωRNA³¹, while the IscB and enIscB gene sequences were sourced from the pIscB-ωRNA and penIscB-ωRNA plasmids, respectively³⁸. Take the pSC101-TnpB (MolecularCloud number: MC_0101508) plasmid as an example, the TnpB gene was amplified via PCR, purified, treated with DpnI enzyme, and cloned into the linearized pSC101 vector (5 copies) to generate the pSC101-TnpB plasmid, which enables the constitutive expression of the TnpB. The constructions of the pSC101-IscB (MolecularCloud number: MC_0101510)/p15A-IscB (MolecularCloud number: MC_0101511) and pSC101-enIscB (MolecularCloud number: MC_0101512)/p15A-enIscB (MolecularCloud number: MC_0101513) plasmids followed a similar procedure, with the TnpB, IscB, and enIscB genes expressed constitutively in these plasmids. Sequence information for TnpB, IscB, and enIscB are provided in Supplementary Table 3.

For the construction of the pωRNA-TnpB-targetX series plasmids (targetX was represented as the target gene; MolecularCloud number: MC_0101516), the gRNA sequence on the original pEcgRNA plasmid was replaced with the ωRNA-coding DNA sequence derived from pSisTnpB-ωRNA plasmid³¹. Similarly, for the pωRNA-IscB-targetX plasmids (MolecularCloud number: MC_0101514), the gRNA in pEcgRNA was substituted with the ωRNA-coding DNA sequence from pIscB-ωRNA plasmid³⁸. For the construction of pωRNA-TnpB-targetX-THR plasmids, homologous arms (500 bp) amplified from the genomic DNA of E. coli were inserted into pωRNA-TnpB-targetX plasmid to generate pωRNA-TnpB-targetX-THR (MolecularCloud number: MC_0101515).

Plasmid transformation and testing the toxicity of TnpB, IscB, and enIscB in E. coli

The competent cells for E. coli strains, including MG1655, ATCC9637, and BL21(DE3), were prepared for electroporation using previously described methods^48,52. For example, to assess the toxicity of TnpB, 100 μL of competent cells from each strain was mixed with 100 ng TnpB, including both pSC101-TnpB and p15A-TnpB. As a control, the pCK1 plasmid (10 kb), known to be nontoxic to E. coli MG1655, ATCC9637, and BL21(DE3) was included in the experiment. The electroporation was performed in a cooled 2-mm Gene Pulser cuvette (Bio-Rad, Hercules, USA) at a voltage of 2.5 kV. After electroporation, the mixture was immediately suspended in the fresh LB broth and incubated at 37 °C for 1 h. Subsequently, the recovered cells were plated on an LB solid medium containing kanamycin (for pSC101-TnpB) or chloramphenicol (for p15A-TnpB) and incubated overnight at 37 °C. The colonies that grew on the plates were calculated as the colony-forming units (CFU), and the plasmid transformation efficiency was determined. If the transformation efficiency on TnpB was significantly lower than the control plasmid, the protein was considered toxic to the host. Conversely, if the transformation efficiency of TnpB was comparable to the control plasmid, the protein was recognized as nontoxic to the host.

The procedure for testing the toxicity of IscB and enIscB in E. coli strains followed the same protocol. Plasmids carrying IscB or enIscB proteins, including pSC101-IscB/p15A-IscB and pSC101-enIscB/p15A-enIscB, were transformed into E. coli and the transformation efficiencies were recorded to determine the toxicity of these proteins in the respective E. coli stains.

