Abstract
MicroRNAs (miRNAs) are short endogenous non-coding RNAs and play important roles in regulating mammary development and activities of ovine mammary epithelial cells (OMECs), which affect the milk yield and milk ingredient contents of ewes. We previously found that miR-21 was highly expressed in ovine mammary tissue, while the regulatory mechanisms of miR-21 underlying mammary development and lactation performance are still unclear. Accordingly, in this study, we investigated the functions of miR-21 in the activities of OMECs, and validated the target relationship of miR-21 with a predicted target gene programmed cell death 4 (PDCD4) by a dual-luciferase reporter assay. Finally, we investigated the regulatory effect of PDCD4 on the viability, proliferation and milk fat synthesis of OMECs. The overexpression of miR-21 significantly increased the viability of OMECs, the number and proportion of Edu-labeled positive OMECs, as well as the contents of triglyceride in OMECs. In fact, miR-21 inhibitor obtained opposite results with miR-21 mimics. The results obtained from the dual luciferase report and RT-qPCR assays confirmed that the seed sequence of miR-21 can complementarily combine with the 3′-untranslated regions (3′-UTR) of PDCD4, and miR-21 decreased the luciferase activity of PDCD4. Meanwhile, miR-21 also reduced the expression of PDCD4. These results indicate that PDCD4 is a target gene of miR-21. It was further found that PDCD4 decreased the viability and triglyceride content of OMECs, and the number and proportion of Edu-labeled positive OMECs. These findings suggest that miR-21 promotes the viability, proliferation and milk fat synthesis of OMECs by down-regulating the expression of PDCD4. The results revealed the regulatory mechanism by which miR-21 affected the activities and milk fat synthesis of OMECs in sheep.
Keywords: miR-21, ovine mammary epithelial cells, PDCD4, activity, triglyceride
1. Introduction
Lactation performance is an essential component of the economic traits of livestock animals. It has a significant impact on the production performance of offspring and is also an important indicator by which to measure genetic values [1]. The lactation performance of ewes mainly depends on milk yield and milk composition. Milk is known to be synthesized by the absorption of nutrients from the blood by mammary epithelial cells (MECs), and their number and activities therefore affect the yield and quality of milk [2,3]. In this context, the investigation of the regulatory mechanisms underlying the number and activity of MECs is crucial for improving the lactation performance of ewes.
MicroRNAs (miRNAs) are endogenous non-coding RNAs that widely participate in various biological activities, with a length of approximately 18–21 nucleotides [4]. miRNAs are known to play roles in organisms mainly through complementary pairing with the 3′-UTR of the target mRNAs, thereby inhibiting the translation or promoting the degradation of the target genes at a post-transcriptional level [5,6]. It has been indicated that miRNAs are widely involved in development and lactation of the mammary gland, as well as the synthesis and metabolism of milk components [7,8,9]. Previously, Nagaoka et al. [7] revealed that miR-200a inhibited the differentiation of MECs by affecting their cavity formation rate and polarity. Lin et al. [8] found that the overexpression of miR-103 increased the expression of genes related to milk fat synthesis, thereby promoting the formation of fat droplets, and the accumulation of triglycerides and unsaturated fatty acids. miR-21-3p has been reported to promote the formation of triglycerides in bovine MECs by targeting long-chain fatty acid elongase 5 (Elovl5) [9]. In spite of this, the regulatory mechanisms of many miRNAs underpinning lactation performance and mammary development remain unclear.
miR-21 is located on chromosome 11 of the sheep genome and is widely expressed in various tissues, such as the heart, liver, spleen, mammary gland and skin, eventually participating in various biological activities of the body [10]. Increasing numbers of reports have indicated that miR-21 is widely involved in the regulation of physiological and pathological activities of mammary gland tissue [11,12]. For example, Feuermann et al. [13] found that miR-21 was indispensable for mammary gland development and lactation in mice. A study by Zhu et al. [14] showed that miR-21 plays a role in cell invasion and tumor metastasis in metastatic breast cancer MDA-MB-231 cells by targeting multiple tumor/metastasis suppressor genes. miR-21-3p was up-regulated in the expression in high-fat breast tissue, indicating that miR-21 may be responsible for lipid synthesis [15,16]. However, it is still unclear whether miR-21 has a regulatory effect on the activities and milk fat synthesis of OMECs.
