Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2025 Feb 22;39(4):e70412. doi: 10.1096/fj.202402531R

Fructose induces inflammatory activation in macrophages and microglia through the nutrient‐sensing ghrelin receptor

Zheng Shen 1, Zeyu Liu 1, Hongying Wang 1, Danilo Landrock 1, Ji Yeon Noh 1, Qun Sophia Zang 2, Chih‐Hao Lee 3, Yuhua Z Farnell 4, Zheng Chen 5, Yuxiang Sun 1,6,
PMCID: PMC11846021  PMID: 39985299

Abstract

High fructose corn syrup (HFCS) is a commonly used sweetener in soft drinks and processed foods, and HFCS exacerbates inflammation when consumed in excess. Fructose, a primary component of HFCS; however, it is unclear whether fructose directly activates inflammatory signaling. Growth hormone secretagogue receptor (GHSR) is a receptor of the nutrient‐sensing hormone ghrelin. We previously reported that GHSR ablation mitigates HFCS‐induced inflammation in adipose tissue and liver, shifting macrophages toward an anti‐inflammatory spectrum. Since inflammation is primarily governed by innate immune cells, such as macrophages in the peripheral tissues and microglia in the brain, this study aims to investigate whether GHSR autonomously regulates pro‐inflammatory activation in macrophages and microglia upon fructose exposure. GHSR deletion mutants of RAW 264.7 macrophages and the immortalized microglial cell line (IMG) were generated using CRISPR‐Cas9 gene editing. After treating the cells with equimolar concentrations of fructose or glucose for 24 h, fructose increased mRNA and protein expression of GHSR and pro‐inflammatory cytokines (Il1β, Il6, and Tnfα) in both macrophages and microglia, suggesting that fructose activates Ghsr and induces inflammation directly in macrophages and microglia. Remarkably, GHSR deletion mutants (Ghsr mutant) of macrophages and microglia exhibited reduced inflammatory responses to fructose, indicating that GHSR mediates fructose‐induced inflammation. Furthermore, we found that GHSR regulates fructose transport and fructose metabolism and mediates fructose‐induced inflammatory activation through CREB–AKT‐NF‐κB and p38 MAPK signaling pathways. Our results underscore that fructose triggers inflammation, and reducing HFCS consumption would reduce disease risk. Moreover, these findings reveal for the first time that the nutrient‐sensing receptor GHSR plays a crucial role in fructose‐mediated inflammatory activation, suggesting that targeting GHSR may be a promising therapeutic approach to combat the immunotoxicity of foods that contain fructose.

Keywords: fructose, growth hormone secretagogue receptor (GHSR), inflammation, macrophage, microglia


Nutrient‐sensing GHSR is a key mediator of fructose‐induced inflammatory activation in macrophages and microglia; it functions through the following three pathways: (1) GHSR stimulates the CREB–AKT–NF‐κB pathway, which is an essential mechanism mediating fructose‐induced inflammation; (2) GHSR regulates fructose uptake and metabolism by activating GLUT5 expression and enhancing the KHK‐associated AMPK‐AKT and p38 signaling pathways, respectively; (3) Fructose increases Ghsr gene expression, promoting a positive feedback loop that exacerbates the inflammatory state in macrophages and microglia.

graphic file with name FSB2-39-e70412-g006.jpg


Abbreviations

AKT

protein kinase B

AMPK

AMP‐activated protein kinase

BMDMs

bone marrow‐derived macrophages

CNS

central nervous system

CTR

control

Fru

fructose

GHSR

growth hormone secretagogue receptor

Ghsr mutant

Ghsr mutant

Glu

glucose

GLUT5

glucose transporter 5

HFCS

high fructose corn syrup

IL‐1β

interleukin‐1β

IL‐6

interleukin‐6

IMG

immortalized microglial cell line

iNOS

inducible Nitric Oxide Synthase

KHK

ketohexokinase

NAFLD

non‐alcoholic fatty liver disease

p38 MAPK

p38 mitogen‐activated protein kinase

TNF‐α

tumor necrosis factor‐α

WT

wild type

1. INTRODUCTION

Daily consumption of soft drinks, flavored candies, and processed food leads to overconsumption of fructose. 1 , 2 , 3 Since the 1960s, the widespread use of high‐fructose corn syrup (HFCS) in the U.S. food supply has drastically changed the dietary composition of Americans. 1 , 3 Notably, the proportion of HFCS as a major component of sweeteners in the U.S. surged from 0.0% to 42.0% between 1966 and 2000. 1 , 4 During this same period, there has been a significant increase in obesity and diabetes among U.S. adults, with obesity rates climbing from 13.4% to 30.9% and the prevalence of diagnosed diabetes rising from 1.8% to 5.8%. 1 , 5 , 6 , 7 By 2020, the intake of added sweeteners (including HFCS) in the U.S. adult population has increased by approximately 200% compared to the 1960s. 8 Clinical studies have shown that when daily fructose intake increases by 20 g, inflammatory blood biomarkers, such as C‐reactive protein (CRP) and interleukin‐6 (IL‐6), increase by 1.5% to 1.9%. 9 Chronic excessive fructose consumption has been shown to increase the risk of obesity and other metabolic disorders, resulting in various organ dysfunctions and diseases such as non‐alcoholic fatty liver disease (NAFLD) 10 , 11 and type 2 diabetes (T2D). 12 , 13 Excessive fructose consumption has also been shown to increase chronic inflammation in the peripheral tissues 14 , 15 , 16 , 17 and the brain. 18 , 19 , 20 However, the cell‐type‐specific effect and the underlying mechanisms of fructose‐associated inflammation remain poorly understood.

Myeloid cells, such as macrophages in peripheral tissues and microglia in the brain, play central roles in innate immune responses and the development of peripheral and central inflammation. 21 , 22 , 23 Macrophages release pro‐inflammatory cytokines, including interleukin‐1β (IL‐1β) and tumor necrosis factor‐α (TNF‐α), which recruit other immune cells to enhance the immune response, together to combat the inflammatory insults. 24 , 25 While macrophages are distributed throughout the body, microglia represent a specialized subset of myeloid cells residing exclusively in the central nervous system (CNS). 26 , 27 , 28 Macrophages and microglia exhibit a unique property of plasticity; they undergo dynamic polarization and phagocytosis reflective of their specific tissue niches. 26 , 29 , 30 Dysregulated activation of macrophages or microglia leads to inflammation disorders, contributing to the pathogenesis of inflammation in various peripheral and central tissues, such as NAFLD and Alzheimer's disease. 23 , 26 , 31 However, the cellular mechanism underlying fructose‐induced macrophage/microglia pro‐inflammatory polarization is still not clear.

The growth hormone secretagogue receptor (GHSR), a G‐protein‐coupled receptor, is the biologically relevant receptor for the nutrient‐sensing hormone ghrelin. 32 , 33 Our previous studies have demonstrated that HFCS induces inflammation in adipose tissue and the liver, and this is attenuated by GHSR ablation. 14 , 17 More importantly, using our myeloid‐specific Ghsr knockout mouse model, we recently discovered that myeloid‐specific GHSR deletion mitigates diet‐induced systemic and tissue inflammation by reprogramming macrophage polarization through the suppression of the insulin signaling pathway. 34 Additionally, we reported a significant reduction in neuroinflammation following neuronal ablation of GHSR. 31 These exciting findings together raise the question of whether GHSR governs the effect of fructose in macrophages and microglia.