Testing the cleavage activities of TnpB, IscB, and enIscB in E. coli

The cleavage activities of TnpB, IscB, and enIscB were assessed by using proteins that exhibited low toxicity to their respective host strains. The cleavage testing of TnpB was shown as an example, 100 µL of competent E. coli cells carrying plasmids expressing TnpB, including pSC101-TnpB/p15A-TnpB, were mixed with 100 ng of the pωRNA-TnpB-targetX series plasmid, along with the pCK2 control plasmid (2.5 kb) which does not target any sites in the genome respectively. Following electroporation, the mixture was suspended in 1 mL of freshly prepared LB broth and then placed in an incubator set at 37 °C for a duration of 1 h. The recovered cells were plated onto LB solid medium supplemented with spectinomycin and kanamycin (for pSC101-TnpB) or spectinomycin and chloramphenicol (for p15A-TnpB). The plates were incubated throughout the night at 37 °C, and CFU were counted with the aim of calculating the plasmid transformation efficiency. If the transformation efficiency of TnpB was comparable to the control plasmid, it indicated that the protein did not cleave the host genomic DNA. Conversely, if the transformation efficiency of TnpB was significantly lower by at least two orders of magnitude than the control plasmid, it suggested that the protein was capable of cleaving the host genomic DNA.

The cleavage testing of IscB and enIscB followed a similar procedure. Plasmids carrying IscB or enIscB proteins, including pSC101-IscB/p15A-IscB and pSC101-enIscB/p15A-enIscB, were transformed into E. coli and the transformation efficiencies were assessed to determine the cleavage activities in the E. coli stains.

Verifying the gene deletion efficiencies of TnpB, IscB, and enIscB in E. coli

The gene deletion efficiency of TnpB was assessed as an example. For the purpose of inducing the expression of the λ-Red system, a 10 mM arabinose was supplemented into the cultures of E. coli carrying either the pSC101-TnpB or p15A-TnpB plasmid. 100 µL of competent cells were mixed with 100 ng of the pωRNA-TnpB-targetX-THR plasmid. The mixture was electroporated and suspended in the fresh LB broth for incubation at 37 °C for 1 h, then plating onto LB plates containing spectinomycin and kanamycin (for pSC101-TnpB) or spectinomycin and chloramphenicol (for p15A-TnpB). Subsequently, the plates were cultured throughout the night at 37 °C. About 15 colonies were randomly selected for verification by colony PCR, with the utilization of primers which are complementary to the sequences situated ~50 bp upstream and downstream of the homologous arms on the genome. The PCR products were sequenced to confirm successful gene deletion, with the corresponding wild-type strains serving as controls.

The procedure for verifying the gene deletion efficiencies of IscB or enIscB, including pSC101-IscB/p15A-IscB and pSC101-enIscB/p15A-enIscB, was similar to TnpB, except that homologous arms (400 ng) were provided as linear dsDNA rather than being incorporated into plasmids.

Plasmid curing

The pωRNA-TnpB-targetX-THR was taken as an example for the curing of pωRNA series plasmid⁵¹. Edited colonies harboring both the pSC101-TnpB and pωRNA-TnpB-targetX-THR plasmids were inoculated into 5 mL of LB medium containing kanamycin (50 µg/mL). The cultures were cultured overnight and then spread on LB plates containing kanamycin (50 µg/mL). Following overnight incubation at 37 °C, the colonies on the LB plates were randomly picked and then screened on LB plates supplemented with kanamycin (50 µg/mL) and spectinomycin (50 µg/mL). Colonies confirmed as cured exhibited sensitivity to spectinomycin. The curing procedure for the pωRNA-IscB-targetX plasmid was similar to that of pωRNA-TnpB-targetX-THR.

For curing the pTnpB/pIscB/penIscB series plasmids, the pSC101-TnpB was used as a representative example. Colonies cured of the pωRNA-TnpB-targetX-THR plasmid were inoculated into the LB medium and incubated overnight at 37 °C. Subsequent to the incubation process, 10 μL of the culture was spread onto LB agar plates carrying 10 g/L sucrose and then incubated overnight at 37 °C. Subsequently, the single colonies were randomly picked and screened on LB plates with and without kanamycin (50 µg/mL). Colonies that were sensitive to kanamycin were considered cured of the pSC101-TnpB plasmid. The curing processes for pSC101-IscB/pSC101-enIscB and pSC101-TnpB plasmids followed the same procedure.