PDCD4 is a tumor suppressor gene induced during programmed cell death, which plays a role in cell apoptosis and DNA damage response [17,18]. Recent studies have found that miR-21 can regulate various cell proliferation and apoptosis processes by binding to the 3′-UTR regions of PDCD4. For example, miR-21-5p inhibited the phosphorylation of serine/threonine kinase PKB (AKT) by targeting PDCD4, thereby inhibiting the apoptosis of porcine endometrial epithelial cells [19]. miR-21 negatively regulated the expression level of PDCD4 in renal cell carcinoma and then increased the invasiveness and metastasis of cancer cells [20]. In our previous study, miR-21 was found to be highly expressed using RNA-seq in ovine mammary gland tissue [21]. So far, it is still unknown whether miR-21 can play a role in the ovine mammary gland development and lactation process by targeting PDCD4 in sheep. Accordingly, in this study, we validated the target relationship between miR-21 and PDCD4. We also analyzed the effects of miR-21 and PDCD4 on the viability, proliferation and triglyceride content of OMECs, with a clear aim to elucidate the molecular mechanism of miR-21 regulating lactation performance in sheep.
2. Results
2.1. Detection of Transfection Efficiency of miR-21 and PDCD4 into OMECs
The RT-qPCR analysis showed that compared with the NC group, miR-21 mimic significantly increased the expression level of miR-21 in OMECs (Figure 1A), while interference with miR-21 inhibitor significantly reduced its expression level (Figure 1A). These indicate that miR-21 mimic and miR-21 inhibitor have been successfully transfected into ovine OMECs and can be used for subsequent experiments.
Figure 1.
The detection of transfection efficiency of miR-21 and PDCD4 into ovine mammary epithelial cells (OMECs). (A) The expression levels of miR-21 when miR-21 mimic and miR-21 inhibitor were transfected into OMECs. (B) The expression levels of PDCD4 when pcDNA 3.1(+)-PDCD4 and si-PDCD4 were transfected into OMECs. ** p < 0.01.
The relative expression level of PDCD4 significantly increased in cells transfected with pcDNA3.1(+)-PDCD4 when compared to the pcDNA3.1(+) group (p < 0.01, Figure 1B). On the contrary, si-PDCD4 led to a significantly decrease in expression of PDCD4 compared with its NC group (p < 0.01, Figure 1B).
2.2. The miR-21 Promotes the Proliferation and Viability of OMECs
The cell counting kit-8 (CCK8) assay and 5-Ethynyl-2′-deoxyuridine (EdU) assay analysis results showed that the overexpression of miR-21 significantly increased the viability of OMECs (Figure 2A), as well as the number (Figure 2B) and proportion (Figure 2C) of Edu-labeled positive OMECs compared with its NC group, while miR-21 inhibitor markedly reduced the viability of OMECs, and the number and proportion of Edu-labeled positive OMECs (Figure 2).
Figure 2.
miR-21 promoted the proliferation and viability of ovine mammary epithelial cells (OMECs). (A) The viability of OMECs detected after transfection with miR-21 mimic and miR-21 inhibitor. (B) The Edu assay for detecting the effect of miR-21 on the proliferation of OMECs. (C) The proportion of Edu-labeled positive OMECs. * p < 0.05 and ** p < 0.01.
2.3. The miR-21 Increases Triglyceride Content
Compared with the miR-21 mimic NC group, miR-21 mimic significantly increased the triglyceride content in OMECs (p < 0.01, Figure 3). However, there was no significant difference in triglyceride content between miR-21 inhibitor and miR-21 inhibitor NC (p > 0.05, Figure 3). These results indicate that miR-21 promotes triglyceride synthesis of OMECs.
Figure 3.
The triglyceride level of ovine mammary epithelial cells (OMECs) transfected with miR-21 mimic and miR-21 inhibitor. ** p < 0.01.
2.4. PDCD4 Is a Target Gene of miR-21
In order to verify the target relationship between miR-21 and its predicted target gene PDCD4, the dual luciferase reporter vectors were constructed and confirmed using Sanger sequencing (Figure 4A). The miR-21 mimic significantly decreased the luciferase activity of PDCD4 in the wild-type dual luciferase vector (Figure 4B). However, miR-21 mimic did not significantly affect the activity of PDCD4 in the mutate-type dual luciferase vector (Figure 4B). Taken together, these results indicate that PDCD4 is a target gene of miR-21.
Figure 4.
The validation of the target relationship between miR-21 and PDCD4 using a dual luciferase report assay. (A) The validation of dual luciferase report vectors using Sanger sequencing. (B) The luciferase activity detection of PDCD4 when miR-21 mimic or miR-21 mimic NC, and wild-type or mutate-type luciferase reporter vectors were co-transfected into HEK293T cells. ** p < 0.01.
2.5. miR-21 Down-Regulates the Expression of PDCD4
Subsequently, we transfected miR-21 mimic and miR-21 inhibitor into OMECs to evaluate whether miR-21 affected the expression of PDCD4. The results showed that miR-21 mimic significantly reduced the expression level of PDCD4 in OMECs (p < 0.01), while miR-21 inhibitor obtained the opposite result with miR-21 mimic (Figure 5). These results indicate that miR-21 down-regulated the expression of PDCD4 at the post-transcriptional level.
Figure 5.
miR-21 negatively regulated the expression of PDCD4. ** p < 0.01.
