Protocol for measuring the auxin-induced changes of m⁶A modification

Summary

Plant m⁶A modification is highly dynamic, with plant hormones serving as key regulators that induce these dynamics. Here, we present a protocol for detecting phytohormone-induced changes in m⁶A modification using RNA dot blot and m⁶A sequencing (m⁶A-seq) techniques. We describe steps for the auxin treatment, RNA dot blot and m⁶A-seq library preparation, and data analysis. This protocol holds potential applications for analyzing changes in m⁶A modification induced by plant hormones.

For complete details on the use and execution of this protocol, please refer to Bin et al.¹

Graphical abstract

Highlights

• •Protocol for auxin treatment of Arabidopsis seedlings
• •Steps for analyzing m⁶A abundance by RNA dot blot
• •Instructions for m⁶A-seq library preparation and data analysis

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Plant m⁶A modification is highly dynamic, with plant hormones serving as key regulators that induce these dynamics. Here, we present a protocol for detecting phytohormone-induced changes in m⁶A modification using RNA dot blot and m⁶A sequencing (m⁶A-seq) techniques. We describe steps for the auxin treatment, RNA dot blot and m⁶A-seq library preparation, and data analysis. This protocol holds potential applications for analyzing changes in m⁶A modification induced by plant hormones.

Before you begin

N⁶-methyladenosine (m⁶A) plays a crucial role in various biological processes in plants, including plant growth and development, disease resistance, flowering and fertility.² The addition of m⁶A marks is facilitated by a methyltransferase complex, while demethylases are responsible for their removal.³ The abundance and distribution of plant m⁶A vary across different developmental stages and environmental conditions. Numerous studies have concentrated on the modification of m⁶A in response to biotic and abiotic stressors.² However, the mechanisms by which endogenous signals, such as phytohormones, regulate m⁶A modification remain inadequately understood, and the established protocol to study this regulation is not fully described.

Recently, we employed the procedures outlined in this protocol, in conjunction with genetic analyses and biochemical experiments, to demonstrate how the activity of the m⁶A methyltransferase complex is regulated by auxin. This protocol, which encompasses auxin treatment, RNA extraction and mRNA enrichment, RNA dot blotting, and m⁶A sequencing (m⁶A-seq), offers a comprehensive workflow for detecting auxin-induced changes in m⁶A abundance and distribution. Other more accurate quantification methods such as LC-MS/MS should be used to confirm the RNA dot blotting result. Additionally, this protocol can be adapted to explore m⁶A dynamics in different development stages and in response to other phytohormones in plants.

Prepare 1/2 MS media plates

Timing: 2 h

• 1.Add 2.21 g MS powder and dissolve it with 1000 mL water.
• 2.Add 10 g sucrose to dissolve.
• 3.Adjust pH to 5.8.
• 4.Add 10 g Agar.
• 5.Sterilization in 115°C for 15 min.
• 6.Mix and pour into 90 mm square plates.

Store at 4°C for up to two weeks.

Preparations of stock solutions

• 7.
  Prepare 1 mL of auxin (1000x) stock solution.

  • a.
    Dissolve 0.18 g auxin powder in 1 mL 75% alcohol.
  • b.
    Mix on a magnetic stirrer.
  • c.
    Store away from light at −20°C.

CRITICAL: Auxin is easily decomposed in light, so it should be kept away from light.

• 8.
  Prepare 100 mL 1 M Tris-HCl (pH7.5).

  • a.
    Dissolve 12.11 g Tris-base powder in 90 mL ddH₂0.
  • b.
    Adjust pH value to 7.5 with HCl.
  • c.
    Adjust volume to 100 mL.
• 9.
  Prepare 100 mL of 0.5 M EDTA (pH8.0).

  • a.
    Dissolve 14.55 g EDTA powder in 90 mL ddH₂O.
  • b.
    Adjust pH value to 8.0 with NaOH.
  • c.
    Adjust volume to 100 mL.
• 10.
  Prepare 100 mL of 1 M LiCl.

  • a.
    Dissolve 4.24 g LiCl powder in 90 mL ddH₂O.
  • b.
    Adjust volume to 100 mL.

Preparations of working solutions

• 11.
  Prepare 10 mL Binding buffer.