Workflow for verifying the reason of the escape

The procedure of the escape rate assay was follows: the escape rate testing of TnpB was shown as an example, 100 µL of competent cells of E. coli MG1655 carrying the pSC101-TnpB/p15A-TnpB, and then mixed with pωRNA-TnpB-targetX series plasmid. Next, the mixture was suspended in the fresh LB broth and incubated at 37 °C for 1 h. The resulting mixture was plated onto the solid medium, and then incubated overnight at 37 °C. The colonies were counted to calculate the CFU of the experimental group, and the pωRNA-null plasmid (does not target any site on the genome) was regarded as the control group. (the escape rate=the CFU of pωRNA-TnpB-targetX series plasmid in MG1655 containing TnpB/the CFU of pωRNA-null in MG1655 containing TnpB). The procedure for testing the escape rates of IscB and enIscB in different E. coli strains followed the same protocol.

Approximately 10 escapers were randomly chosen from the maeB site to investigate the reason for escape. The plasmids from these escapers, including pSC101-TnpB/pSC101-IscB and pωRNA series plasmids, were extracted, and their sizes were assessed by using agarose gel electrophoresis. If any plasmid displayed an obvious size abnormality, DNA sequencing was performed on key elements, including the TnpB, IscB and ωRNA coding sequencing, to identify specific mutations responsible for the escape.

Statistics and reproducibility

All the statistical data were calculated by using the GraphPad Prism 9.5.1 and all experiments were performed at least three times (n = 3 independent experiments). Data are shown as mean ± standard error mean (SEM). The statistical significance of differences between the two groups was determined by using one-way ANOVA analysis.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Supplementary information

Peer Review file^{(733KB, pdf)}

Supplemental information^{(4.2MB, pdf)}

42003_2025_7521_MOESM3_ESM.pdf^{(38.1KB, pdf)}

Description of Additional Supplementary Files

Supplementary Data 1^{(26.7KB, xlsx)}

Reporting summary^{(1.8MB, pdf)}

Acknowledgements

This study was supported by National Natural Science Foundation of China (Number: 32402894), Sichuan Science and Technology Program (Number: 2024NSFSC0373), and Luzhou Laojiao Co., Ltd (Number: 2022HX07). We would like to thank Prof. Nan Peng for providing the pSisTnpB-ωRNA related plasmids; Prof. Hui Yang and Yingsi Zhou for providing the pIscB/penIscB-ωRNA related plasmids.

Author contributions

Qi Li, Hongjie Tang and Jie Gao conceived the project and designed the experiments. Hongjie Tang, Jie Gao, and Mingjun Sun carried out the experiments. Qi Li, Hongjie Tang, Jie Gao, Hengyi Wang, Suyi Zhang, and Chuan Song analyzed the data. Qi Li, Hongjie Tang, and Jie Gao wrote the manuscript. All authors discussed the results and contributed to the final manuscript.

Peer review

Peer review information

Communications Biology thanks Nan Peng and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Primary Handling Editors: Haichun Gao and Mengtan Xing. [A peer review file is available.]

Data availability

The source data underlying the graphs in the manuscript are shown in Supplementary Data 1. Plasmid sequences generated in this study can be obtained from Genscript (MolecularCloud numbers: MC_0101508 to MC_0101516). Any remaining information can be obtained from the corresponding author Qi Li (liqi@sicnu.edu.cn), upon reasonable request.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

The online version contains supplementary material available at 10.1038/s42003-025-07521-1.