2.6. PDCD4 Inhibits Proliferation and Viability of OMECs
As shown in Figure 6, when compared with its control group pcDNA3.1(+), overexpressed PDCD4 remarkably inhibited the viability of OMECs (Figure 6A), as well as the number (Figure 6B) and proportion (Figure 6C) of Edu-labeled positive OMECs, while si-PDCD4 increased the measurements (Figure 6).
Figure 6.
The PDCD4 inhibited the viability and proliferation of ovine mammary epithelial cells (OMECs). (A) The viability of OMECs after transfection with pcDNA3.1(+)-PDCD4 and si-PDCD4. (B) The Edu assay for detecting the effect of PDCD4 on the proliferation of OMECs. (C) The proportion of Edu-labeled positive OMECs transfected with pcDNA3.1(+)-PDCD4 and si-PDCD4. ** p < 0.01 and * p < 0.05.
2.7. PDCD4 Decreases Triglyceride Content
When compared with the NC group-pcDNA3.1(+), pcDNA3.1(+)-PDCD4 significantly reduced the triglyceride content of OMECs. On the contrary, we tested for an increase in triglyceride content in the cells transfected with si-PDCD4 (Figure 7).
Figure 7.
The triglyceride level of ovine mammary epithelial cells (OMECs) transfected with pcDNA3.1(+)-PDCD4 and si-PDCD4. ** p < 0.01.
3. Discussion
In this study, miR-21 was found to promote the viability and proliferation of OMECs. This is consistent with other findings for dairy cows. For example, miR-21 was found to promote the proliferation of MECs by targeting insulin-like growth factor-binding protein 5 (IGFBP5) [22]. Meanwhile, in other types of cells, miR-21 has also been reported to regulate cell proliferation and apoptosis. Si et al. [23] found that miR-21 inhibited apoptosis by regulating the expression of b-cell lymphoma-2 (Bcl-2) in a breast cancer mouse model. Yang et al. [24] found that miR-21-5p promotes cell proliferation in melanoma by targeting cyclin-dependent kinase inhibitor 1C (CDKN1C). Given that the proliferation and viability of OMECs are responsible for the lactation performance of ewes, it was therefore inferred that miR-21 may regulate the milk yield and milk composition of ewes.
In view of the fact that miRNA plays its post-transcriptional regulatory roles mainly by complementary binding with its target genes, the target genes of miR-21 were therefore predicted and then validated. Upon the joint analysis of TargetScan v7.2 and miRDB, a total of 161 genes would be predicted to target miR-21. Among all the predicted target genes, PDCD4 caught our attention. Firstly, PDCD4 is known as a tumor suppressor gene, and plays an important biological role in cell differentiation and apoptosis [25,26]. Secondly, previous studies have found that miR-21 primarily exerts biological effects in multiple other cells through its target gene PDCD4. For example, miR-21 promotes the sustained activation of hepatic stellate cells by down-regulating the expression of PDCD4 [27]. Xiao et al. [28] found that miR-21 can inhibit cardiomyocytes apoptosis by reducing the expression of PDCD4. Subsequently, our dual luciferase reporter assay results confirmed that miR-21 can target the 3′-UTR region of PDCD4. The RT-qPCR further found that miR-21 down-regulated the expression level of PDCD4 in OMECs.
In view of the above discussion, we further investigated the functions of PDCD4 in the activities of OMECs. It was found that PDCD4 inhibited the viability, proliferation and milk fat synthesis of OMECs. To the best of our knowledge, this is the first study to report the effects of PDCD4 on the regulation of the proliferation and viability of MECs in mammals. PDCD4 is generally considered to be a key regulatory factor for cell apoptosis, and its function is mainly achieved by regulating the PI3K/AKT/GSK-3β pathway [29]. Xia et al. [30] found that the overexpression of PDCD4 inhibited the PI3K/AKT and JNK signaling pathways, thereby inhibiting cell proliferation. Hua et al. [19] found that the knock-down of ssc-miR-21-5p inhibited the phosphorylation of AKT by targeting PDCD4, and eventually led to the inhibition of the proliferation and migration of endometrial epithelial cells. Akt is thought to be a key mediator of signal transduction processes, and its phosphorylation can promote cell survival by inhibiting apoptosis proteins [31,32]. Therefore, we believe that PDCD4 may regulate the proliferation of OMECs by regulating the AKT signaling pathway. Meanwhile, PDCD4 has been reported to regulate the proliferation and viability of other type of cells, including human peritoneal mesothelial cells [33], ovarian cancer cells [34] and human breast cancer cells [35]. For example, Hua et al. [19] found that the overexpression of ssc-miR-21-5p can target PDCD4 to inhibit the apoptosis of endometrial epithelial cell. Fu et al. [36] found that the overexpression of miR-21 inhibited the expression of PDCD4, thereby reducing ovarian cell apoptosis. The previous findings were consistent with our results obtained in OMECs.