To unequivocally define the direct effects of fructose on macrophages and microglia, we generated Ghsr deletion mutants in RAW 264.7 macrophages and the immortalized microglial cell line (IMG) using CRISPR‐Cas9 gene editing. We examined the roles of GHSR in the pro‐inflammatory activation of these cells under fructose treatment in vitro. Our results showed that GHSR inhibition significantly alleviated fructose‐induced inflammation in both macrophages and microglia, suggesting that GHSR is a key mediator of the immunotoxicity of fructose, and GHSR may serve as a therapeutic target to protect against fructose‐induced inflammation.

2. METHODS

2.1. Cell lines and culture conditions

The RAW 264.7 mouse macrophage cell line was obtained from ATCC (ATCC#TIB‐71, Manassas, VA, USA) and cultured in RPMI 1640 medium supplemented with heat‐inactivated 10% fetal bovine serum (FBS) (Sigma, St. Louis, MO, USA) and 1% penicillin–streptomycin solution (P/S) (Sigma, St. Louis, MO, USA). The IMG mouse microglial cell line was obtained from Millipore Sigma (Cat# SCC134, St. Louis, MO, USA) and cultured in StableCell™ DMEM supplemented with 10% FBS and 1% P/S. Both cell lines were maintained in a humidified cell culture incubator at 37°C with 5% CO2.

2.2. Generation of Ghsr deletion mutant RAW 264.7 and IMG cell line

To create a RAW 264.7 cell line with Ghsr gene deletion, we employed the CRISPR‐Cas9 gene‐editing technique, as described in our previous publication. 25 Similarly, to create a Ghsr deletion IMG microglia cell line, we performed electroporation of the IMG cell line with synthetic Ghsr sgRNAs according to the published protocol. 25 , 35 The single guide RNAs were designed using Synthego's algorithm, as illustrated in Table 1.

TABLE 1.

Single guide RNAs were designed using Synthego's algorithm and synthesized for CRISPR editing.

CRISPR guide name Guide sequence GHSR protein target
Ghsr+27371816 GUGGAACGCGACGCCCAGCG aa192‐193
Ghsr−27372373 CGGCACUCGUUGGUGUCCCG aa7‐8

Electroporation of the IMG cell line with ribonucleoproteins was performed using the protocol provided by Synthego and optimized for the IMG cell line. The isolation of single cells from the knockout cell pool was accomplished through limiting dilution and clonal expansion according to Synthego's standard protocols. 36 In this protocol, cells from each edited population were diluted to 1 cell per 100 μL and plated on at least two 96‐well plates. Obtained clones were screened for the presence of deletions using the primers listed in Table 2.

TABLE 2.

The primers used to screen for the presence of deletions in the obtained IMG cell clones.

Genotyping primer sequences (5′ to 3′)
F/R = 740 bp (wt) + 150–700 bp (del)
Ghsr F CTCCTCAGGGGACCAGATTT
Ghsr R GAGCACAGTGAGGCAGAAGA

Several clones that exhibited PCR bands, indicative of potential deletions, were further expanded and verified by genotyping (Figure S1A,B). Ghsr mutant lines A1, B3, and D10 IMG showed the highest deletion efficiency among all the clones (Figure S1C), and D10 was used as our Ghsr deletion mutant (Ghsr mutant) IMG cell line in this study due to its highest efficiency in suppressing pro‐inflammatory cytokine Il6 gene expression (Figure S1D).

2.3. Fructose exposure of RAW 264.7 macrophages and IMG microglia cell lines in vitro

At the beginning of the treatment, the complete medium of wild type (WT) and Ghsr mutant RAW 264.7 or IMG cell lines was replaced with the corresponding reduced FBS medium (1% FBS, 1% P/S). 37 , 38 , 39 , 40 Specifically, in the fructose‐treated group, cells (3.0 × 105 live cells per well; 6‐well plate) were cultured in medium supplemented with fructose (Cat# F0127, Sigma, St. Louis, MO, USA) equimolar to the glucose content in the original respective culture medium (11.1 mM fructose was supplemented in the RPMI 1640 medium for the RAW 264.7 cell line, and 17.5 mM fructose was supplemented in the StableCell™ DMEM medium for the IMG cell line). To exclude the possibility that the effects observed in the fructose‐treated group were due to a doubling of monosaccharide concentration rather than the specific effects of fructose, we also had a glucose‐treated group that received an equivalent molar concentration of glucose (11.1 mM glucose was supplemented in the RPMI 1640 for the RAW 264.7 cell line, and 17.5 mM glucose was supplemented in the StableCell™ DMEM for the IMG cell line). A similar approach has been employed in numerous studies to examine the physiological effects of fructose exposure in a setting where glucose co‐exists. 18 , 41 , 42 , 43 , 44 The dosage choice and length of fructose exposure (24 h) were based on previous studies. 18 , 41 Following this exposure period, protein or RNA samples were extracted for subsequent analysis.

2.4. Real‐time quantitative PCR

Total RNA samples were extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and then reverse‐transcribed into complementary DNAs (cDNAs) using iScript™ Reverse Transcription Supermix (Cat# 1708890, Bio‐Rad, Hercules, CA, USA) according to the manufacturer's instructions. The resulting cDNAs were diluted with PCR‐grade H2O (6‐time dilution), then combined with SsoAdvanced Universal SYBR® Green Supermix (Cat# 1725274, Bio‐Rad, Hercules, CA, USA) and subjected to real‐time PCR using the CFX384 Touch™ Real‐Time PCR Detection System (Bio‐Rad) as previously described. 25 The gene encoding β‐actin (Actb) was used as the internal control. cDNA amplification was conducted in duplicate. Relative gene expression levels were calculated by using the 2−∆∆CT method. 45 The following primers were used in this study: Actb: 5′‐ACTGTCGAGTCGCGTCCA‐3′ (Forward), 5′‐TCATCCATGGCGAACTGGTG‐3′ (Reverse); Tnfa: 5′‐GAGAAAGT‐CAACCTCCTCTCTG‐3′ (Forward), 5′‐GAAGACTCCTCCCAGGTATATG‐3′ (Reverse); iNOS: 5′‐CCAAGCCCTCACCTACTTCC‐3′ (Forward), 5′‐CTCTGAGGGCTGACACAAGG‐3′ (Reverse); Il1b: 5′‐TGTTCTTTGAAGTTGACGGACCC‐3′ (Forward), 5′‐TCATCTCGGAGCCTGTAGTGC‐3′ (Reverse); Il6: 5′‐CCAGAGATACAAAGAAATGAT‐GG‐3′ (Forward), 5′‐ACTCCAGAAGACCAGAGGAAAT‐3′ (Reverse); Khk: 5′‐AACTCCTG‐CACTGTC CTTTCCTT‐3′ (Forward), 5′‐CCACCAGGAAGTCGGCAA‐3′ (Reverse); Slc2a5: 5′‐AAGCGACGACGTCCAGTATGT‐3′ (Forward), 5′‐GAATCGCCGTCCCCAAAG‐3′ (Reverse); Ghsr: 5′‐AAGATGCTTGCTGTGGTGGT‐3′ (Forward), 5′‐AGCGCTGAGGTAGA‐AGAGGA‐3′ (Reverse).