References

1.Arbab, S. et al. Antimicrobial drug resistance against Escherichia coli and its harmful effect on animal health. Vet. Med. Sci.8, 1780–1786 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Arbab, S. Comparison of antibacterial activity of ciprofloxacin and cephalexin against some common bacterial species isolates from donkey wounds around the vicinity of tandojam sindh pakistan. Pure Appl. Biol.10, 1095–1103 (2021). [Google Scholar]
3.Urban-Chmiel, R. et al. Antibiotic resistance in bacteria-a review. Antibiotics Basel11, 1079 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Szmolka, A. et al. Microarray based comparative genotyping of gentamicin resistant Escherichia coli strains from food animals and humans. Vet. Microbiol.156, 110–118 (2012). [DOI] [PubMed] [Google Scholar]
5.Jiang, X. K. et al. Outer membranes of polymyxin-resistant acinetobacter baumannii with phosphoethanolamine-modified lipid a and lipopolysaccharide loss display different atomic-scale interactions with polymyxins. ACS Infect. Dis.6, 2698–2708 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
6.He, Y. Z. et al. A transposon-associated CRISPR/Cas9 system specifically eliminates both chromosomal and plasmid-borne mcr-1 in Escherichia coli. Antimicrob. Agents Chemother.65, 100–128 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Sulaiman, J. E. & Lam, H. Evolution of bacterial tolerance under antibiotic treatment and its implications on the development of resistance. Front. Microbiol.12, 617412 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Müller, R. Towards the sustainable discovery and development of new antibiotics. Nat. Rev. Chem.5, 726–749 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Zhang, F. S. & Cheng, W. The mechanism of bacterial resistance and potential bacteriostatic strategies. Antibiotics-Basel11, 1215 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Tarín-Pelló, A. et al. Antibiotic resistant bacteria: current situation and treatment options to accelerate the development of a new antimicrobial arsenal. Expert Rev. Anti. Infect. Ther.20, 1095–1108 (2022). [DOI] [PubMed] [Google Scholar]
11.Jian, Z. H. et al. Antibiotic resistance genes in bacteria: occurrence, spread, and control. J. Basic Microbiol.61, 1049–1070 (2021). [DOI] [PubMed] [Google Scholar]
12.Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science337, 816–821 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Bhaya, D., Davison, M. & Barrangou, R. CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation. Annu. Rev. Genet.45, 273–297 (2011). [DOI] [PubMed] [Google Scholar]
14.Gencay, Y. E. et al. Engineered phage with antibacterial CRISPR-Cas selectively reduce E. coli burden in mice. Nat. Biotechnol.42, 265–274 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Bikard, D. & Barrangou, R. Using CRISPR-Cas systems as antimicrobials. Curr. Opin. Microbiol.37, 155–160 (2017). [DOI] [PubMed] [Google Scholar]
16.Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science339, 819–823 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science343, 84–87 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Li, Q. et al. CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol. J.11, 961–972 (2016). [DOI] [PubMed] [Google Scholar]
19.Abavisani, M. et al. CRISPR-Cas system as a promising player against bacterial infection and antibiotic resistance. Drug Resist. Updat.68, 100948 (2023). [DOI] [PubMed] [Google Scholar]
20.Lam, K. N. et al. Phage-delivered CRISPR-Cas9 for strain-specific depletion and genomic deletions in the gut microbiome. Cell Rep.37, 109930 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Rottinghaus, A. G. et al. Genetically stable CRISPR-based kill switches for engineered microbes. Nat. Commun.13, 672 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Kato, K. et al. Structure of the IscB-ωRNA ribonucleoprotein complex, the likely ancestor of CRISPR-Cas9. Nat. Commun.13, 6719 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Pacesa, M. et al. Past, present, and future of CRISPR genome editing technologies. Cell187, 1076–1100 (2024). [DOI] [PubMed] [Google Scholar]
24.Nakagawa, R. et al. Cryo-EM structure of the transposon-associated TnpB enzyme. Nature616, 390 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Xiao, Q. et al. Engineered IscB-ωRNA system with expanded target range for base editing. Nat. Chem. Biol. 10.1038/s41589-024-01706-1 (2024). [DOI] [PMC free article] [PubMed]