Milk fat is a determining factor for the nutritional composition of milk. The vast majority of milk fat is composed of triglycerides (98%), besides small amounts of phospholipids, sterols and fat-soluble vitamins [37]. Therefore, the content of triglycerides is crucial for milk composition. Our study found that the overexpression of PDCD4 reduced the levels of triglycerides in OMECs. A previous study has also found that PDCD4 inhibited the secretion of triglycerides in dairy goat MECs [38]. The impact of PDCD4 on lipid metabolism may be achieved by inhibiting regulatory factors of lipid homeostasis [39]. Given that the target relationship of miR-21 with PDCD4, and the negative regulatory effects on viability, proliferation and triglyceride levels of OMECs between miR-21 with PDCD4 affirmed in this study, as well as the effect of PDCD4 on activities and milk fat synthesis of OMECs, it was concluded that miR-21 promoted the viability, proliferation and milk fat synthesis of OMECs by down-regulating the expression of PDCD4.
In addition, miRNA was found to target multiple genes to play its biological role [40]. In this context, miR-21 may regulate the activities and triglyceride levels of OMECs through targeting other target genes in sheep. However, this speculation needs to be further explored. In other MECs, the target relationship of miR-21 with other target genes has been verified. For example, Li et al. [18] found that miR-21 promoted triglyceride yield by targeting Elovl5 in bovine MECs. Xia et al. [41] also mentioned that miR-21 can increase the triglyceride content in MECs of dairy cows through target functional genes.
4. Materials and Methods
4.1. Ethics Statement
All procedures involving sheep in this study were strictly conducted in accordance with the Animal Care Committee of Gansu Agricultural University (approval number: GSAU-ETH-AST-2021-027).
4.2. Cell Transfection and Real-Time Fluorescence Quantification (RT-qPCR)
According to a previous description [42], OMECs were isolated from the mammary gland tissue of a three-year-old adult Small-tailed Han ewe reared in the Jinzihe Sheep Breeding Company (Tianzhu County, China). And the OMECs were cultured in an incubator at 37 °C with a CO2 content of 5%.
The miR-21 mimic (50 nM), miR-21 inhibitor (100 nM), si-PDCD4 (50 nM) and their corresponding negative controls (NC) (named miR-21 mimic NC, miR-21 inhibitor NC and si-NC) were synthesized by GenePharma Co. Ltd. (Suzhou, China), while the overexpressed vector of PDCD4 (named pcDNA3.1(+)-PDCD4) was synthesized by GENEWIZ Co., Ltd. (Suzhou, China). When the confluence of OMECs cultured in 24-well plates reached 70%~80%, miR-21 mimic, miR-21 inhibitor, si-PDCD4, pcDNA3.1(+)-PDCD4 and their NC were respectively transfected into OMECs using INVI DNA and RNA transfection reagents (Invigentech, Carlsbad, CA, USA). After transfection for 48 h, total RNA from OMECs was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA), and its purity was then evaluated using Nanodrop 2000 (Thermo Scientific, Waltham, MA, USA). The extracted RNA was reverse transcribed into cDNA using a HiScript III first strand cDNA synthesis kit (Vazyme, Nanjing, China) and a miRNA 1st Strand cDNA Synthesis Kit (Accurate Biology, Changsha, China), and then RT-qPCR was performed on the Applied Biosystems QuantStudio®6 Flex (Thermo Lifetech, Waltham, MA, USA) using SYBR Premix Ex Taq II (Takara, Dalian, China). An MiRcute miRNA qPCR detection kits (Tianjin, Beijing, China) was used to detect transfection efficiency. The primers used were designed using Primer 5.0 software and are listed in Table 1. The GAPDH was used as an internal reference gene to standardize the expression levels of mRNAs, while U6 and 18sRNA were chosen as internal references for miRNAs. The relative expression levels of mRNAs and miRNAs were quantified using the 2−ΔΔCT method [43].
Table 1.
Sequence of primers used in this study.