2.5. Western blot analysis

Western blot analysis was conducted as previously described. 31 , 34 , 46 In brief, protein samples were initially prepared using Alfa Aesar™ Laemmli SDS sample buffer (reducing, 6X) (Cat# AAJ61337AD, Thermo Fisher Scientific) based on their protein concentration and denatured at 96°C for 10 min. Subsequently, protein samples (25–40 μg) were separated on a polyacrylamide gel (7.5%–15%) using the Mini‐PROTEAN® Tetra Vertical Electrophoresis Cell (Cat# 1658004, Bio‐Rad, Hercules, CA, USA) and then transferred onto Pierce™ PVDF Transfer Membranes (0.2 μm) (Cat# 88520, Thermo Fisher Scientific) using the Trans‐Blot Turbo Transfer System (Cat# 1704150, Bio‐Rad). Membranes were then incubated overnight at 4°C with primary antibodies (1:1000 dilution) in a 5% BSA solution (5% w/v in TBST), followed by incubation with a secondary antibody (horseradish peroxidase (HRP)‐linked anti‐rabbit IgG, Cat# 7074, Cell Signaling Technology) in a 5% BSA solution the following day. Clarity Western ECL Substrate (Cat# 1705061, Bio‐Rad) was used to incubate with the HRP‐linked secondary antibody, resulting in the generation of light signals that were captured by the ChemiDoc™ Imaging System (Cat# 12003153, Bio‐Rad). Primary antibodies for AKT (Cat# 4691), AMPKα (Cat# 2603), β‐Actin (Cat# 4970), CREB (Cat# 9197), NF‐κB p65 (Cat# 8242), p38 MAPK (Cat# 9212), phospho‐AKT‐Ser473 (Cat# 9271), phospho‐AKT‐Thr308 (Cat# 4056), phospho‐AMPKα‐Thr172 (Cat# 2535), phospho‐CREB‐Ser133 (Cat# 9198), phospho‐NF‐κB p65‐Ser536 (Cat# 3033), and phospho‐p38 MAPK‐Thr180/Tyr182 (Cat# 4511) were purchased from Cell Signaling Technology. Primary antibodies for GLUT5 (Cat# PA5‐89347) and GHSR (Cat# 720278) were purchased from Thermo Fisher Scientific. β‐Actin was used as the internal control. The protein band intensity was quantified using the ImageJ software (NIH, 1.8.0v).

2.6. Interactome analysis and prediction of putative transcription factor binding sites of Ghsr

The interactome (network) analysis on GHSR‐mediated networks was performed using QIAGEN Ingenuity Pathway Analysis (IPA) software (QIAGEN, Redwood City, CA, USA). 47 , 48 , 49 Based on associated functions and data mining from experimental studies documented in the literature, 50 , 51 IPA can identify the potential relationships between GHSR and other proteins of interest (Figure S2A). The components were transformed into relevant networks using a comprehensive database powered by the QIAGEN Biomedical Knowledge Bases to explore the signaling pathways in the current study. The PROMO virtual laboratory 52 , 53 was utilized to predict potential transcription factor binding sites for Ghsr (Figure S2B,C).

2.7. Statistical analysis

A Student's t‐test (with Welch's correction) was used to compare the means of two groups. Two‐way ANOVA (coupled with Tukey's post‐test) was used to compare the means of more than two groups with two independent variables. Data were presented as mean ± SEM. A p‐value of less than .05 was considered statistically significant. *, # for p‐value <.05; **, ## for p‐value <.01; ***, ### for p‐value <.001. In particular, the pound sign (#) is used for comparing treatments (fructose‐ or glucose‐treated) with the untreated group, while the asterisk (*) is used for comparing Ghsr deletion mutants with the WT group. Statistical analysis was performed using GraphPad Prism software (Version 8.0.2).

3. RESULTS

3.1. Fructose upregulates pro‐inflammatory gene expression in macrophages and microglia

To determine the direct effect of fructose on the activation of macrophages and microglia, RAW 264.7 macrophages and IMG microglia were cultured in media supplemented with fructose for 24 h. The concentration of supplemented fructose was maintained at the same level as the glucose concentration in the original culture medium. Additionally, a glucose‐treated group (+Glu) was included, where the concentration of supplemented glucose in the medium was the same as in the fructose‐treated group to match the monosaccharide concentration (Figure 1A). This experimental paradigm has been adopted in many studies to investigate the physiological effects of fructose in the presence of glucose in vitro. 18 , 41 , 42 The RT‐qPCR results revealed a significantly elevated expression of the pro‐inflammatory polarization signature gene iNOS and pro‐inflammatory cytokine genes of Tnfa, Il1b, and Il6 in both RAW 264.7 and IMG cells with fructose exposure (+Fru) (Figure 1B,C). In contrast, the same concentration of monosaccharide/glucose (+Glu) had either no significant effect or only a modest effect on the expression of these pro‐inflammatory cytokine genes (Figure 1B,C). This result suggests that fructose uniquely promotes the pro‐inflammatory activation of macrophages and microglia. The fructose‐induced pro‐inflammatory effect is attributable to fructose, rather than to an increase in monosaccharide in general.

FIGURE 1.

FIGURE 1

Fructose exposure upregulates pro‐inflammatory genes in macrophages and microglia. (A) RAW 264.7 macrophages and IMG microglia were grown in their respective culture medium alone (CTR) or supplemented with either glucose (+Glu) or fructose (+Fru) for 24 h. Glucose, fructose, and total monosaccharide concentrations in each group are noted. (B, C) Relative mRNA levels of pro‐inflammatory genes (iNOS, Tnfα, Il1β, Il6) in either RAW 264.7 (B) or IMG (C) cells were measured by RT‐qPCR. Data were presented as mean ± SEM, # p < .05; ## p < .01; ### p < .001, +Glu or +Fru vs. CTR.