26.Karvelis, T. et al. Transposon-associated TnpB is a programmable RNA-guided DNA endonuclease. Nature599, 692 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Altae-Tran, H. et al. The widespread IS200/IS605 transposon family encodes diverse programmable RNA-guided endonucleases. Science374, 57 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Wang, Y. L. et al. Phylogenetic relationships among TnpB-containing mobile elements in six bacterial species. Genes14, 523 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Sasnauskas, G. et al. TnpB structure reveals minimal functional core of Cas12 nuclease family. Nature616, 384 (2023). [DOI] [PubMed] [Google Scholar]
30.Xiang, G. H. et al. Evolutionary mining and functional characterization of TnpB nucleases identify efficient miniature genome editors. Nat. Biotechnol.6, 1–13 (2023). [DOI] [PubMed] [Google Scholar]
31.Xu, Y. et al. Reprogramming an RNA-guided archaeal TnpB endonuclease for genome editing. Cell Discov.9, 112 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Nety, S. P. et al. The Transposon-encoded protein TnpB processes its own mRNA into ωRNA for guided nuclease activity. CRISPR J.6, 232–242 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Li, Z. F. et al. Engineering a transposon-associated TnpB-ωRNA system for efficient gene editing and phenotypic correction of a tyrosinaemia mouse model. Nat. Commun.15, 831 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Feng, X. et al. Flexible TAM requirement of TnpB enables efficient single-nucleotide editing with expanded targeting scope. Nat. Commun.15, 3463 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Ren, K. et al. Discovery and structural mechanism of DNA endonucleases guided by RAGATH-18-derived RNAs. Cell Res.4, 3463 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Jia, N. & Patel, D. J. Structure-based evolutionary relationship between IscB and Cas9. Cell Res.32, 875–877 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Han, L. et al. Engineering miniature IscB nickase for robust base editing with broad targeting range. Nat. Chem. Biol.20, 1629–2639 (2024). [DOI] [PubMed] [Google Scholar]
38.Han, D. Y. et al. Development of miniature base editors using engineered IscB nickase. Nat. Methods.20, 1029 (2023). [DOI] [PubMed] [Google Scholar]
39.Rocha, E. P. C., Cornet, E. & Miche, B. Comparative and evolutionary analysis of the bacterial homologous recombination systems. Plos Genet.1, 247–259 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Selle, K. & Barrangou, R. Harnessing CRISPR-Cas systems for bacterial genome editing. Trends Microbiol.23, 225–232 (2015). [DOI] [PubMed] [Google Scholar]
41.Li, Q. et al. Improving the editing efficiency of CRISPR-Cas9 by reducing the generation of escapers based on the surviving mechanism. ACS Synth. Biol.12, 672–680 (2023). [DOI] [PubMed] [Google Scholar]
42.Fang, H. et al. Standardized iterative genome editing method for Escherichia coli based on CRISPR-Cas9. ACS Synth. Biol.13, 613–623 (2024). [DOI] [PubMed] [Google Scholar]
43.Lee, J. W. et al. Next-generation biocontainment systems for engineered organisms. Nat. Chem. Biol.14, 530–537 (2018). [DOI] [PubMed] [Google Scholar]
44.Wang, T. M. et al. Pooled CRISPR interference screening enables genome-scale functional genomics study in bacteria with superior performance. Nat. Commun.9, 2475 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Shuman, S. & Glickman, M. S. Bacterial DNA repair by non-homologous end joining. Nat. Rev. Microbiol.5, 852–861 (2007). [DOI] [PubMed] [Google Scholar]
46.Vento, J. M., Crook, N. & Beisel, C. L. Barriers to genome editing with CRISPR in bacteria. J. Ind. Msicrobiol. Biotechnol.46, 1327–1341 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Symington, L. S. & Gautier, J. Double-strand break end resection and repair pathway choice. Annu. Rev. Genet.45, 246–271 (2011). [DOI] [PubMed] [Google Scholar]
48.Lieber, M. R. The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway. Annu. Rev. Biochem.79, 181–211 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Uribe, R. V. et al. Bacterial resistance to CRISPR-Cas antimicrobials. Sci. Rep.11, 17267 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Edraki, A. et al. A compact, high-accuracy Cas9 with a dinucleotide PAM for in vivo genome editing. Mol. Cell.73, 714 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Li, Q. et al. A modified pCas/pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochim. Biophys. Sin.53, 620–627 (2021). [DOI] [PubMed] [Google Scholar]
52.Sharan, S. K. et al. Recombineering: a homologous recombination-based method of genetic engineering. Nat. Protoc.4, 206–223 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Peer Review file^{(733KB, pdf)}