miRNAs/Genes | Sequence Information | Purpose | Fragment Length and Annealing Temperature | |
---|---|---|---|---|
Forward (5′–3′) | Reverse (5′–3″) | |||
miR-21 | CGCGTAGCTTATCAGACTGATGTTGAC | mRQ 3′ primer | RT-qPCR | 60 °C |
PDCD4 | GATGATGACCAGGAGAAC | TCCAACGCTAAGGACACT | 200 bp, 58 °C | |
18sRNA | GTGGTGTTGAGGAAAGCAGACA | TGATCACACGTTCCACCTCATC | 79 bp, 60 °C | |
U6 | ACGGACAGGATTGACAGATT | TCGCTCCACCAACTAAGAA | 80 bp, 58 °C | |
GAPDH | ATCTCGCTCCTGGAAGATG | TCGGAGTGAACGGATTCG | 173 bp, 58 °C | |
PDCD4 (WT) | CCGctcgagAGGGTGTAAAGGAGGGAC | ATTTgcggccgcGAAAGGAGTGGCAGTCAG | Construction of dual luciferase reporter vectors | 356 bp, 60 °C |
PDCD4 (Mut) | TTCTCtattcgaACCTTTTGTAAGTGCCATGTTTATG | AAGGTtcgaataGAGAATATCCCACTTAAGAAGTGGTTAC | 368 bp, 60 °C |
4.3. Determination of Cell Proliferation and Viability
When the confluence of OMECs reached 70%~80% in the 24-well plates, miR-21 mimic, miR-21 inhibitor, pcDNA3.1(+)-PDCD4, si-PDCD4 and their corresponding NC were transfected into OMECs and then continued to be cultured in a 37 °C and 5% CO2 incubator. For the CCK8 assay, 30 μL CCK8 solution (Vazyme, Nanjing, China) was added to each well after 46 h of transfection and then incubated for 2 h. The absorbance of OMECs at 450 nm was measured using Varioskan™ LUX (Thermo Scientific, Waltham, MA, USA). For the EdU assay, 100 mL of 50 mM Edu reagent (Beyotime, Shanghai, China) was added to each well after 44 h of transfection. After incubation for 4 h, the cells were fixed with 4% paraformaldehyde, and then detected using a Cell-Light™ Edu kit (Beyotime, Shanghai, China). Finally, the Edu staining result was observed using an IX73 inverted fluorescence microscope (Olympus, Tokyo, Japan) and then counted using the ImageJ v1.8.0 software (National Institutes of Health, Bethesda, MA, USA).
4.4. Validation of the Target Genes for miR-21 Using a Dual-Luciferase Reporter Assay
Two online software programs, TargetScan v7.2 (https://www.targetscan.org/) and miRDB (https://www.mirdb.org), were used to predict the target mRNA binding sites of miR-21 and the predicted results were intersected.
A dual luciferase reporter assay was conducted to verify the target relationship between miR-21 and the predicted target gene PDCD4. Briefly, specific primers containing NotI and XhoI restriction sites were designed based on the miR-21 seed sequence and the 3′-UTR sequence information of PDCD4 (Table 1). The 3′-UTR sequences of PDCD4 were cloned into the pmiR-PB-REPORTTM dual luciferase reporter vector to generate a wild-type dual luciferase vector. At the same time, a Mut Express II Fast Mutagenesis Kit (Vazyme, Nanjing, China) was used to generate the mutant sequences of miR-21-5p binding sites on the 3′-UTR, resulting in the generation of a mutate-type dual luciferase vector. Subsequently, when the confluence of HEK293T cells cultured in 12-well plates reached 70% to 80%, the wild-type or mutant-type dual luciferase vectors (3 μg), or miR-21 mimic or miR-21 mimic NC (3 μL), were co-transfected using the INVI DNA & RNA Transfection ReagentTM (Invigentech, Carlsbad, CA, USA). After 48 h of transfection, the dual luciferase reporter assay kit (Promega, Madison, WI, USA) was used to detect the luciferase activity of PDCD4, further verifying whether miR-21 has a regulatory effect on the target gene.
Finally, we further investigated the effect of miR-21 on the expression level of the target gene. Specifically, miR-21 mimic, miR-21 mimic NC, miR-21 inhibitor and miR-21 inhibitor NC were transfected into OMECs, as described above. Their transfection efficiency was detected using RT-qPCR. After 48 h, RNA was collected from the cells, and the expression level of PDCD4 was then detected using a RT-qPCR, with GAPDH as a reference gene.
4.5. Triglyceride Content Detection
When the fusion rate of ovine MECs cultured in a 12-well plate reached 70% to 80%, the cell triglyceride detection assay kit (Solarbio, Beijing, China) was used to detect the contents of intracellular triglycerides from OMECs independently transfected with miR-21 mimic, miR-21 inhibitor, pcDNA3.1(+)-PDCD4, si-PDCD4 and their corresponding NC.
4.6. Statistical Analysis
The statistical analysis of all the data was conducted through a two-tailed independent t-test using SPSS 22.0 software, and p < 0.05 was considered statistically significant.
5. Conclusions
In summary, our results indicate that miR-21 promotes the viability, proliferation and content of triglycerides of OMECs by down-regulating the expression of PDCD4. This study contributes to a better understanding of the role of miR-21 in the development and lactation of sheep mammary glands.
Author Contributions
Conceptualization, J.W.; methodology, J.W. and Z.H.; software, P.Y., Y.Z. and X.W. (Xuanyu Wang); validation, M.L.; investigation, C.R.; cell culture, X.W. (Xinmiao Wu) and H.Z.; supervision, C.R.; writing—original draft preparation, L.H., Z.H., X.G. and J.W.; funding acquisition, J.W. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
The study protocol was approved by the Ethics Committee of Gansu Agricultural University (protocol code GSAU-ETH-AST-2021-027, the approval date: 12 November 2021).