3.2. Inhibition of Ghsr suppresses fructose‐induced inflammation in macrophages and microglia

We previously showed that GHSR ablation attenuates HFCS‐induced inflammation in adipose tissue and the liver. 17 We recently reported that GHSR plays a crucial role in regulating macrophage polarization in mice exposed to the environmental toxin bisphenol A or a high‐fat diet. 25 , 34 Our data suggest that GHSR has an immunoregulatory effect in macrophages. To determine whether fructose activates GHSR in RAW 264.7 macrophages and IMG microglia, we investigated the expression of GHSR in these cells. Our RT‐qPCR analysis revealed a significant increase in Ghsr mRNA levels in both RAW 264.7 and IMG cells following exposure to fructose (Figure 2A,B). To further investigate whether GHSR plays a critical role in the fructose‐induced pro‐inflammatory activation of macrophages and microglia, we utilized CRISPR‐Cas9 gene editing to generate a Ghsr deletion mutant (Ghsr mutant) in RAW 264.7 macrophages 25 and IMG microglia (Figure S1). We assessed GHSR protein levels with or without fructose exposure and found that the protein levels of GHSR were relatively low without fructose treatment in WT cells, and there was no difference between WT and Ghsr mutant cells (Figure 2C,D). Importantly, with fructose treatment, GHSR in WT cells showed a significant increase of GHSR (more prominent in RAW 264.7 macrophages), while Ghsr mutant cells showed a much lower level of band intensity (Figure 2C,D). Remarkably, Ghsr deletion in RAW 264.7 and IMG cells significantly attenuated fructose‐induced pro‐inflammatory gene expression of Il1β and Il6, with Tnfa being more responsive to Ghsr deletion in IMG than in RAW cells (Figure 2E,F). These findings underscore the important role of GHSR in fructose‐induced pro‐inflammatory activation in macrophages and microglia, suggesting that GHSR acts as a nutrient sensor in myeloid cells to modulate inflammatory responses.

FIGURE 2.

FIGURE 2

Ghsr inhibition suppresses fructose‐induced inflammation in macrophages and microglia. (A, B) Relative mRNA levels of Ghsr in RAW 264.7 (A) and IMG (B) cells with or without fructose (Fru) treatment for 24 h. (C, D) Representative immunoblot images and quantification results of GHSR protein levels in WT and Ghsr‐mutant (Ghsr mutant) RAW 264.7 (C) or IMG (D) cells with or without fructose treatment for 24 h. (E, F) Relative mRNA levels of pro‐inflammatory cytokine genes (Tnfα, Il1β, Il6) in WT and Ghsr mutant RAW 264.7 (E) or IMG (F) cells with or without fructose treatment. Data were presented as mean ± SEM, # p < .05; ## p < .01; ### p < .001, +Fru vs. −Fru; *p < .05; **p < .01; ***p < .001, Ghsr mutant vs. WT.

3.3. Uptake and metabolism of fructose in macrophages and microglia are GHSR‐dependent

Since our results demonstrate that GHSR plays an important role in fructose‐induced pro‐inflammation in macrophages and microglia, we further investigated the underpinning molecular mechanisms by examining whether GHSR inhibition suppresses the uptake and metabolism of fructose in RAW 264.7 and IMG cells. Previous studies have shown that fructose uptake into cells is facilitated by fructose transporter GLUT5. 20 , 54 While most studies on GLUT5 and fructose uptake focus on intestinal epithelial cells and hepatocytes, 42 , 43 , 44 , 55 some have reported that fructose can be utilized by macrophages or microglia through GLUT5. 18 , 56 , 57 As illustrated in the schematic diagram Figure 3A, upon entering the cell via GLUT5, fructose is rapidly phosphorylated to fructose‐1‐phosphate (fructose‐1‐P) by ketohexokinase (KHK), the rate‐limiting enzyme for fructose metabolism. 20 , 55 With the production of fructose‐1‐P, ATP is converted into ADP and further converted to AMP, leading to an elevation of the intracellular AMP/ATP ratio and eventually triggering the phosphorylation and activation of AMP‐activated protein kinase (AMPK). 58 , 59 Concurrently, fructose‐1‐P enters the fructose metabolic process, ultimately inducing the expression of GLUT5 (encoded by Slc2a5) and further enhancing fructose uptake. 54 , 58 Indeed, in fructose‐treated RAW 264.7 and IMG cells, we observed a significant increase in the expression of Khk (Figure 3B,C), and both mRNA and protein levels of GLUT5 were strongly elevated by fructose (Figure 3B–E). More importantly, fructose‐induced upregulation of Khk and Slc2a5 was markedly suppressed in GHSR deletion mutant macrophages and microglia (Figure 3B–E), indicating that GHSR inhibition suppresses fructose uptake in these cells. Consistently, in Ghsr mutant RAW 264.7 and IMG cells, the fructose‐induced upregulation of AMPK phosphorylation was attenuated (Figure 3D,E), indicating that the fructose‐associated energy metabolic signaling was downregulated. Taken together, our findings suggest that inhibiting GHSR suppresses both the uptake and metabolism of fructose in macrophages and microglia.

FIGURE 3.

FIGURE 3

Ghsr inhibition suppresses the expression of fructose transporter GLUT5 and AMPK phosphorylation in macrophages and microglia. (A) A schematic diagram illustrates the fructose uptake and the initiation of fructose metabolism. (B, C) Relative mRNA levels of GLUT5 (encoded by gene Slc2a5) and ketohexokinase (encoded by gene Khk) in RAW 264.7 (B) or IMG (C) cells. (D, E) Representative immunoblot images and quantification of GLUT5, p‐AMPKα (Thr172), and AMPKα in RAW 264.7 (D) or IMG (E) cells. Data were presented as mean ± SEM, # p < .05; ## p < .01; ### p < .001, +Fru vs. −Fru; *p < .05; **p < .01; ***p < .001, Ghsr mutant vs. WT.

3.4. Ghsr inhibition attenuates fructose‐induced pro‐inflammatory activation in macrophages and microglia via CREB–AKT, NF‐κB p65, and p38 MAPK signaling pathways

It has been well documented that NF‐κB and p38 MAPK signaling pathways are two central signaling pathways involved in the pro‐inflammatory activation of macrophages. 60 , 61 We previously reported that GHSR‐mediated CREBAKT signaling regulates NF‐κB phosphorylation and its nuclear translocation, thereby regulating the pro‐inflammatory polarization of macrophages under inflammatory stimulation. 34 Consistently, using QIAGEN Ingenuity Pathway Analysis (IPA) software powered by the QIAGEN Biomedical Knowledge Bases database, 48 , 49 we performed interactome network analysis on GHSR‐associated networks. Our analysis revealed a strong crosstalk among GHSR, NF‐κB, and p38 MAPK‐AP1 signaling pathways (Figure S2A). Additionally, using the virtual laboratory PROMO to identify putative transcription factor binding sites (TFBS) in the DNA sequences of the Ghsr promoter region, 53 CREB was predicted to be one of them (Figure S2B,C). Based on these predictions, we investigated the inflammatory signaling pathways induced by fructose and the effect of GHSR on these pathways. We found that under fructose exposure, phosphorylation of CREB at Ser133 in RAW 264.7 and IMG cells was significantly increased (Figure 4A,B). In addition, two phosphorylation sites highly indicative of AKT activation, Ser473 and Thr308, 62 , 63 were also markedly elevated under fructose (Figure 4A,B). More importantly, under fructose treatment, phosphorylation of the key transcription factor NF‐κB p65 exhibited a significant increase, indicating an NF‐κB‐mediated pro‐inflammatory shift in macrophages and microglia. Remarkably, in GHSR deletion mutant (Ghsr mutant) macrophages and microglia, we observed a pronounced downregulation of fructose‐induced CREB, AKT, and NF‐κB p65 phosphorylation (Figure 4A,B). These results demonstrate that GHSR modulates the CREB–AKT and NF‐κB signaling cascade to promote fructose‐induced pro‐inflammatory activation. In addition to NF‐κB p65, we also found a significant increase in p38 MAPK phosphorylation in RAW 264.7 and IMG cells upon fructose exposure, and inhibition of GHSR significantly suppressed fructose‐induced p38 phosphorylation in both cell types (Figure 4C,D). Collectively, these findings indicate that fructose‐induced pro‐inflammatory activation in RAW 264.7 macrophages and IMG microglia is, at least in part, through NF‐κB p65 and p38 MAPK signaling pathways, and the fructose‐induced immunoregulation is GHSR dependent (Figure 4E).