Supplemental information^{(4.2MB, pdf)}

42003_2025_7521_MOESM3_ESM.pdf^{(38.1KB, pdf)}

Description of Additional Supplementary Files

Supplementary Data 1^{(26.7KB, xlsx)}

Reporting summary^{(1.8MB, pdf)}

Data Availability Statement

[CR1] 1.Arbab, S. et al. Antimicrobial drug resistance against Escherichia coli and its harmful effect on animal health. Vet. Med. Sci.8, 1780–1786 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR2] 2.Arbab, S. Comparison of antibacterial activity of ciprofloxacin and cephalexin against some common bacterial species isolates from donkey wounds around the vicinity of tandojam sindh pakistan. Pure Appl. Biol.10, 1095–1103 (2021). [Google Scholar]

[CR3] 3.Urban-Chmiel, R. et al. Antibiotic resistance in bacteria-a review. Antibiotics Basel11, 1079 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR4] 4.Szmolka, A. et al. Microarray based comparative genotyping of gentamicin resistant Escherichia coli strains from food animals and humans. Vet. Microbiol.156, 110–118 (2012). [DOI] [PubMed] [Google Scholar]

[CR5] 5.Jiang, X. K. et al. Outer membranes of polymyxin-resistant acinetobacter baumannii with phosphoethanolamine-modified lipid a and lipopolysaccharide loss display different atomic-scale interactions with polymyxins. ACS Infect. Dis.6, 2698–2708 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR6] 6.He, Y. Z. et al. A transposon-associated CRISPR/Cas9 system specifically eliminates both chromosomal and plasmid-borne mcr-1 in Escherichia coli. Antimicrob. Agents Chemother.65, 100–128 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR7] 7.Sulaiman, J. E. & Lam, H. Evolution of bacterial tolerance under antibiotic treatment and its implications on the development of resistance. Front. Microbiol.12, 617412 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR8] 8.Müller, R. Towards the sustainable discovery and development of new antibiotics. Nat. Rev. Chem.5, 726–749 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR9] 9.Zhang, F. S. & Cheng, W. The mechanism of bacterial resistance and potential bacteriostatic strategies. Antibiotics-Basel11, 1215 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR10] 10.Tarín-Pelló, A. et al. Antibiotic resistant bacteria: current situation and treatment options to accelerate the development of a new antimicrobial arsenal. Expert Rev. Anti. Infect. Ther.20, 1095–1108 (2022). [DOI] [PubMed] [Google Scholar]

[CR11] 11.Jian, Z. H. et al. Antibiotic resistance genes in bacteria: occurrence, spread, and control. J. Basic Microbiol.61, 1049–1070 (2021). [DOI] [PubMed] [Google Scholar]

[CR12] 12.Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science337, 816–821 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR13] 13.Bhaya, D., Davison, M. & Barrangou, R. CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation. Annu. Rev. Genet.45, 273–297 (2011). [DOI] [PubMed] [Google Scholar]

[CR14] 14.Gencay, Y. E. et al. Engineered phage with antibacterial CRISPR-Cas selectively reduce E. coli burden in mice. Nat. Biotechnol.42, 265–274 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR15] 15.Bikard, D. & Barrangou, R. Using CRISPR-Cas systems as antimicrobials. Curr. Opin. Microbiol.37, 155–160 (2017). [DOI] [PubMed] [Google Scholar]

[CR16] 16.Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science339, 819–823 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR17] 17.Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science343, 84–87 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR18] 18.Li, Q. et al. CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol. J.11, 961–972 (2016). [DOI] [PubMed] [Google Scholar]

[CR19] 19.Abavisani, M. et al. CRISPR-Cas system as a promising player against bacterial infection and antibiotic resistance. Drug Resist. Updat.68, 100948 (2023). [DOI] [PubMed] [Google Scholar]