  • a.
    Add 200 μL 1 M Tris-HCl.
  • b.
    Add 5 mL 1 M LiCl.
  • c.
    Add 40 μL 0.5 M EDTA.
  • d.
    Adjust volume to 10 mL.
  • e.
    Mix on a magnetic stirrer at 25°C.
• 12.
  Prepare 10 mL Wash buffer.

  • a.
    Add 100 μL 1 M Tris-HCl.
  • b.
    Add 300 μL 1 M LiCl.
  • c.
    Add 20 μL 0.5 M EDTA.
  • d.
    Mix on a magnetic stirrer at 25°C.
• 13.
  Prepare 1000 mL 1x TBST.

  • a.
    Add 100 mL 10x TBST.
  • b.
    Add 900 mL ddH₂O.
  • c.
    Mix on a magnetic stirrer.
• 14.
  Prepare 50 mL 5% milk solution.

  • a.
    Add 2.5 g skim milk in 50 mL 1x TBST.
  • b.
    Mix on a magnetic stirrer.
  • c.
    Store at 4°C.
• 15.
  Prepare 10 mL m⁶A antibody solution.

  • a.
    Add 0.3 g BSA in 10 mL 1x TBST.
  • b.
    Mix on a magnetic stirrer.
  • c.
    Add 10 μL Anti-N⁶-methyladenosine antibody, final concentration is 1 μg/mL.
  • d.
    Mix well and store at 4°C.
• 16.
  Prepare 10 mL secondary antibody solution.

  • a.
    Add 0.5 g skim milk in 10 mL 1x TBST.
  • b.
    Mix on a magnetic stirrer.
  • c.
    Add 2 μL HRP conjugated Goat Anti-Rabbit antibody.
  • d.
    Mix well and store at 4°C.
• 17.
  Prepare 100 mL TE buffer.

  • a.
    Add 1 mL 1 M Tris-HCl.
  • b.
    Add 200 μL 0.5 M EDTA.
  • c.
    Adjust volume to 100 mL.
• 18.
  Prepare 10 mL 5x RNA binding buffer.

  • a.
    Add 0.5 mL 1 M Tris-HCl.
  • b.
    Add 1.5 mL 3 M NaCl.
  • c.
    Add 0.5 mL Igepal CA-630.
  • d.
    Adjust volume to 10 mL.
• 19.
  Prepare 10 mL 1x RNA binding buffer.

  • a.
    Add 2 mL 5x RNA binding buffer.
  • b.
    Add 8 mL ddH₂O.
  • c.
    Mix on a magnetic stirrer.
• 20.
  Prepare RNA elution buffer.

  • a.
    Add 90 μL 5x RNA binding buffer.
  • b.
    Add 150 μL m⁶A (20 mM stock).
  • c.
    Add 7 μL RNasin Plus.
  • d.
    Adjust volume to 450 μL.

Note: All buffer preparations for RNA extraction and mRNA enrichment are to be working in RNase free conditions.

Primer for RT-qPCR

Primer (5′-3′)	Sequence
GH3-RT-F	CAATTTAAGTTATTTAGCCG
GH3-RT-R	TGTTCGTCATTAACATCGAC
ARF1-RT-F	CCAATCATTCATCTGGTAAACCT
ARF1-RT-R	CATCTGTTGCTCCAAACCTTGG

RNA-to-cDNA mix

Reagent	Amount
10X ezDNase Buffer	1 μL
ezDNase enzyme	1 μL
500 μg/μL	1 μL
Nuclease-free Water	to 10 μL

Cycling conditions

Steps	Temperature	Time
Anneal primers	25°C	10 min
Reverse transcribe RNA	50°C	10 min
Inactivate enzyme	85°C	5 min
Hold	4°C	One week

qPCR reaction master mix

Reagent	Amount
2x SYBR	10 μL
Primer 1	2 μL
Primer 2	2 μL
cDNA	1 μL
ddH2O	4 μL
Total	20 μL

qPCR cycling conditions

Steps	Temperature	Time	Cycles
Initial Denaturation	98°C	30 s	1
Denaturation	98°C	10 s	40 cycles
Annealing	60°C	20 s
Extension	72°C	20 s
Final extension	72°C	5 min	1
Hold	4°C	forever