FIGURE 4.

FIGURE 4

Ghsr Inhibition suppresses fructose‐induced CREB–AKT, NF‐κB p65, and p38 MAPK signaling cascades in macrophages and microglia. WT & Ghsr‐mutant (Ghsr mutant) RAW 264.7 macrophages and IMG microglia were treated with fructose (+Fru) for 24 h. (A, B) Representative immunoblot images and quantification results of p‐CREB (Ser133), CREB, p‐AKT (Ser473), p‐AKT (Thr308), AKT, p‐NF‐κB p65 (Ser536), and NF‐κB p65 in RAW 264.7 (A) and IMG (B). (C, D) Representative immunoblot images and quantification results of p‐p38 MAPK (Thr180/Tyr182) and p38 MAPK in RAW 264.7 (C) or IMG (D). Data were presented as mean ± SEM, # p < .05; ## p < .01; ### p < .001, +Fru vs. −Fru; *p < .05; **p < .01; ***p < .001, Ghsr mutant vs. WT. (E) The schematic diagram illustrates the effect of GHSR on fructose‐induced inflammatory pathways of RAW 264.7 macrophages and IMG microglia. The dashed arrow from GHSR to p38 indicates that the regulation of p38 by GHSR is likely to involve multiple steps.

4. DISCUSSION

Over the past few decades, the extensive use of HFCS as a sweetener in many foods and beverages has raised serious concerns regarding the potential adverse effects of excessive fructose consumption on health. 11 , 12 For example, excessive fructose uptake could increase total calorie consumption and trigger chronic inflammation. 15 , 17 A recent study has demonstrated that exposure to fructose compromises the metabolic flexibility of monocytes and macrophages, rendering these immune cells more susceptible to endotoxin LPS‐induced inflammation. 41 In mice subjected to a two‐week diet of a 10% fructose‐glucose mixture, serum levels of pro‐inflammatory cytokines IL‐1β and IL‐6 were significantly elevated compared to control groups following intraperitoneal injection of LPS. 41 Here we systematically elucidated the pro‐inflammatory effects of fructose in both macrophages and microglia, leading to several key findings: (1) Fructose exposure significantly induces pro‐inflammatory activation of macrophages and microglia; (2) Fructose promotes GHSR expression, which in turn upregulates CREB–AKT, NF‐κB, and p38 pro‐inflammatory signaling cascades; (3) GHSR alters fructose uptake and metabolism in macrophages and microglia; (4) GHSR inhibition significantly suppresses the utilization of fructose in macrophages and microglia, improving the reprogramming of metabolic and inflammatory pathways. Collectively, we demonstrated that fructose exposure induces pro‐inflammatory activation in macrophages and microglia, with a more robust effect on pro‐inflammatory activation than the same molar concentration of glucose. More importantly, we found the pro‐inflammatory effect of fructose in myeloid cells is mediated, at least in part, by GHSR, which engages the CREB–AKT, NF‐κB, and p38 MAPK signaling pathways. Our results suggest that GHSR may serve as an effective immune therapeutic target against diet‐induced inflammation.

In addition to inflammation in peripheral tissue, long‐term fructose consumption also triggers inflammation in the brain. Neurons primarily utilize glucose as their main energy source. 18 , 54 However, excessive fructose consumption leads to elevated fructose influx into the brain through the blood–brain barrier and upregulates the expression of GLUT5 in neurons to facilitate fructose uptake. 28 , 59 , 64 Simultaneously, microglia become activated in response to fructose stimulation and produce pro‐inflammatory cytokines. 19 , 27 , 28 Prolonged activation of microglia is considered a key risk factor in the development of neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease. 30 , 65 We recently reported that GHSR in the neurons plays a crucial role in regulating cognitive function in mice, and neuronal ablation of GHSR significantly improves depression and memory decline induced by diet‐induced obesity. 31 Here, we extended our molecular mechanistic investigation of fructose to microglia. Our findings demonstrated that GHSR‐mediated CREB–AKT, NF‐κB, and p38 signaling pathways contribute to fructose‐induced pro‐inflammatory activation in microglia. This new finding suggests that fructose may be a dietary risk factor for the development of neurodegenerative diseases, and targeting GHSR in microglia may serve as a potential strategy to prevent neuroinflammation and combat neurodegenerative diseases.

Furthermore, we showed here that GHSR deletion suppresses the expression of the fructose transporter GLUT5 and the phosphorylation of AMPK, indicating that GHSR plays a role in regulating the uptake and metabolism of fructose in macrophages and microglia. While the activation of AMPK is widely recognized for its anti‐inflammatory effects, 66 , 67 , 68 several studies have highlighted its essential role in the phosphorylation and activation of AKT under stress conditions. 68 , 69 Using chemical or genetic approaches to inhibit AMPK resulted in significant downregulation of AKT phosphorylation at Thr308 and Ser473. 68 , 69 Restoring AMPK expression in AMPK knockdown cells restored the AKT phosphorylation and activation. 69 More importantly, fructose metabolism leads to an elevation of AMP levels, which serves as a substrate for generating uric acid. 70 , 71 Uric acid is a potent pro‐inflammatory agent that can activate AKT 72 and p38 MAPK, 73 , 74 which further enhance the activity of NF‐ᴋB and activator protein 1 (AP1), promoting pro‐inflammatory gene expression. 61 , 73 , 75 Overall, we propose that fructose exposure leads to upregulation of GLUT5 and nutrient‐sensing GHSR in macrophages and microglia that activate CREB and increase the intracellular AMP/ATP ratio, which in turn promotes AMPK phosphorylation and activation. This process subsequently activates AKT and p38, triggering a pro‐inflammatory signaling cascade. We postulate that inhibiting Ghsr expression in macrophages and microglia reduces fructose uptake and fructose metabolism, which suppresses the onset of pro‐inflammatory activation to maintain immune homeostasis (Figure 5).

FIGURE 5.

FIGURE 5

The proposed model illustrating the role of GHSR in fructose‐induced pro‐inflammatory activation in macrophages and microglia. In this study, we demonstrated that fructose exposure promotes inflammatory activation in macrophages and microglia. GHSR is involved in three aspects of the regulation: (1) GHSR stimulates the CREB–AKT and NF‐κB pro‐inflammatory signaling pathways, which are essential for fructose‐induced inflammation (noted as number 1 in the diagram); (2) GHSR expression directly or indirectly regulates fructose uptake and metabolism by promoting GLUT5 and KHK. This regulation alters the intracellular energy balance and AMP/ATP ratio, and the upregulation of AMP can subsequently promote inflammation via the AMPK–AKT and p38 pathways (noted as number 2 in the diagram); (3) Fructose increases Ghsr gene expression in macrophages and microglia potentially through CREB, resulting in a positive feedback loop that further exacerbates the inflammatory state (noted as number 3 in the diagram).