[CR20] 20.Lam, K. N. et al. Phage-delivered CRISPR-Cas9 for strain-specific depletion and genomic deletions in the gut microbiome. Cell Rep.37, 109930 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR21] 21.Rottinghaus, A. G. et al. Genetically stable CRISPR-based kill switches for engineered microbes. Nat. Commun.13, 672 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR22] 22.Kato, K. et al. Structure of the IscB-ωRNA ribonucleoprotein complex, the likely ancestor of CRISPR-Cas9. Nat. Commun.13, 6719 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR23] 23.Pacesa, M. et al. Past, present, and future of CRISPR genome editing technologies. Cell187, 1076–1100 (2024). [DOI] [PubMed] [Google Scholar]

[CR24] 24.Nakagawa, R. et al. Cryo-EM structure of the transposon-associated TnpB enzyme. Nature616, 390 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR25] 25.Xiao, Q. et al. Engineered IscB-ωRNA system with expanded target range for base editing. Nat. Chem. Biol. 10.1038/s41589-024-01706-1 (2024). [DOI] [PMC free article] [PubMed]

[CR26] 26.Karvelis, T. et al. Transposon-associated TnpB is a programmable RNA-guided DNA endonuclease. Nature599, 692 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR27] 27.Altae-Tran, H. et al. The widespread IS200/IS605 transposon family encodes diverse programmable RNA-guided endonucleases. Science374, 57 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR28] 28.Wang, Y. L. et al. Phylogenetic relationships among TnpB-containing mobile elements in six bacterial species. Genes14, 523 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR29] 29.Sasnauskas, G. et al. TnpB structure reveals minimal functional core of Cas12 nuclease family. Nature616, 384 (2023). [DOI] [PubMed] [Google Scholar]

[CR30] 30.Xiang, G. H. et al. Evolutionary mining and functional characterization of TnpB nucleases identify efficient miniature genome editors. Nat. Biotechnol.6, 1–13 (2023). [DOI] [PubMed] [Google Scholar]

[CR31] 31.Xu, Y. et al. Reprogramming an RNA-guided archaeal TnpB endonuclease for genome editing. Cell Discov.9, 112 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR32] 32.Nety, S. P. et al. The Transposon-encoded protein TnpB processes its own mRNA into ωRNA for guided nuclease activity. CRISPR J.6, 232–242 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR33] 33.Li, Z. F. et al. Engineering a transposon-associated TnpB-ωRNA system for efficient gene editing and phenotypic correction of a tyrosinaemia mouse model. Nat. Commun.15, 831 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR34] 34.Feng, X. et al. Flexible TAM requirement of TnpB enables efficient single-nucleotide editing with expanded targeting scope. Nat. Commun.15, 3463 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR35] 35.Ren, K. et al. Discovery and structural mechanism of DNA endonucleases guided by RAGATH-18-derived RNAs. Cell Res.4, 3463 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR36] 36.Jia, N. & Patel, D. J. Structure-based evolutionary relationship between IscB and Cas9. Cell Res.32, 875–877 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR37] 37.Han, L. et al. Engineering miniature IscB nickase for robust base editing with broad targeting range. Nat. Chem. Biol.20, 1629–2639 (2024). [DOI] [PubMed] [Google Scholar]

[CR38] 38.Han, D. Y. et al. Development of miniature base editors using engineered IscB nickase. Nat. Methods.20, 1029 (2023). [DOI] [PubMed] [Google Scholar]

[CR39] 39.Rocha, E. P. C., Cornet, E. & Miche, B. Comparative and evolutionary analysis of the bacterial homologous recombination systems. Plos Genet.1, 247–259 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR40] 40.Selle, K. & Barrangou, R. Harnessing CRISPR-Cas systems for bacterial genome editing. Trends Microbiol.23, 225–232 (2015). [DOI] [PubMed] [Google Scholar]

[CR41] 41.Li, Q. et al. Improving the editing efficiency of CRISPR-Cas9 by reducing the generation of escapers based on the surviving mechanism. ACS Synth. Biol.12, 672–680 (2023). [DOI] [PubMed] [Google Scholar]