Informed Consent Statement
Not applicable.
Data Availability Statement
The data presented in this study are available in the article.
Conflicts of Interest
We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.
Funding Statement
This work was financially supported by the National Natural Science Foundation of China (32472879), the fund for Basic Research Creative Groups of Gansu Province (22JR5RA829), the Discipline Team Project of Gansu Agricultural University (GAU-XKTD-2022-21), the Fuxi Young Talents Fund of Gansu Agricultural University (Gaufx-02Y02) and the Science and Technology project of Lanzhou city (2022-2-91).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Akers R.M. A 100-Year Review: Mammary development and lactation. J. Dairy Sci. 2017;100:10332–10352. doi: 10.3168/jds.2017-12983. [DOI] [PubMed] [Google Scholar]
- 2.Ashraf A., Imran M. Causes, types, etiological agents, prevalence, diagnosis, treatment, prevention, effects on human health and future aspects of bovine mastitis. Anim. Health Res. Rev. 2020;21:36–49. doi: 10.1017/S1466252319000094. [DOI] [PubMed] [Google Scholar]
- 3.Nowak R., Poindron P. From birth to colostrum: Early steps leading to lamb survival. Reprod. Nutr. Dev. 2006;46:431–446. doi: 10.1051/rnd:2006023. [DOI] [PubMed] [Google Scholar]
- 4.Bartel D.P. MicroRNAs: Target recognition and regulatory functions. Cell. 2009;136:215–233. doi: 10.1016/j.cell.2009.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Krol J., Loedige I., Filipowicz W. The widespread regulation of microRNA biogenesis, function and decay. Nat. Rev. Genet. 2010;11:597–610. doi: 10.1038/nrg2843. [DOI] [PubMed] [Google Scholar]
- 6.Jonas S., Izaurralde E. Towards a molecular understanding of microRNA-mediated gene silencing. Nat. Rev. Genet. 2015;16:421–433. doi: 10.1038/nrg3965. [DOI] [PubMed] [Google Scholar]
- 7.Nagaoka K., Zhang H., Watanabe G., Taya K. Epithelial cell differentiation regulated by MicroRNA-200a in mammary glands. PLoS ONE. 2013;8:e65127. doi: 10.1371/journal.pone.0065127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Lin X., Luo J., Zhang L., Wang W., Gou D. MiR-103 controls milk fat accumulation in goat (Capra hircus) mammary gland during lactation. PLoS ONE. 2013;8:e79258. doi: 10.1371/journal.pone.0079258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Li X., Jiang P., Yu H., Yang Y., Xia L., Yang R., Fang X., Zhao Z. miR-21-3p Targets Elovl5 and Regulates Triglyceride Production in Mammary Epithelial Cells of Cow. DNA Cell Biol. 2019;38:352–357. doi: 10.1089/dna.2018.4409. [DOI] [PubMed] [Google Scholar]
- 10.Zennami K., Choi S.M., Liao R., Li Y., Dinalankara W., Marchionni L., Rafiqi F.H., Kurozumi A., Hatano K., Lupold S.E. PDCD4 Is an Androgen-Repressed Tumor Suppressor that Regulates Prostate Cancer Growth and Castration Resistance. Mol. Cancer Res. 2019;17:618–627. doi: 10.1158/1541-7786.MCR-18-0837. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Fujita S., Ito T., Mizutani T., Minoguchi S., Yamamichi N., Sakurai K., Iba H. miR-21 Gene expression triggered by AP-1 is sustained through a double-negative feedback mechanism. J. Mol. Biol. 2008;378:492–504. doi: 10.1016/j.jmb.2008.03.015. [DOI] [PubMed] [Google Scholar]
- 12.Gu J.B., Bao X.B., Ma Z. Effects of miR-21 on proliferation and apoptosis in human gastric adenocarcinoma cells. Oncol. Lett. 2018;15:618–622. doi: 10.3892/ol.2017.6171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Feuermann Y., Kang K., Shamay A., Robinson G.W., Hennighausen L. MiR-21 is under control of STAT5 but is dispensable for mammary development and lactation. PLoS ONE. 2014;9:e85123. doi: 10.1371/journal.pone.0085123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zhu S., Wu H., Wu F., Nie D., Sheng S., Mo Y.Y. MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 2008;18:350–359. doi: 10.1038/cr.2008.24. [DOI] [PubMed] [Google Scholar]
- 15.Song M.J., Lee E.J., Yang Y., Sung M.K. Luteolin supplementation modulates mammary tumor growth in C3H mice fed diet with high- and low-fat content. Nutr. Cancer. 2014;66:523–530. doi: 10.1080/01635581.2013.780629. [DOI] [PubMed] [Google Scholar]
- 16.Han D.X., Sun X.L., Xu M.Q., Chen C.Z., Jiang H., Gao Y., Yuan B., Zhang J.B. Roles of differential expression of microRNA-21-3p and microRNA-433 in FSH regulation in rat anterior pituitary cells. Oncotarget. 2017;8:36553–36565. doi: 10.18632/oncotarget.16615. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Shibahara K., Asano M., Ishida Y., Aoki T., Koike T., Honjo T. Isolation of a novel mouse gene MA-3 that is induced upon programmed cell death. Gene. 1995;166:297–301. doi: 10.1016/0378-1119(95)00607-9. [DOI] [PubMed] [Google Scholar]
- 18.Li C., Du L., Ren Y., Liu X., Jiao Q., Cui D., Wen M., Wang C., Wei G., Wang Y., et al. SKP2 promotes breast cancer tumorigenesis and radiation tolerance through PDCD4 ubiquitination. J. Exp. Clin. Cancer Res. 2019;38:76. doi: 10.1186/s13046-019-1069-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Hua R., Zhang X., Li W., Lian W., Liu Q., Gao D., Wang Y., Lei M. Ssc-miR-21-5p regulates endometrial epithelial cell proliferation, apoptosis and migration via the PDCD4/AKT pathway. J. Cell Sci. 2020;133:jcs248898. doi: 10.1242/jcs.248898. [DOI] [PubMed] [Google Scholar]
- 20.Li X., Xin S., He Z., Che X., Wang J., Xiao X., Chen J., Song X. MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor PDCD4 and promotes cell transformation, proliferation, and metastasis in renal cell carcinoma. Cell Physiol. Biochem. 2014;33:1631–1642. doi: 10.1159/000362946. [DOI] [PubMed] [Google Scholar]
- 21.Wang J., Hao Z., Hu J., Liu X., Li S., Wang J., Shen J., Song Y., Ke N., Luo Y. Small RNA deep sequencing reveals the expressions of microRNAs in ovine mammary gland development at peak-lactation and during the non-lactating period. Genomics. 2021;113:637–646. doi: 10.1016/j.ygeno.2020.09.060. [DOI] [PubMed] [Google Scholar]
- 22.Zhang X., Cheng Z., Wang L., Jiao B., Yang H., Wang X. MiR-21-3p Centric Regulatory Network in Dairy Cow Mammary Epithelial Cell Proliferation. J. Agric. Food. Chem. 2019;67:11137–11147. doi: 10.1021/acs.jafc.9b04059. [DOI] [PubMed] [Google Scholar]
- 23.Si M.L., Zhu S., Wu H., Lu Z., Wu F., Mo Y.Y. miR-21-mediated tumor growth. Oncogene. 2007;26:2799–2803. doi: 10.1038/sj.onc.1210083. [DOI] [PubMed] [Google Scholar]
- 24.Yang Z., Liao B., Xiang X., Ke S. miR-21-5p promotes cell proliferation and G1/S transition in melanoma by targeting CDKN2C. FEBS Open Bio. 2020;10:752–760. doi: 10.1002/2211-5463.12819. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lankat-Buttgereit B., Göke R. The tumour suppressor Pdcd4: Recent advances in the elucidation of function and regulation. Biol. Cell. 2009;101:309–317. doi: 10.1042/BC20080191. [DOI] [PubMed] [Google Scholar]
- 26.Ozpolat B., Akar U., Steiner M., Zorrilla-Calancha I., Tirado-Gomez M., Colburn N., Danilenko M., Kornblau S., Berestein G.L. Programmed cell death-4 tumor suppressor protein contributes to retinoic acid-induced terminal granulocytic differentiation of human myeloid leukemia cells. Mol. Cancer Res. 2007;5:95–108. doi: 10.1158/1541-7786.MCR-06-0125. [DOI] [PubMed] [Google Scholar]
- 27.Zhang Z., Zha Y., Hu W., Huang Z., Gao Z., Zang Y., Chen J., Dong L., Zhang J. The autoregulatory feedback loop of microRNA-21/programmed cell death protein 4/activation protein-1 (MiR-21/PDCD4/AP-1) as a driving force for hepatic fibrosis development. J. Biol. Chem. 2013;288:37082–37093. doi: 10.1074/jbc.M113.517953. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Xiao J., Pan Y., Li X.H., Yang X.Y., Feng Y.L., Tan H.H., Jiang L., Feng J., Yu X.Y. Cardiac progenitor cell-derived exosomes prevent cardiomyocytes apoptosis through exosomal miR-21 by targeting PDCD4. Cell Death Dis. 2016;7:e2277. doi: 10.1038/cddis.2016.181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Feng M.G., Liu C.F., Chen L., Feng W.B., Liu M., Hai H., Lu J.M. MiR-21 attenuates apoptosis-triggered by amyloid-β via modulating PDCD4/PI3K/AKT/GSK-3β pathway in SH-SY5Y cells. Biomed. Pharmacother. 2018;101:1003–1007. doi: 10.1016/j.biopha.2018.02.043. [DOI] [PubMed] [Google Scholar]
- 30.Xia H., Zhao Y. miR-155 is high-expressed in polycystic ovarian syndrome and promotes cell proliferation and migration through targeting PDCD4 in KGN cells. Artif. Cells Nanomed. Biotechnol. 2020;48:197–205. doi: 10.1080/21691401.2019.1699826. [DOI] [PubMed] [Google Scholar]
- 31.Lawlor M.A., Alessi D.R. PKB/Akt: A key mediator of cell proliferation, survival and insulin responses? J. Cell Sci. 2001;114:2903–2910. doi: 10.1242/jcs.114.16.2903. [DOI] [PubMed] [Google Scholar]
- 32.Brunet A., Bonni A., Zigmond M.J., Lin M.Z., Juo P., Hu L.S., Anderson M.J., Arden K.C., Blenis J., Greenberg M.E. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell. 1999;96:857–868. doi: 10.1016/S0092-8674(00)80595-4. [DOI] [PubMed] [Google Scholar]
- 33.Wu P., Wang J., Mao X., Xu H., Zhu Z. PDCD4 regulates apoptosis in human peritoneal mesothelial cells and promotes gastric cancer peritoneal metastasis. Histol. Histopathol. 2021;36:447–457. doi: 10.14670/HH-18-305. [DOI] [PubMed] [Google Scholar]
- 34.Wei N., Liu S.S., Chan K.K., Ngan H.Y. Tumour suppressive function and modulation of programmed cell death 4 (PDCD4) in ovarian cancer. PLoS ONE. 2012;7:e30311. doi: 10.1371/journal.pone.0030311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Cheng Y., Xiang G., Meng Y., Dong R. MiRNA-183-5p promotes cell proliferation and inhibits apoptosis in human breast cancer by targeting the PDCD4. Reprod. Biol. 2016;16:225–233. doi: 10.1016/j.repbio.2016.07.002. [DOI] [PubMed] [Google Scholar]
- 36.Fu X., He Y., Wang X., Peng D., Chen X., Li X., Wang Q. Overexpression of miR-21 in stem cells improves ovarian structure and function in rats with chemotherapy-induced ovarian damage by targeting PDCD4 and PTEN to inhibit granulosa cell apoptosis. Stem Cell Res. Ther. 2017;8:187. doi: 10.1186/s13287-017-0641-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Bernard L., Rouel J., Leroux C., Ferlay A., Faulconnier Y., Legrand P., Chilliard Y. Mammary lipid metabolism and milk fatty acid secretion in alpine goats fed vegetable lipids. J. Dairy Sci. 2005;88:1478–1489. doi: 10.3168/jds.S0022-0302(05)72816-2. [DOI] [PubMed] [Google Scholar]
- 38.Zhu J., Wei W., Pei D., Zhang F., Duan Y., Guo Y., Jiang Y., Xia S., Han J., Hou J., et al. Effects of PDCD4 on the apoptosis of dairy goat mammary epithelial cells and the synthesis of β-casein and TG. Acta Vet. Zootech. Sin. 2023;54:1429–1440. [Google Scholar]
- 39.Wang W., Zhao J., Wang H., Sun Y., Peng Z., Zhou G., Fan L., Wang X., Yang S., Wang R., et al. Programmed cell death 4 (PDCD4) mediates the sensitivity of gastric cancer cells to TRAIL-induced apoptosis by down-regulation of FLIP expression. Exp. Cell Res. 2010;316:2456–2464. doi: 10.1016/j.yexcr.2010.05.027. [DOI] [PubMed] [Google Scholar]
- 40.Hao Z., Wang J., Luo Y., Hu J., Liu X., Li S., Li M., Shi B., Hu L., Liu Y., et al. MicroRNA-200c Affects Milk Fat Synthesis by Targeting PANK3 in Ovine Mammary Epithelial Cells. Int. J. Mol. Sci. 2022;23:15601. doi: 10.3390/ijms232415601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Xia L., Zhao Z., Yu X., Lu C., Jiang P., Yu H., Li X., Yu X., Liu J., Fang X., et al. Integrative analysis of miRNAs and mRNAs revealed regulation of lipid metabolism in dairy cattle. Funct. Integr. Genom. 2021;21:393–404. doi: 10.1007/s10142-021-00786-9. [DOI] [PubMed] [Google Scholar]
- 42.Hao Z., Luo Y., Wang J., Hickford J.G.H., Zhou H., Hu J., Liu X., Li S., Shen J., Ke N., et al. MicroRNA-432 inhibits milk fat synthesis by targeting SCD and LPL in ovine mammary epithelial cells. Food Funct. 2021;12:9432–9442. doi: 10.1039/D1FO01260F. [DOI] [PubMed] [Google Scholar]
- 43.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data presented in this study are available in the article.