There are some limitations of our study. Although we revealed that fructose exposure significantly upregulates GHSR expression in macrophages and microglia, and GHSR is required in fructose‐induced pro‐inflammatory activation through regulating fructose transport and metabolic pathways, the detailed regulatory mechanisms and the hierarchy of the signaling pathways require further investigation. We previously reported a strong correlation between GHSR and CREB upregulation under diet‐induced obesity. 34 In the current study, our results also showed that CREB phosphorylation was significantly upregulated under fructose exposure. Therefore, it is possible that fructose not only activates the GHSR‐mediated CREB – AKT axis but also promotes GHSR expression via CREB. This positive feedback loop may further exacerbate fructose‐induced inflammation. To further determine whether our mechanistic findings are relevant to humans, it would be beneficial for future studies to involve human macrophages and microglia. It has been reported that fructose stimulates inflammatory activation in both mouse macrophages and human monocytes via AKT‐mediated signaling. 41 Since mouse and human immune cells have similar responses to fructose, we believe that GHSR likely promotes fructose‐induced inflammation in human macrophages as well.

In summary, our study offers novel insights into the direct effects of fructose in macrophages and microglia and the role of GHSR in fructose‐induced inflammatory activation of macrophages and microglia. Mechanistically, the GHSR‐mediated CREB–AKT, NF‐κB, and p38 signaling pathways regulate fructose‐induced inflammation. These findings underscore the immunotoxicity of fructose and suggest the therapeutic potential of GHSR inhibition in the prevention/treatment of fructose‐induced inflammation.

AUTHOR CONTRIBUTIONS

Zheng Shen, Zeyu Liu, and Yuxiang Sun designed research; Zheng Shen, Zeyu Liu, Hongying Wang, and Danilo Landrock conducted research; Zheng Shen and Zeyu Liu analyzed data; Zheng Shen, Zeyu Liu, Hongying Wang, and Ji Yeon Noh wrote the paper; Zheng Shen, Zeyu Liu, Hongying Wang, Danilo Landrock, Ji Yeon Noh, Qun Sophia Zang, Yuhua Z. Farnell, Zheng Chen, and Yuxiang Sun reviewed and edited the paper; Yuxiang Sun had primary responsibility for final content. All authors read and approved the final manuscript.

DISCLOSURES

The authors declare no conflicts of interest.

Supporting information

Figures S1‐S2.

FSB2-39-e70412-s001.pdf (312.4KB, pdf)

ACKNOWLEDGMENTS

The authors extend their appreciation to Dr. Andrei Golovko at the Texas Institute for Genomic Medicine, Texas A&M University, for generating the Ghsr deletion mutant RAW 264.7 and IMG cell lines used in this study. The authors also appreciate the technical contributions of Briget Shull, Jazmin Lopez, and Ryme Elboukhani to this project. This study was supported by NIH/NIDDK R01DK118334, NIH/NIA R01AG064869, and BrightFocus Foundation Grant A2019630S (YS). This work was also supported in part by the Texas A&M AgriLife Institute for Advancing Health Through Agriculture, NIH/NIEHS 2P30ES029067, USDA Hatch project 7001445, and USDA NIFA 1022378 (YS), and NIH/NIAID R21AI178434 (QSZ & YS).

Shen Z, Liu Z, Wang H, et al. Fructose induces inflammatory activation in macrophages and microglia through the nutrient‐sensing ghrelin receptor. The FASEB Journal. 2025;39:e70412. doi: 10.1096/fj.202402531R

Zheng Shen and Zeyu Liu contributed equally to this project.

DATA AVAILABILITY STATEMENT

The data supporting this study's findings are available on request from the corresponding author.

REFERENCES

  • 1. Bray GA, Nielsen SJ, Popkin BM. Consumption of high‐fructose corn syrup in beverages may play a role in the epidemic of obesity. Am J Clin Nutr. 2004;79:537‐543. [DOI] [PubMed] [Google Scholar]
  • 2. Ludwig DS, Peterson KE, Gortmaker SL. Relation between consumption of sugar‐sweetened drinks and childhood obesity: a prospective, observational analysis. Lancet. 2001;357:505‐508. [DOI] [PubMed] [Google Scholar]
  • 3. Raben A, Vasilaras TH, Møller AC, Astrup A. Sucrose compared with artificial sweeteners: different effects on ad libitum food intake and body weight after 10 wk of supplementation in overweight subjects. Am J Clin Nutr. 2002;76:721‐729. [DOI] [PubMed] [Google Scholar]
  • 4. Vuilleumier S. Worldwide production of high‐fructose syrup and crystalline fructose. Am J Clin Nutr. 1993;58(5 Suppl):733S‐736S. doi: 10.1093/ajcn/58.5.733s [DOI] [PubMed] [Google Scholar]
  • 5. Flegal KM, Carroll MD, Ogden CL, Johnson CL. Prevalence and trends in obesity among US adults, 1999–2000. JAMA. 2002;288(14):1723‐1727. doi: 10.1001/jama.288.14.1723 [DOI] [PubMed] [Google Scholar]
  • 6. Gregg EW, Cadwell BL, Cheng YJ, et al. Trends in the prevalence and ratio of diagnosed to undiagnosed diabetes according to obesity levels in the U.S. Diabetes Care. 2004;27:2806‐2812. [DOI] [PubMed] [Google Scholar]
  • 7. Woolcott OO, Seuring T. Temporal trends in obesity defined by the relative fat mass (RFM) index among adults in the United States from 1999 to 2020: a population‐based study. BMJ Open. 2023;13:e071295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Cato W, Linda HM, Eric C, et al. Trends in nutrition, lifestyle, and metabolic disease in the United States from 1900 onwards. PharmaNutrition. 2023;25:100350. doi: 10.1016/j.phanu.2023.100350 [DOI] [Google Scholar]
  • 9. Li X, Joh HK, Hur J, et al. Fructose consumption from different food sources and cardiometabolic biomarkers: cross‐sectional associations in US men and women. Am J Clin Nutr. 2023;117:490‐498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Basaranoglu M, Basaranoglu G, Bugianesi E. Carbohydrate intake and nonalcoholic fatty liver disease: fructose as a weapon of mass destruction. Hepatobiliary Surg Nutr. 2015;4:109‐116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Coronati M, Baratta F, Pastori D, Ferro D, Angelico F, Del Ben M. Added fructose in non‐alcoholic fatty liver disease and in metabolic syndrome: a narrative review. Nutrients. 2022;14:1127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Hattori H, Hanai Y, Oshima Y, Kataoka H, Eto N. Excessive intake of high‐fructose corn syrup drinks induces impaired glucose tolerance. Biomedicine. 2021;9(5):541. doi: 10.3390/biomedicines9050541 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Goran MI, Ulijaszek SJ, Ventura EE. High fructose corn syrup and diabetes prevalence: a global perspective. Glob Public Health. 2013;8:55‐64. [DOI] [PubMed] [Google Scholar]
  • 14. Ma X, Lin L, Yue J, et al. Suppression of ghrelin exacerbates HFCS‐induced adiposity and insulin resistance. Int J Mol Sci. 2017;18:1302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Wang L, Ji T, Yuan Y, et al. High‐fructose corn syrup promotes proinflammatory macrophage activation via ROS‐mediated NF‐κB signaling and exacerbates colitis in mice. Int Immunopharmacol. 2022;109:108814. [DOI] [PubMed] [Google Scholar]
  • 16. DeChristopher LR, Uribarri J, Tucker KL. Intake of high‐fructose corn syrup sweetened soft drinks, fruit drinks and apple juice is associated with prevalent arthritis in US adults, aged 20‐30 years. Nutr Diabetes. 2016;6:e199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Ma X, Lin L, Yue J, et al. Ghrelin receptor regulates HFCS‐induced adipose inflammation and insulin resistance. Nutr Diabetes. 2013;3:e99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Mizuno TM, Lew PS, Jhanji G. Regulation of the fructose transporter gene Slc2a5 expression by glucose in cultured microglial cells. Int J Mol Sci. 2021;22(23):12668. doi: 10.3390/ijms222312668 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Xu MX, Yu R, Shao LF, et al. Up‐regulated fractalkine (FKN) and its receptor CX3CR1 are involved in fructose‐induced neuroinflammation: suppression by curcumin. Brain Behav Immun. 2016;58:69‐81. [DOI] [PubMed] [Google Scholar]
  • 20. Cigliano L, Spagnuolo MS, Crescenzo R, et al. Short‐term fructose feeding induces inflammation and oxidative stress in the hippocampus of young and adult rats. Mol Neurobiol. 2018;55:2869‐2883. [DOI] [PubMed] [Google Scholar]
  • 21. Hirayama D, Iida T, Nakase H. The phagocytic function of macrophage‐enforcing innate immunity and tissue homeostasis. Int J Mol Sci. 2017;19(1):92. doi: 10.3390/ijms19010092 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Roland Osei S, Precious B, Samuel VN. The interactive role of macrophages in innate immunity. In: Vijay K, ed. Chapter 3, Macrophages. IntechOpen; 2022. [Google Scholar]
  • 23. Govaere O, Petersen SK, Martinez‐Lopez N, et al. Macrophage scavenger receptor 1 mediates lipid‐induced inflammation in non‐alcoholic fatty liver disease. J Hepatol. 2022;76:1001‐1012. [DOI] [PubMed] [Google Scholar]
  • 24. Lee H, Fessler MB, Qu P, Heymann J, Kopp JB. Macrophage polarization in innate immune responses contributing to pathogenesis of chronic kidney disease. BMC Nephrol. 2020;21:270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Ye X, Liu Z, Han HW, et al. Nutrient‐sensing ghrelin receptor in macrophages modulates bisphenol A‐induced intestinal inflammation in mice. Genes (Basel). 2023;14(7):1455. doi: 10.3390/genes14071455 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Li Q, Barres BA. Microglia and macrophages in brain homeostasis and disease. Nat Rev Immunol. 2018;18:225‐242. [DOI] [PubMed] [Google Scholar]
  • 27. Ho CY, Lin YT, Chen HH, et al. CX3CR1‐microglia mediates neuroinflammation and blood pressure regulation in the nucleus tractus solitarii of fructose‐induced hypertensive rats. J Neuroinflammation. 2020;17:185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Ting KKY. Fructose overconsumption‐induced reprogramming of microglia metabolism and function. Front Immunol. 2024;15:1375453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Kreutzberg GW. Microglia: a sensor for pathological events in the CNS. Trends Neurosci. 1996;19:312‐318. [DOI] [PubMed] [Google Scholar]
  • 30. Yu Y, Ye RD. Microglial Aβ receptors in Alzheimer's disease. Cell Mol Neurobiol. 2015;35:71‐83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Wang H, Shen Z, Wu CS, et al. Neuronal ablation of GHSR mitigates diet‐induced depression and memory impairment via AMPK‐autophagy signaling‐mediated inflammation. Front Immunol. 2024;15:1339937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Sun Y, Wang P, Zheng H, Smith RG. Ghrelin stimulation of growth hormone release and appetite is mediated through the growth hormone secretagogue receptor. Proc Natl Acad Sci USA. 2004;101:4679‐4684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Mear Y, Enjalbert A, Thirion S. GHS‐R1a constitutive activity and its physiological relevance. Front Neurosci. 2013;7:87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Kim DM, Lee JH, Pan Q, et al. Nutrient‐sensing growth hormone secretagogue receptor in macrophage programming and meta‐inflammation. Mol Metab. 2024;79:101852. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Hendel A, Bak RO, Clark JT, et al. Chemically modified guide RNAs enhance CRISPR‐Cas genome editing in human primary cells. Nat Biotechnol. 2015;33:985‐989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Synthego . Limiting Dilution & Clonal Expansion:32019. Available from: https://app‐na1.hubspotdocuments.com/documents/2418554/view/23207011?accessId=2aae5e. [Google Scholar]
  • 37. Toda G, Yamauchi T, Kadowaki T, Ueki K. Preparation and culture of bone marrow‐derived macrophages from mice for functional analysis. STAR Protoc. 2021;2:100246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Yun JK, McCormick TS, Villabona C, Judware RR, Espinosa MB, Lapetina EG. Inflammatory mediators are perpetuated in macrophages resistant to apoptosis induced by hypoxia. Proc Natl Acad Sci USA. 1997;94(25):13903‐13908. doi: 10.1073/pnas.94.25.13903 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Dalzon B, Torres A, Devcic J, Fenel D, Sergent JA, Rabilloud T. A low‐serum culture system for prolonged in vitro toxicology experiments on a macrophage system. Front Toxicol. 2021;3:780778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Ovanesov MV, Sauder C, Rubin SA, et al. Activation of microglia by borna disease virus infection: in vitro study. J Virol. 2006;80:12141‐12148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Jones N, Blagih J, Zani F, et al. Fructose reprogrammes glutamine‐dependent oxidative metabolism to support LPS‐induced inflammation. Nat Commun. 2021;12:1209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Zhao S, Jang C, Liu J, et al. Dietary fructose feeds hepatic lipogenesis via microbiota‐derived acetate. Nature. 2020;579:586‐591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Jang C, Hui S, Lu W, et al. The small intestine converts dietary fructose into glucose and organic acids. Cell Metab. 2018;27:351‐361.e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Jang C, Wada S, Yang S, et al. The small intestine shields the liver from fructose‐induced steatosis. Nat Metab. 2020;2:586‐593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐Delta Delta C(T)) method. Methods. 2001;25:402‐408. [DOI] [PubMed] [Google Scholar]
  • 46. Li X, Chen Y, Shen JZ, et al. Epigallocatechin gallate inhibits hepatic glucose production in primary hepatocytes via downregulating PKA signaling pathways and transcriptional factor FoxO1. J Agric Food Chem. 2019;67:3651‐3661. [DOI] [PubMed] [Google Scholar]
  • 47. Sagini MN, Zepp M, Bergmann F, Bozza M, Harbottle R, Berger MR. The expression of genes contributing to pancreatic adenocarcinoma progression is influenced by the respective environment. Genes Cancer. 2018;9:114‐129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Chung S, Kim IH, Lee D, et al. The role of inositol 1,4,5‐trisphosphate 3‐kinase A in regulating emotional behavior and amygdala function. Sci Rep. 2016;6:23757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Calvano SE, Xiao W, Richards DR, et al. A network‐based analysis of systemic inflammation in humans. Nature. 2005;437:1032‐1037. doi: 10.1038/nature03985 [DOI] [PubMed] [Google Scholar]
  • 50. Clément V, Roy V, Paré B, et al. Tridimensional cell culture of dermal fibroblasts promotes exosome‐mediated secretion of extracellular matrix proteins. Sci Rep. 2022;12:19786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Cirillo E, Parnell LD, Evelo CT. A review of pathway‐based analysis tools that visualize genetic variants. Front Genet. 2017;8:174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Farré D, Roset R, Huerta M, et al. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 2003;31:3651‐3653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Messeguer X, Escudero R, Farré D, Núñez O, Martínez J, Albà MM. PROMO: detection of known transcription regulatory elements using species‐tailored searches. Bioinformatics. 2002;18:333‐334. [DOI] [PubMed] [Google Scholar]
  • 54. Payant MA, Chee MJ. Neural mechanisms underlying the role of fructose in overfeeding. Neurosci Biobehav Rev. 2021;128:346‐357. [DOI] [PubMed] [Google Scholar]
  • 55. Park SH, Helsley RN, Fadhul T, et al. Fructose induced KHK‐C can increase ER stress independent of its effect on lipogenesis to drive liver disease in diet‐induced and genetic models of NAFLD. Metabolism. 2023;145:155591. doi: 10.1016/j.metabol.2023.155591 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Horikoshi Y, Sasaki A, Taguchi N, et al. Human GLUT5 immunolabeling is useful for evaluating microglial status in neuropathological study using paraffin sections. Acta Neuropathol. 2003;105:157‐162. [DOI] [PubMed] [Google Scholar]
  • 57. Malide D, Davies‐Hill TM, Levine M, Simpson IA. Distinct localization of GLUT‐1, ‐3, and ‐5 in human monocyte‐derived macrophages: effects of cell activation. Am J Phys. 1998;274:E516‐E526. [DOI] [PubMed] [Google Scholar]
  • 58. Merino B, Fernández‐Díaz CM, Cózar‐Castellano I, Perdomo G. Intestinal fructose and glucose metabolism in health and disease. Nutrients. 2019;12(1):94. doi: 10.3390/nu12010094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Jurcovicova J. Glucose transport in brain—effect of inflammation. Endocr Regul. 2014;48:35‐48. [DOI] [PubMed] [Google Scholar]
  • 60. Yang Y, Kim SC, Yu T, et al. Functional roles of p38 mitogen‐activated protein kinase in macrophage‐mediated inflammatory responses. Mediat Inflamm. 2014;2014:352371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Liang W, Han B, Hai Y, et al. The role of microglia/macrophages activation and TLR4/NF‐κB/MAPK pathway in distraction spinal cord injury‐induced inflammation. Front Cell Neurosci. 2022;16:926453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Su CH, Wang CY, Lan KH, et al. Akt phosphorylation at Thr308 and Ser473 is required for CHIP‐mediated ubiquitination of the kinase. Cell Signal. 2011;23:1824‐1830. [DOI] [PubMed] [Google Scholar]
  • 63. Yung HW, Charnock‐Jones DS, Burton GJ. Regulation of AKT phosphorylation at Ser473 and Thr308 by endoplasmic reticulum stress modulates substrate specificity in a severity dependent manner. PLoS One. 2011;6:e17894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Shu HJ, Isenberg K, Cormier RJ, Benz A, Zorumski CF. Expression of fructose sensitive glucose transporter in the brains of fructose‐fed rats. Neuroscience. 2006;140:889‐895. [DOI] [PubMed] [Google Scholar]
  • 65. Ho MS. Microglia in Parkinson's disease. Adv Exp Med Biol. 2019;1175:335‐353. [DOI] [PubMed] [Google Scholar]
  • 66. Jeon SM. Regulation and function of AMPK in physiology and diseases. Exp Mol Med. 2016;48:e245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Lindholm CR, Ertel RL, Bauwens JD, Schmuck EG, Mulligan JD, Saupe KW. A high‐fat diet decreases AMPK activity in multiple tissues in the absence of hyperglycemia or systemic inflammation in rats. J Physiol Biochem. 2013;69:165‐175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Zhu YP, Brown JR, Sag D, Zhang L, Suttles J. Adenosine 5′‐monophosphate‐activated protein kinase regulates IL‐10‐mediated anti‐inflammatory signaling pathways in macrophages. J Immunol. 2015;194:584‐594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Han F, Li CF, Cai Z, et al. The critical role of AMPK in driving Akt activation under stress, tumorigenesis and drug resistance. Nat Commun. 2018;9:4728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Lubawy M, Formanowicz D. High‐fructose diet‐induced hyperuricemia accompanying metabolic syndrome‐mechanisms and dietary therapy proposals. Int J Environ Res Public Health. 2023;20(4):3596. doi: 10.3390/ijerph20043596 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Zhang C, Li L, Zhang Y, Zeng C. Recent advances in fructose intake and risk of hyperuricemia. Biomed Pharmacother. 2020;131:110795. [DOI] [PubMed] [Google Scholar]
  • 72. Crişan TO, Cleophas MCP, Novakovic B, et al. Uric acid priming in human monocytes is driven by the AKT‐PRAS40 autophagy pathway. Proc Natl Acad Sci USA. 2017;114(21):5485‐5490. doi: 10.1073/pnas.1620910114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Kırça M, Oğuz N, Çetin A, Uzuner F, Yeşilkaya A. Uric acid stimulates proliferative pathways in vascular smooth muscle cells through the activation of p38 MAPK, p44/42 MAPK and PDGFRβ. J Recept Signal Transduct Res. 2017;37:167‐173. [DOI] [PubMed] [Google Scholar]
  • 74. Kanellis J, Watanabe S, Li JH, et al. Uric acid stimulates monocyte chemoattractant protein‐1 production in vascular smooth muscle cells via mitogen‐activated protein kinase and cyclooxygenase‐2. Hypertension. 2003;41:1287‐1293. [DOI] [PubMed] [Google Scholar]
  • 75. Zhou Y, Fang L, Jiang L, et al. Uric acid induces renal inflammation via activating tubular NF‐κB signaling pathway. PLoS One. 2012;7:e39738. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figures S1‐S2.

FSB2-39-e70412-s001.pdf (312.4KB, pdf)

Data Availability Statement

The data supporting this study's findings are available on request from the corresponding author.


Articles from The FASEB Journal are provided here courtesy of Wiley

RESOURCES