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-N6-methyladenosine	Abcam	Ab151230 (1:1000 dilution)
Goat anti-rabbit IgG H&L (HRP)	Abcam	Ab6721 (1:5000 dilution)
Chemicals, peptides, and recombinant proteins
TRIzol	Invitrogen	Cat# 15596026CN
Murashige & Skoog medium	Solarbio	Cat# M8521
Oligo (dT) magnetic beads	NEB	Cat# S1419S
Trichloromethane	SCRC	Cat# 10006818
Western ECL substrate	Bio-Rad	Cat# 170-5061
Tris base	Sigma	Cat# 77-86-1
LiCl	Merck	Cat# 7447-41-8
EDTA	Merck	Cat# 60-00-4
NAA	Merck	Cat# 86-87-3
Skim milk	BD Difco	Cat# 232100
10X TBST	Biosharp	Cat# BL315B
DNase I	Thermo Fisher Scientific	Cat# EN0525
Nitrocellulose membrane	Pall Corporation	Cat# 69095847
BSA	Sigma	Cat# B667
RNA fragment module	NEB	E6150S
Protein-G beads	Thermo Fisher Scientific	Cat# 88848
IGEPAL CA-630	Sigma	Cat# I8896
m6A	Sigma	Cat# M2780
RNasin Plus	Promega	Cat# N2611
Software and algorithms
ImageJ	Schneider et al.4	https://imagej.nih.gov/ij/
AdapterRemoval	Schubert et al.5	https://adapterremoval.readthedocs.io/en/stable/
STAR	Dobin et al.6	https://github.com/alexdobin/STAR
DEGseq	Wang et al.7	https://www.bioconductor.org/packages/release/bioc/html/DEGseq.html
MeRIPtools	Zhang et al.8	https://github.com/scottzijiezhang/MeRIPtools

Materials and equipment

Binding buffer

Reagent	Final concentration	Amount
Tris-HCl (1 M) pH 7.5	20 mM	200 μL
LiCl (1 M)	0.5 M	5 mL
EDTA (0.5 M) pH 8.0	2 mM	40 μL
ddH2O	N/A	4.76 mL
Total	N/A	10 mL

Storage conditions: Store at 4°C for six months.

Wash buffer

Reagent	Final concentration	Amount
Tris-HCl (1 M) pH 7.5	10 mM	100 μL
LiCl (1 M)	30 mM	300 μL
EDTA (0.5 M) pH 8.0	1 mM	20 μL
ddH2O	N/A	9.58 mL
Total	N/A	10 mL

Storage conditions: Store at 4°C for six months.

5 x RNA binding buffer

Reagent	Final concentration	Amount
Tris-HCl (1 M) pH 7.5	50 mM	0.5 mL
NaCl (3 M)	0.45 M	1.5 mL
Igepal CA-630	5% (v/v)	0.5 mL
ddH2O	N/A	7.5 mL
Total	N/A	10 mL

Storage conditions: Store at 4°C for six months.

RNA elution buffer

Reagent	Final concentration	Amount
Tris-HCl (1 M) pH 7.5	10 mM	4.5 μL
NaCl (3 M)	0.15 M	13.5 μL
Igepal CA-630	1% (v/v)	4.5 μL
m6A (20 mM)	6.67 mM	150 μL
RNasin Plus	0.62 U/μL	7 μL
ddH2O	N/A	270.5 μL
Total	N/A	450 μL

Storage conditions: Store at 4°C for six months. RNasin Plus and m6A should be added to the buffer immediately before use, after which the buffer can be stored at 4°C for up to 2 h.

Step-by-step method details

We provide a detailed step-by-step protocol for auxin treatment, followed by RNA extraction and mRNA purification. The m6A dynamics are analyzed by RNA dot blot and m⁶A-seq.

Arabidopsis seedlings preparation

Timing: 7 days

This step describes how to prepare Arabidopsis seedlings for auxin treatment.

• 1.Sterilize 0.1 g Arabidopsis seeds in 1 mL 75% alcohol for 10 min.
• 2.Remove the supernatant.
• 3.Add 1 mL sterile water to wash seeds for 10 min.
• 4.Remove the supernatant.
• 5.Repeat step c and d, plate sterilized seeds on the 1/2 MS solid medium.
• 6.Put the plates in a fridge at 4°C in the dark for 3 days.
• 7.Place in incubator at 22°C for 7 days under long day condition (16 h light and 8 h dark).

Auxin treatment and material collection

Timing: 24 h

This step describes how to treat Arabidopsis seedlings with NAA.

• 8.Submerge 30 7-day-old Arabidopsis seedlings in 10 mL H₂O with 50 μM NAA in the dark at 21°C without stirring for indicated time (Figure 1).
• 9.Harvest and freeze control and NAA treated seedlings in liquid nitrogen (Figure 1).

Note: As short time treatment of Arabidopsis seedlings in water will not affect their status, for convenience, we used water for NAA treatment. However, for long time treatment, liquid 1/2 MS medium should be used instead.

Figure 1.

Scheme of auxin treatment

Seven-day-old Arabidopsis seedlings are submerged in H₂O with or without 50 μM NAA for 0, 4, 8, 16 and 24 h. Seedlings are collected by RNA extraction.

RNA extraction

Timing: 3 h

This step describes how to extract total RNA from NAA treated Arabidopsis seedlings.

• 10.Homogenize the collected seedlings into powder in liquid nitrogen.
• 11.For each 100 μL powder, add 1000 μL TRIzol reagent and incubate for 10 min on ice.
• 12.Add 200 μL chloroform and mix well.
• 13.Centrifuge at 12,000 x g for 5 min.
• 14.Transfer the supernatant to a new 1.5 mL EP tube.
• 15.Add 500 μL of isopropyl alcohol and incubate at −80°C for 30 min.
• 16.Centrifuge at 12,000 x g for 20 min at 4°C, remove the supernatant.
• 17.Wash the RNA pellet twice with 75% ethanol.
• 18.Remove the remaining ethanol and dry the pellet in the air.
• 19.Dissolve the RNA pellet in 20 μL RNase-free water.

CRITICAL: TRIzol and chloroform are highly toxic, avoid direct contact, wear double gloves for skin protection and remove them immediately after handling TRIzol or chloroform. Always wear safety glasses, a lab coat, and closed-toe shoes and do it in hood. The RNA extraction must be conducted at 4°C, and the tubes need to be ice-chilled before use.

Deplete DNA from RNA

Timing: 2 h

This step describes how to remove DNA from total RNA.

• 20.Aliquot 50 μg RNA and adjust the RNA solution to 38 μL with H₂O.
• 21.Add 10 μL 10x DNase buffer and 2 μL DNase I (1 U/μL) and incubate at 37°C for 5 min.
• 22.Stop the reaction by adding 1000 μL TRIzol.
• 23.Add 200 μL of chloroform and mix.
• 24.Centrifuge at 12,000 x g for 5 min.
• 25.Transfer the supernatant to a new 1.5 mL EP tube.
• 26.Add 500 μL of isopropyl alcohol and incubate at −80°C for 20 min.
• 27.Centrifuge at 12,000 x g for 20 min, remove the supernatant.
• 28.Wash the RNA pellet twice with 75% ethanol.
• 29.Remove the remaining ethanol and dry the pellet in the air.
• 30.Dissolve the RNA pellet in 50 μL RNase-free water.
• 31.Measure the RNA concentration with Nanodrop.

Note: RNA concentration should be higher than 2 μg/μL: firstly, the obtained material can propose RNA greater than 100 μg, secondly, the subsequent experiment needs RNA of not less than 2 μg/μL.

mRNA enrichment

Timing: 3 h

This step describes how to purify mRNA from total RNA.

• 32.Aliquot 75 μg DNA free RNA, adjust the volume to 100 μL with TE buffer.
• 33.Incubate at 65°C for 5 min and immediately place on ice.
• 34.Wash 200 μL oligo-(dT) magnetic beads once with 1 mL binding buffer.
• 35.Resuspend the beads in 100 μL of binding buffer.
• 36.Add the beads into 100 μL RNA solution and incubate at 25°C for 10 min.
• 37.Separate the beads on a magnetic rack and remove the supernatant.
• 38.Wash beads twice with 200 μL of wash buffer, remove the wash buffer on a magnetic rack.
• 39.Add 10 μL TE buffer and incubate at 80°C for 2 min.
• 40.Separate the beads on a magnetic rack and collect the supernatant.

Note: Supernatant is mRNA, which needs to be stored at −80°C. The expected yield mRNA from 75 μg total RNA is 0.75 μg.

RNA dot blot

Timing: 8 h

This step describes how to perform RNA dot blot.

• 41.Adjust the concentration of the mRNA solution to 500 ng/μL.
• 42.Spot 1 μL mRNA onto the nitrocellulose membrane using a pipette.
• 43.Air-dry the membrane at 25°C for 10 min and then then incubate at 85°C for 1 h in a drying oven.
• 44.Cool the membrane to 25°C and block it with 5% milk solution for 30 min at 4°C.
• 45.Remove milk solution and incubate the membrane with m⁶A antibody solution and leave at 4°C standing for 4 h.
• 46.Wash the membrane three times with 1x TBST.
• 47.Incubate the membrane with 10 mL secondary antibody solution for 1 h at 25°C.
• 48.Wash the membrane three times with 1x TBST.
• 49.The membrane is now ready for detection.
• 50.Mix 2 mL of liquid A and B of western ECL Substrate at a ratio of 1:1.
• 51.Drop the mixed solution onto the membrane.
• 52.Detect the signal in a ChemiDoc imaging system (Bio-Rad).

RNA dot blot data analysis

Timing: 1 h

This step describes how to quantify RNA dot blot signal. ImageJ can be used according to the published protocol.⁴

• 53.Indicate the area of the selected area.
• 54.Average gray value of the selected area.
• 55.Derive gray value.
• 56.Analyze data.

Construct m⁶A-seq library

Timing: 2 days

This step describes how to construct m⁶A-seq library.

• 57.Isolate poly(A) mRNA using oligo-(dT) magnetic beads from 200 μg total RNA.
• 58.Fragment mRNA into ∼200 nt using RNA fragment module according to the manufacturer’s instructions.
• 59.Adjust the volume of RNA fragment to 400 μL.
• 60.Add 400 μL isopropyl alcohol, 40 μL 3M sodium acetate salt (pH 5.2) and incubate at −80°C for 20 min.
• 61.Centrifuge at 12,000 x g for 20 min, remove the supernatant.
• 62.Wash the RNA pellet twice with 75% ethanol.
• 63.Remove the remaining ethanol and dry the pellet in the air.
• 64.Dissolve the RNA pellet in 50 μL RNase-free water.
• 65.Dilute the RNA in 400 μL RNA binding buffer with 2 μg m⁶A antibody and incubate at 4°C for 4 h.
• 66.Aliquot 20 μL Protein G dynabeads and wash twice with RNA binding buffer.
• 67.Add Protein G dynabeads into RNA-antibody mixture and incubate at 4°C for 1 h.
• 68.Separate Protein G dynabeads in a magnetic rack, remove supernatant.
• 69.Wash beads three times with RNA binding buffer.
• 70.Elute RNA with 50 μL elution buffer at 50°C for 1 h.
• 71.Purify eluted RNA by TRIzol reagent.
• 72.Build m⁶A-seq library using NEBNext RNA Library Prep Kit and sequence in 2 × 150 bp paired-end mode. At least six gigabases (Gb) data are acquired (Nova6000).

Analyze m⁶A-seq data

Timing: 6 h

This step describes how to analyze m⁶A-seq data.

• 73.Remove the adapters using the AdapterRemoval tool⁵ following the parameter settings “--mm 0.5 --minlength 18”.
• 74.Map the reads against the Arabidopsis genome (TAIR10) by STAR⁶ following the parameter settings “--alignIntronMax 10000 --outSAMtype BAM Unsorted --outFilterMultimapNmax 1”.
• 75.Assign reads to gene models using the R package DEGseq⁷ using default parameter settings.
• 76.Call m⁶A peaks using the R package MeRIPtools⁸ using default parameter settings.

Expected outcomes

This protocol can be used to analyze auxin-induced changes of abundance and distribution of m⁶A modification. By utilizing qRT-PCR, this protocol enables the detection of relative expression of auxin responsive genes (Figure 2) to ensure the success of auxin treatment. m⁶A dot blot is used to measure changes of m⁶A abundance on different kinds of RNAs upon auxin treatment (Figure 3). Additionally, the m⁶A dot blot signals are quantified using ImageJ to analyze the relative abundance of m⁶A modification (Figure 4). This protocol also analyze the changes of m⁶A distribution by m⁶A-seq, the transcriptome-wide changes of m⁶A or changes of m⁶A at specific genomic loci can be analyzed as shown in the research of Li et al., 2024 (Figure 5).

Figure 2.

Relative expression of auxin response genes

Relative expression of IAA2 (A) and GH3.3 (B) after auxin treatment for indicated time. Relative expression level is determined by quantitative real-time PCR and normalized to the expression of ACTIN. Bars show mean ± SEM of three independent replicates.

Figure 3.

Dot blot analysis of m⁶A modification abundance

(A). Relative abundance of m⁶A modification of total RNA. Arabidopsis seedlings are treated by 50 μM NAA for 0, 4, 8,16 and 24 h. RNA is extracted by TRIzol reagent; (B-C). Relative abundance of m⁶A modification of RNAs with (B) and without (C) poly(A) tail. Arabidopsis seedlings are treated by 50 μM NAA for 0, 4, 8,16 and 24 h. RNA is extracted by TRIzol reagent, poly(A) RNA is purified using oligo(dT) magnetic beads, supernatant is collected and precipitated by ethanol and used as RNAs without poly(A) tail.

Figure 4.

Quantification of m⁶A signal

(A) Dot blot analysis of the m⁶A levels. The relative abundance of m⁶A signal is quantified by image J, and the m⁶A signals of 4, 6, 16 and 24 h are normalized to that of 0 h

(B) Plot of relative abundance of m⁶A signal in (A).

Figure 5.

Genomic browser snapshot of the m⁶A-seq signal

Genomic browser snapshot for input-subtracted m⁶A-seq signal at the YUCC4 (A) and PIN1 (B) loci in the seedlings with or without NAA treatment. The y axis represents the mean counts per million (CPMs) from replicates of immunoprecipitated samples subtracted from that from input samples.

Limitations

This protocol is designed to analyze the relative abundance of m⁶A modification rather than provide absolute quantification. Additionally, this protocol employs m⁶A sequencing to examine changes in the distribution of m⁶A modification. However, the resolution is limited, and it cannot provide information about the specific nucleotides where m⁶A modification occur. Given the distinct characteristics of various plant hormones, the protocol should also be applicable to other phytohormones.

Troubleshooting

Problem 1

Auxin responsive genes do not up-regulate after auxin treatment. Related to step 2.

Potential solution

Prepare a new auxin storage solution, aliquot it after preparation, and store it in a −20°C freezer away from light. Ensure that seedlings are fully submerged in H₂O with NAA during auxin treatment, and change the solution every 4 h if necessary.

Problem 2

The concentration of mRNA is low, or its purity is poor. Related to step 5.

Potential solution

Increase the amount of total RNA and oligo-dT magnetic beads to enrich a sufficient quantity of mRNA. Repeat the oligo-dT enrichment step to enhance the purity of mRNA.

Problem 3

Noisy background of dot blotting result. Related to step 6.

Potential solution

Replace milk with BSA for membrane blocking and extend the blocking time.

Adjust the dilution ratio of the antibody and reduce the incubation time of membrane in the m⁶A antibody solution. Before incubating with the secondary antibody solution, repeat the washing step with TBST.

Use a high-sensitivity ECL solution to achieve improved signal detection.

Problem 4

Broad peak of m⁶A-seq result. Related to step 8.

Potential solution

Fragment the RNA in a PCR machine. Do not place the RNA in the machine until it reaches 95°C, and increase the fragmentation time.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Chongsheng He (chongshenghe@outlook.com).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Bin Li (binli369@hnu.edu.cn).

Materials availability

This study did not generate new unique reagents.

Data and code availability

This study did not generate any datasets/code.

Acknowledgments

The study has been supported in part by the National Natural Science Foundation of China (32270623), the Natural Science Foundation of Hunan Province (2024JJ2016), and the Hunan agricultural science and technology innovation fund project (2024CX119).

Author contributions

B.L. and C.H. developed the protocol. B.L. performed the experiments with the help of Y.L., Lan Li, Lei Li, and L.C. B.L. and C.H. wrote the manuscript. Li Li and C.H. revised the manuscript. All the authors reviewed and approved the final manuscript.

Declaration of interests

The authors declare no competing interests.