[CR42] 42.Fang, H. et al. Standardized iterative genome editing method for Escherichia coli based on CRISPR-Cas9. ACS Synth. Biol.13, 613–623 (2024). [DOI] [PubMed] [Google Scholar]

[CR43] 43.Lee, J. W. et al. Next-generation biocontainment systems for engineered organisms. Nat. Chem. Biol.14, 530–537 (2018). [DOI] [PubMed] [Google Scholar]

[CR44] 44.Wang, T. M. et al. Pooled CRISPR interference screening enables genome-scale functional genomics study in bacteria with superior performance. Nat. Commun.9, 2475 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR45] 45.Shuman, S. & Glickman, M. S. Bacterial DNA repair by non-homologous end joining. Nat. Rev. Microbiol.5, 852–861 (2007). [DOI] [PubMed] [Google Scholar]

[CR46] 46.Vento, J. M., Crook, N. & Beisel, C. L. Barriers to genome editing with CRISPR in bacteria. J. Ind. Msicrobiol. Biotechnol.46, 1327–1341 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR47] 47.Symington, L. S. & Gautier, J. Double-strand break end resection and repair pathway choice. Annu. Rev. Genet.45, 246–271 (2011). [DOI] [PubMed] [Google Scholar]

[CR48] 48.Lieber, M. R. The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway. Annu. Rev. Biochem.79, 181–211 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR49] 49.Uribe, R. V. et al. Bacterial resistance to CRISPR-Cas antimicrobials. Sci. Rep.11, 17267 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR50] 50.Edraki, A. et al. A compact, high-accuracy Cas9 with a dinucleotide PAM for in vivo genome editing. Mol. Cell.73, 714 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR51] 51.Li, Q. et al. A modified pCas/pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochim. Biophys. Sin.53, 620–627 (2021). [DOI] [PubMed] [Google Scholar]

[CR52] 52.Sharan, S. K. et al. Recombineering: a homologous recombination-based method of genetic engineering. Nat. Protoc.4, 206–223 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Characterization of the genome editing with miniature DNA nucleases TnpB and IscB in Escherichia coli strains

Hongjie Tang

Jie Gao

Hengyi Wang

Mingjun Sun

Suyi Zhang

Chuan Song

Qi Li

Abstract

Introduction

Results

TnpB-based genome editing tools worked in MG1655 but not in ATCC9637 and BL21(DE3)

Fig. 1. TnpB-based genome editing tool was successfully established in E. coli MG1655, but not in E. coli ATCC9637 or BL21(DE3).

Efficient genome editing could be achieved in ATCC9637 and BL21(DE3) by using IscB but not in MG1655

Fig. 2. The genome editing could be achieved in E. coli ATCC9637 and BL21(DE3) while not in MG1655 by using IscB.

Genome editing in E. coli ATCC9637 and BL21(DE3) could also be achieved by using enIscB

Fig. 3. EnIscB-based genome editing tool could be established in E. coli ATCC9637 and BL21(DE3), but not in E. coli MG1655.

Plasmid elimination in TnpB/IscB/enIscB-based genome editing systems was achieved by a two-step plasmid curing strategy

Fig. 4. Plasmids curing results for the pTnpB/pωRNA, pIscB/pωRNA, and penIscB/pωRNA systems.

Table 1.

Preliminary uncovering the mechanisms of E. coli escaping from TnpB/IscB-based genome editing

Fig. 5. Analysis of the reasons for escape in E. coli under the editing of TnpB/IscB.

Discussion

Methods

Bacterial strains and culture methods

Reagents and enzymes

Plasmids construction

Plasmid transformation and testing the toxicity of TnpB, IscB, and enIscB in E. coli

Testing the cleavage activities of TnpB, IscB, and enIscB in E. coli

Verifying the gene deletion efficiencies of TnpB, IscB, and enIscB in E. coli

Plasmid curing

Workflow for verifying the reason of the escape

Statistics and reproducibility

Reporting summary

Supplementary information

Acknowledgements

Author contributions

Peer review

Peer review information

Data availability

Competing interests

Footnotes

Supplementary information

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases