Germacrone ameliorates acute lung injury induced by intestinal ischemia-reperfusion by regulating macrophage M1 polarization and mitochondrial defects

Abstract

Intestinal ischemia-reperfusion (I/R) injury severely affects the lungs. Germacrone (Ger) possesses anti-inflammatory and antioxidant properties. However, it is unclear whether it protects the lungs from I/R injury. In this study, we elucidate the mechanisms by which Ger protects lungs from I/R injury. C57BLKS/J male mice are subjected to I/R injury via complete clamping of the superior mesenteric artery. Ger is administered before intestinal I/R. Mitochondrial morphology is observed via electron microscopy. The histopathology of the lung tissues is monitored via hematoxylin-eosin and immunofluorescence staining. The mitochondrial oxygen consumption rate is measured via an XF96 extracellular flux analyzer. In the I/R mouse model, lung specimens present significant lung damage accompanied by increases in the levels of collagen III, vimentin, and α-SMA in lung tissues. After treatment with Ger, lung impairment and fibrosis in I/R-induced acute lung injury (ALI) model mice are restored, suggesting that Ger improves I/R-ALI. In addition, Ger administration decreases the release of inflammatory factors such as IL-1β, IL-6, and COX2, as well as the expressions of M1 macrophage markers, facilitating cell survival in the I/R-ALI model. Additionally, Ger (EC50: 47.16 μM) ameliorates mitochondrial dysfunction by increasing I/R-ALI-induced apoptosis, increasing the expression of SIRT1, and reducing the levels of HIF1-α, Nrf2, and OGG1 in MLE-12 cells. Ger may affect macrophage polarization and improve subsequent mitochondrial defects through the SIRT1-HIF1α-Nrf2 signaling pathway in MLE-12 cells, which ultimately improves lung function and lung inflammation in the I/R-ALI model.

Introduction

Intestinal ischemia-reperfusion (I/R) injury is a common type of tissue and organ injury that plays an important role in the pathological evolution of severe infections, shock, cardiopulmonary insufficiency, and other diseases [1]. I/R not only causes local tissue damage in the digestive tract but also leads to damage to distant organs and even multiple system organ failure (MSOF), with acute respiratory distress syndrome (ARDS) caused by lung injury being the most prominent [2]. The intestine can tolerate hypoperfusion at 20% of maximal blood flow [3]. Research has shown that the delayed diagnosis of intestinal necrosis can lead to very high (60%–80%) mortality after acute mesenteric ischemia [ 4, 5]. The signal transduction mechanism of intestinal I/R lung injury (I/R-ALI) is very complex [6]. Although extensive research has been conducted in recent years, the pathogenesis of this disease remains unclear [7]. Therefore, the signal regulatory mechanism of intestinal I/R lung injury remains a hotspot in respiratory research.

Several investigators have reported that damage to the intestinal mucosal barrier after I/R permits the entry of bacteria and endotoxins, resulting in a systemic inflammatory response [8]. Many inflammatory mediators are subsequently released from macrophages into the systemic circulation, which can lead to cell necrosis, tissue damage, and organ failure [9]. An increased neutrophil count in lung tissue can lead to increased vascular permeability, vascular and interstitial edema, and pulmonary edema [10]. I/R-induced lung injury is associated with increased neutrophils and related inflammatory mediators (including reactive oxygen species (ROS), cytokines, and bacterial endotoxins), impaired mitochondrial function, and pulmonary epithelial cells [ 11– 13]. Resident alveolar macrophages, which typically exhibit an alternately activated phenotype (M2), transit to a classically activated phenotype (M1) and release various potent proinflammatory mediators during the acute phase of acute lung injury (ALI)/ARDS. At later stages, the M1 phenotype of activated resident and recruited macrophages shifts back to the M2 phenotype to eliminate apoptotic cells and participate in fibrosis [14]. Thus, the regulation of macrophage function may be a promising therapeutic strategy against I/R-ALI.

Blocking inflammation has been reported to protect against I/R-ALI. For example, Mesna can restore systemic oxygenation by inhibiting neutrophil infiltration and the NF-κB pathway and significantly reducing the levels of proinflammatory cytokines such as TNF-α, IL-1β, and IL-6 in lung tissue, thereby attenuating histopathological changes and apoptosis in I/R-ALI [15]. Mitochondrial function is closely associated with I/R. Blocking PKCβ through the p66shc-mediated mitochondrial apoptosis pathway prevents long-range organ damage caused by I/R [16]. In addition, the specific PKCβII inhibitor LY333531 significantly inhibits p66shc activation and mitochondrial translocation, leading to a decrease in cytochrome c release and caspase-3 cleavage as well as an increase in glutathione and glutathione peroxidase [16]. Furthermore, LY333531 reduces I/R-induced histological damage, inflammatory cell infiltration, oxidative stress, and apoptosis [17]. These results indicate that I/R-ALI is closely related to mitochondrial function and inflammation. Improving mitochondrial function and inhibiting inflammation may be important for preventing and treating I/R injury [18].

Germacrone (Ger), also known as rhododendron and geranone, is a monocyclic sesquiterpenoid found in Geraniaceae, Rhododendron, and ginger plants [19]. Many studies have shown that Ger can inhibit the proliferation of liver cancer, breast cancer, lung cancer, and glioma cells owing to its antitumor mechanism, which involves inducing the apoptosis of cancer cells and blocking the cell cycle [ 20– 22]. In addition, Ger has anti-inflammatory properties. Makabe et al. [23] reported that Ger suppressed ear inflammation by 75%. An et al. [24] reported that Ger treatment significantly inhibited proinflammatory cytokines, subsequently increasing the expression of anti-inflammatory mediators and reducing LPS-promoted tissue damage in neonatal mice, confirming the anti-inflammatory effects of Ger. Moreover, Germacrone has the ability to restrain MDA-MB-231 cell-induced osteoclastogenesis in vitro and mitigate breast cancer-associated osteolysis in vivo within human MDA-MB-231 breast cancer bone metastasis-bearing mouse models [25]. In addition, mmu_circRNA_0000309 silence leads to drug resistance to germacrone in DN mice. It sponges miR-188-3p and upregulates GPX4 expression, inactivating ferroptosis-dependent mitochondrial function and podocyte apoptosis [26]. Ger has been reported to protect neonatal mice from LPS by regulating claudin-4-induced ALI, significantly decreasing the expressions of the proinflammatory cytokines IL-6 and TNF-α while increasing the expressions of the anti-inflammatory mediators TGF-β1 and IL-10 [27]. Ger also alleviates rat brain damage from I/R injury through antioxidant and antiapoptotic mechanisms, exerting neuroprotective effects [28]. However, it is unclear whether Ger protects the lungs from intestinal I/R injury.

In this study, a mouse model of I/R-ALI was constructed to evaluate the release of inflammatory factors and the effects of Ger on tissue damage and oxidative damage in lung tissue. Furthermore, the protective effects and mechanism of Ger on mitochondrial injury were verified in an in vitro model of alveolar type II epithelial cells.

Materials and Methods

Animals and treatment

All animal experiments were approved by the Institutional Animal Care and Use Committee of the Zhejiang Center of Laboratory Animals (approval No. ZJCLA-IACUC-20030085). Male C57BLKS/J mice (10 weeks old, 20–25 g) were obtained from the Zhejiang Center of Laboratory Animals. The C57BLKS/J mice in each experiment were randomly assigned to the following groups ( n=6): Sham control, Sham + Ger, I/RI, and I/RI + Ger groups. The mice were anesthetized via the intraperitoneal administration of pentobarbital sodium (50 mg/kg). The mice in the intestinal I/R group were subjected to 1 h of ischemia, followed by 3 h of reperfusion. Intestinal I/R injury was induced by completely clamping the superior mesenteric artery (SMA) with a microvascular clip. The sham-operated mice underwent identical surgical interventions and time courses without SMA clamping. The mice in the Sham + Ger and I/RI + Ger groups were intraperitoneally injected with Ger (T2945; Topscience, Shanghai, China) at a dosage of 10 mg/kg/day for 5 consecutive days before intestinal I/R. The Sham and I/RI groups were simultaneously administered with the same volume of 0.9% saline. Germacrone was purchased from Shanghai Topscience Biotech Co. Ltd. and dissolved in a 0.9% saline solution with 2% DMSO (v/v), 20% PEG-300 (v/v), and 1% Tween-80 (v/v). The chemical structure of the germacrone (MW: 218.34) is shown in Supplementary Figure S1. After 3 h of reperfusion with or without SMA, all the mice were sacrificed via the intraperitoneal administration of pentobarbital sodium (50 mg/kg), and blood, lung, and gut tissue samples were collected. A section of each tissue sample was preserved in formalin and glutaraldehyde for histopathological analysis and electron microscopy. The remainder of the tissue samples and blood were frozen immediately in liquid nitrogen and stored at –80 °C until further analysis.

Cell culture and treatment

The MLE-12 mouse lung epithelial cell line was preserved in our laboratory. The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, 11965092; Gibco, Carlsbad, USA) supplemented with 5% FBS (10099141C; Gibco) and 1% penicillin and streptomycin (15070063; Gibco) at 37°C and 5% CO ₂. MLE-12 cells were divided into the following groups: (1) sham control group, (2) HR (3 h/0 h) group subjected to hypoxia for 3 h, (3) HR (3 h/24 h) group subjected to hypoxia for 3 h and reoxygenation for 24 h, and (4) HR + Ger (3 h/24 h) group subjected to hypoxia for 3 h and reoxygenation for 24 h with Ger treatment.Cells in the control group were routinely cultured in a constant temperature incubator at 37 °C, 5% CO ₂, and 95% air. Cells in the treatment groups were cultured under hypoxia for 3 h in a three-gas incubator at 37 °C, 5% CO ₂, 93% N ₂, and 2% O ₂.

Cells in the logarithmic growth phase were selected and inoculated into 6-well plates. The cell density was adjusted to 1 × 10 ⁵ cells per well. siRNA transfection was performed using Lipofectamine ^TM RNAiMAX reagent (13778150; Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. siRNAs were synthesized by Beijing Tsingke Biotech and the sequences were as following: SIRT1-siRNA, 5′-UGAACAAAAGUAUAUGGACCU-3′, and nc-siRNA, 5′-UUCUCCGAACGUGUCACGUTT-3′.

Hematoxylin-eosin (HE) staining

Mouse lung tissues were dehydrated, clarified with xylene, immersed in paraffin, embedded, and cut into sections via a paraffin slicing machine (RM2016 rotary microtome; Leica, Wetzlar, Germany). The paraffin sections were then dewaxed in water. After being stained with Mayer’s hematoxylin staining solution for 5 min, the sections were wassihed with tap water. The sections were then stained with 1% water-soluble eosin for 5 min and washed via standard procedures. Finally, the slices were observed under a DM2000 microscope (Leica).

Immunohistochemistry

The lung tissue samples were dehydrated, paraffinized and cut into paraffin sections, rinsed with ddH ₂O for 3–5 min and blocked with 3% peroxide to ablate endogenous peroxidase. The slices were then incubated with the corresponding antibodies overnight at 4 °C. The following antibodies were used for tissue staining: CD86 (1:100, DF6332; Affinity, Melbourne, Australia), CD163 (1:100, ab182422; Abcam, Cambridge, UK), and Gr-1 (1:100, ab238132; Abcam). The sections were subsequently visualized via the use of streptavidin-horseradish peroxidase and a DAB substrate kit (34002; Thermo Fisher Scientific, Waltham, USA). Counterstaining was performed using hematoxylin. Finally, after the slices had dried, images were acquired via a BX53 microscope (Olympus, Tokyo, Japan).

Immunofluorescence analysis

The tissue sections were rehydrated with xylene and graded concentrations of ethanol, incubated in sodium citrate (10 mM, pH 6.0) for 10 min, and cooled to room temperature. The tissue sections were subjected to microwave antigen retrieval with an appropriate amount of repair solution (0.01 M citrate buffer, pH 6.0) for 15 min and subsequently blocked with goat serum. The following primary antibodies were used: TOM20 (1:250, ab186735; Abcam), 8-oxoG (1:100, ab206461; Abcam), Collagen III (1:100, ab184993; Abcam), α-SMA (1:200, 19245S; Cell Signaling Technology, Danvers, USA), Vimentin (1:100, ab92547; Abcam), ICAM-1 (1:50, ab222736; Abcam), and TGF-α (1:100, AF0262; Affinity). All the sections were incubated with primary antibodies diluted in 5% goat serum at 4°C overnight and then with secondary antibodies CY3 goat anti-mouse/rabbit (ab97035/ab6939; Abcam) and FITC goat anti-mouse/rabbit (ab6785/ab6717; Abcam) for 20 min at room temperature in the dark. Finally, after the slices had dried, the images were captured via an FV3000 confocal microscope (Olympus).

Masson staining

Sections were prepared according to routine procedures. After being stained with Weigert’s iron hematoxylin for 5–7 min, the sections were rinsed with running water for several minutes. Next, 1% hydrochloric acid alcohol was used for differentiation for several seconds, and the sections were stained with Ponceau red acid fuchsin for 3–4 min. Next, a 1% phosphorus molybdic acid solution was differentiated for approximately 5 min, dried, and directly counterstained with an aniline blue staining solution for 5 min without washing with water. Finally, the sections were rinsed with 1% glacial acetic acid for 1 min, dehydrated with 95% alcohol and anhydrous ethanol, immersed in xylene, air-dried, and sealed with neutral gum for microscopic examination. The collagen fibers, mucus, and cartilage were stained blue, whereas the cytoplasm, muscle, fibrin, and red blood cells were stained red.

RNA extraction and qPCR

Total RNA was extracted from lung tissues via RNAiso Easy Kit (TCH020; Takara, Shiga, Japan), and the corresponding RNA extraction procedure was performed following the manufacturer’s instructions. For cDNA synthesis, 500 ng of total RNA was used for reverse transcription in a 20-μL reaction volume via the PrimeScript RT reagent Kit (RR037A; Takara). Quantitative PCR was then performed via the TB GreenPremix Ex Taq Kit (RR420A; Takara). with a Real-Time PCR Detection System (Quant Studio 6; ABI, Foster City, USA). The sequences of primers (Tsingke Biotech, Beijing, China) used are shown in Table 1. The program settings for qPCR amplification are as follows: predegeneration (95°C, 30 s; 1 cycle), annealing and extension (95°C, 15 s; 56°C, 30 s; 72°C, 30 s; 40 cycles), melt curve acquisition (95°C, 15 s; 56°C, 30 s; 95°C, 15 s; 1 cycle). The mRNA expression was normalized to that of β-Actin. Relative gene expression levels were calculated using the 2 ^–∆∆Ct method.

Table 1 Sequences of primers used in this study

Gene	Primer sequence (5′→3′)
Mus GAPDH	Forward	ATGGGTGTGAACCACGAGA
Reverse	CAGGGATGATGTTCTGGGCA
Mus OGG1	Forward	TGCTGGCAGATCAAGTATGG
Reverse	CAGCAGTCTCACACCTTGGA
Mus TGF-α	Forward	CAGCATGTGTCTGCCACTCT
Reverse	TGGATCAGCACACAGGTGAT
Mus NGAL	Forward	GCCCAGGACTCAACTCAGAA
Reverse	GACCAGGATGGAGGTGACAT
Mus mnSOD	Forward	CCAAAGGAGAGTTGCTGGAG
Reverse	TAAGGCCTGTTGTTCCTTGC
Mus Sirt1	Forward	ATCGTTACATATTCCACGGTGCT
Reverse	CACTTTCATCTTCCAAGGGTTCT
Mus Nrf2	Forward	CAGTGCTCCTATGCGTGAA
Reverse	GCGGCTTGAATGTTTGTCT
Mus COX2	Forward	AGGTCATTGGTGGAGAGGTG
Reverse	CCTGCTTGAGTATGTCGCAC
Mus HIF-1α	Forward	GGCGGCGAGAACGAGAAGAAAAATA
Reverse	GGAAGTGGCAACTGATGAGCAAG
Mus IL-6	Forward	CACAGAGGATACCACTCCCAACAGA
Reverse	ACAATCAGAATTGCCATTGCACAAC
Mus IL-1α	Forward	GCAACGGGAAGATTCTGAAG
Reverse	TGACAAACTTCTGCCTGACG

Detection of ATP and respiratory oxygen

An XF96 extracellular flux analyzer (Agilent Seahorse Bioscience, Billerica, USA) was used to measure the oxygen consumption rate (OCR), including basal respiration, ATP-linked respiration, proton leak-linked respiration, and maximal respiration. Briefly, MLE-12 cells were seeded into Seahorse XF96 96-well microplates at a density of 10 ⁴ cells/well. Hypoxic conditions were established via a Trigas CO ₂ incubator (FORMA 3131; Thermo Fisher Scientific). After the treatments were administered to each group, the medium was replaced by XF assay medium, and the cells were placed in a 37 °C incubator without CO ₂ for 1 h before the assay. The values before the addition of oligomycin represent the basic oxygen consumption of the cells, including during oxidative phosphorylation of the mitochondria and proton leak-linked oxygen consumption. The values obtained after the adition of 1 μM oligomycin (an F0F1-ATPase inhibitor) indicate proton leak-linked oxygen consumption, while the reduction value represents oxygen consumption related to ATP synthesis. The oxygen consumption of these cells, which represents nonmitochondrial respiration, indicates spare respiratory capacity. The OCR value was adjusted for the protein concentration per well, and it is expressed as pmol/min/μg.

CCK8 assay

The Cell Counting Kit-8 reagent (HY-K0301; MCE, Monmouth Junction, USA) was used to determine cell viability. Briefly, the cells in each group were inoculated into 96-well plates (1 × 10 ³ cells per well) and cultured for 72 h, then 10 μL of CCK-8 solution was added to each well and incubated for 2 h. Subsequently, the absorbance of each sample was measured at 450 nm via a microplate reader (Flexstation® 3; Molecular Devices, San Jose, USA).

Apoptosis assay

MLE-12 cells from each group were collected after the indicated treatments. Apoptosis analysis was performed using an apoptosis detection kit (KGA108; Keygen, Nanjing, China) according to the manufacturer’s protocol. Briefly, after staining with FITC Annexin V/PI, the degree of apoptosis was analyzed via a flow cytometer (CytoFLEX; Beckman Coulter, Brea, USA), and the data were analyzed via the EXP032 software. The status and percentage of cells undergoing apoptosis were defined as early apoptosis (annexin V-positive and PI-negative) or late apoptosis (annexin V-positive and PI-positive).

Western blot analysis

Total proteins from the lung tissues and cells were extracted via a whole-cell lysis assay. Protein concentrations were determined via a Bicinchoninic Acid Assay Kit (P0010; Beyotime). Protein (20 μg) was separated via 10%–15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes (162-0177; Bio-Rad, Hercules, USA). The membranes were blocked for 1.5 h in Tris-buffered saline and Tween 20 (TBST, pH 7.6) containing 5% nonfat milk powder at room temperature and subsequently incubated with primary antibodies against IL-1β (1:1000, AF5103; Affinity), NOS2 (1:1000, AF0199; Affinity), TLR2 (1:1000, DF7002; Affinity), CD86 (1:1000, 20018SF; Cell Signaling Technology), CD115 (1:1000, ab221684; Abcam), CD206 (1:1000, ab64693; Abcam), ARG1 (1:1000, ab203490; Abcam), CD163 (1:1000, DF8235; Affinity), mnSOD (1:1000, ab68155; Abcam), HIF-1α (1:1000, 36169S; Cell Signaling Technology), SIRT1 (1:1000, 9475S; Cell Signaling Technology), OGG1 (1:1000, DF6401; Affinity) and Nrf2 (1:1000, 12721S; Cell Signaling Technology) at 4°C overnight. The membranes were then washed three times with TBST and incubated with horseradish peroxidase-conjugated secondary antibodies (1:5000 in TBST) for 1 h at room temperature. The blots were developed in the dark via an ECL detection kit (WBKLS0500; Millipore, Billerica, USA) and visualized via the ProteinSimple FluorChem E system. Band intensities were quantified via ImageJ 1.45 software (NIH, Bethesda, USA). β-Actin served as an internal reference.

Transmission electron microscopy

Fresh tissue was selected to determine the sampling site, and mechanical damage, such as pulling, contusion, and extrusion, was minimized. The slices were immediately immersed in electron microscope fixative solution at 4°C for 2–4 h. After being rinsed three times with 0.1 M phosphate buffer (pH 7.4) for 15 min each and postfixed with 1% osmic acid for 2 h at room temperature (20°C), the tissues were dehydrated and subsequently permeated with acetone and embedding medium. The samples were then mounted onto an embedding plate, sliced, placed in a 37°C oven overnight, and finally embedded in a 60°C oven for 48 h. Next, the slices were subjected to uranium-lead double staining (2% uranyl acetate-saturated alcohol solution, lead citrate) for 15 min each. Finally, the sections were dried overnight at room temperature and observed with a transmission electron microscope (HT7700; Hitachi, Tokyo, Japan).

Statistical analysis

Statistical analysis was performed using GraphPad Prism 6 (GraphPad Software, La Jolla, USA). Data are presented as the mean ± SD. Each experiment was conducted in triplicate. The statistical significance of each difference was analyzed via unpaired Student’s t test or one-way ANOVA, followed by Tukey’s post hoc test. Statistical significance was set at P  < 0.05.

Results

Germacrone improved I/RI in mice

To explore the effects of Ger on I/R-ALI in vivo, we first constructed an I/R-ALI model by completely clamping the superior mesenteric artery. Compared with those in the sham group, the intestinal swelling of the mice in the I/RI group was obvious ( Supplementary Figure S2A). Under a microscope, the hemorrhagic foci in the I/RI group appeared disorganized and infiltrated by inflammatory cells ( Supplementary Figure S2B,C). We then evaluated the effect of intestinal ischemia on lung tissue. The results revealed increased lung volume, darker red color, and obvious hemorrhage in the I/RI group compared with the control group ( Figure 1A). Microscopic examination revealed pulmonary interstitial edema, disordered alveolar structure, thickened alveolar duct walls, and obvious fibrosis, indicating that the I/RI model was successfully constructed ( Figure 1B). HE staining also revealed that Ger improved the intestinal tissue structure and resulted in an intact appearance of the lungs ( Figure 1B). Pulmonary fibrosis is associated with lung injury. Masson staining revealed that the progression of fibrosis was obvious in the I/RI group and that the degree of pulmonary fibrosis was alleviated by Ger treatment ( Figure 1C). In addition, fluorescence staining of alveolar tissue revealed that the expressions of typical biomarkers of fibrosis, including collagen III, vimentin, and α-SMA, were markedly increased in the I/RI group compared with those in the I/RI + Ger group, indicating that Ger administration improved fibrosis ( Figure 1D‒F). These results indicated that Ger has the potential in improving I/R-ALI in vivo by alleviating intestinal swelling, lung injury and fibrosis.

Figure 1 .

Germacrone improved I/R-ALI in mice

(A) Photographs showing the appearance of the lungs in each group. (B) HE staining of lung tissues from each group. Scale bar: 50 μm. (C) Masson staining of lung tissues from each group. Scale bar: 1000 μm. (D–F) Immunofluorescence staining of collagen III, vimentin, and α-SMA in lung tissues from each group. Scale bar: 50 μm. Red: collagen III-, vimentin-, and α-SMA-positive cells. Blue: DAPI. Sham: control group; I/RI: mice whose superior mesenteric artery was completely clamped; I/RI  +  Ger: I/RI group administered with germacrone.

Germacrone attenuated the release of inflammatory factors and inhibited apoptosis

Next, we evaluated the secretion of inflammatory cytokines to verify whether Ger attenuates I/R-ALI by regulating the inflammatory response. Compared with those in the Sham + Ger group, the mRNA expression levels of representative inflammatory factors, namely, IL-1α, IL-6, COX2, and TGF-α, were almost elevated by 3-fold in the I/RI group, which was reversed after Ger administration (I/RI + Ger group), suggesting that Ger improved the inflammatory reaction in I/RI ( Figure 2A‒D). Moreover, as indicators of apoptosis, immunofluorescence staining with ICAM1 and TGF-α antibodies and TUNEL staining revealed that the levels of these three markers in the model group were increased after Ger treatment, suggesting that Ger improved apoptosis in I/R-ALI ( Figure 2E‒G). As expected, the number of CD86- and Gr-1-positive cells in the I/R-ALI group was significantly increased, whereas that of CD163-positive cells was reduced. Compared with those in the model group, the number of CD86- and Gr-1-positive cells was significantly lower, and the number of CD163-positive cells was significantly greater in the I/RI + Ger group ( Figure 2H). Furthermore, the expressions of M1 macrophage markers, namely, IL-1β, NOS2, TLR2, and CD86, increased steadily, whereas those of the M2 markers CD115, CD206, ARG1, and CD163 increased significantly in the model group. As expected, the expressions of these proteins, especially the downregulation of CD86 and the upregulation of CD206, were reversed after Ger treatment ( Figure 2I and Supplementary Figure S3). These results indicate that Ger may exert protective effects against I/R-ALI by modulating macrophage polarization.

Figure 2 .

Germacrone attenuated the release of inflammatory factors and inhibited apoptosis

(A‒D) The mRNA expression levels of IL-1α (A), IL-6 (B), COX2 (C), and TGF-α (D) in each group were determined by qPCR. (E,F) Immunofluorescence staining of ICAM1 (E) and TGF-α (F) in lung tissues from each group. Scale bar: 20 μm. (G) TUNEL staining showing the degree of apoptosis. Scale bar: 20 μm. (H) IHC staining of CD86, CD163, and Gr-1 in lung tissues from each group. Scale bar: 20 μm. (I) Protein expression levels of IL-1β, NOS2, TLR2, CD86, CD115, CD206, ARG1, and CD163 in each group, as detected by western blot analysis. Sham: control group; I/RI: mice whose superior mesenteric artery was completely clamped; I/RI + Ger: I/RI group administered with germacrone. Data are shown as the mean ± SD. *P < 0.05 and **P < 0.01.

Germacrone ameliorated mitochondrial functional defects in lung tissues of I/RI mice

We subsequently examined whether Ger relieves mitochondrial functional defects in I/RI model mice. As specific indicators of mitochondrial function, TOM20 and 8-oxoG levels were determined via immunofluorescence staining. The expression of TOM20 was significantly reduced, whereas that of 8-oxoG protein was elevated in the model group compared with those in the sham group. However, the expression of TOM20 increased, whereas that of 8-oxoG decreased after Ger administration in I/RI mice ( Figure 3A), suggesting that Ger had a protective effect on mitochondrial function in the lung tissue of I/RI mice. Similarly, the morphology of the mitochondria in the lung tissue of the sham group was normal, with a double-layer membrane and continuous internal cristae. However, in the I/RI group, the mitochondrial bilayer membrane disappeared, the cristae were broken, and the mito-chondria disintegrated. A double membrane appeared in the mitochondria, and crista breakage improved in the I/RI + Ger group compared with those in the model group ( Figure 3B). These results indicate that Ger ameliorated mitochondrial functional defects in the lung tissues of I/RI mice.

Figure 3 .

Germacrone ameliorated mitochondrial functional defects in I/R-ALI

(A) Immunofluorescence staining of the mitochondrial markers TOM20 and 8-oxoG in lung tissues from each group. Scale bar: 20 μm. (B) Electron microscopy image showing the mitochondrial structures in each group. Scale bar: 1 μm. Sham: control group; I/RI: mice whose superior mesenteric artery was completely clamped; I/RI  +  Ger: I/RI group administered with germacrone.

Germacrone attenuated oxidative stress in lung tissues of I/RI mice

Mitochondria are responsible for important physiological functions, such as oxidative phosphorylation, electron transfer, Ca ²⁺ storage, and energy metabolism. They are the source of intracellular oxidative stress and the main targets of apoptosis. As shown in Figure 4, compared with those in the sham group, the mRNA expression levels of NGAL, HIF-1α, OGG1, and Nrf2 increased steadily, and those of mnSOD and SIRT1 mRNAs significantly decreased in the model group. Ger significantly reduced the levels of NGAL, HIF-1α, OGG1, and Nrf2 but elevated the mnSOD and SIRT1 levels, further suggesting that Ger improves I/RI possibly by regulating oxidative stress in mitochondria ( Figure 4A). Compared with that in the sham group, basal respiration was significantly lower in the model group. After the addition of oligomycin to inhibit ATP synthase, the OCR of oxidative phosphorylation and maximum respiration were significantly reduced in the I/RI group. Ger administration significantly increased basal respiration, the OCR of oxidative phosphorylation, and maximal respiration ( Figure 4B‒E). Thus, Ger decreases oxidative stress in the lung tissues of I/RI mice.

Figure 4 .

Germacrone attenuated oxidative stress in I/R-ALI lung tissue

(A) mRNA expressions of the oxidative stress-related markers NGAL, mnSOD, HIF-1α, OCG1, Nrf2, and SIRT1, as detected via qPCR. (B) OCR in each group. (C‒E) Basal OCR, ATP production, and maximal respiration in each group. Sham: control group; I/RI: mice whose superior mesenteric artery was completely clamped; I/RI + Ger: I/RI group administered with germacrone. All data analyses were conducted via an unpaired t test. Data are shown as the mean ± SD, n = 3. *P < 0.05 and **P < 0.01.

Germacrone improved hypoxia-induced MLE-12 lung epithelial cell apoptosis in vitro

I/RI is characterized by hypoxia. MLE-2 cells were used to construct an in vitro model under hypoxic conditions. Compared with the control treatment, Ger treatment alone did not affect the viability of MLE-2 cells ( Figure 5A). After 3 h of hypoxia, the number of MLE-2 cells gradually decreased with increasing reoxygenation time ( Figure 5A). However, the number of cells increased significantly at each time point in the Ger-treated group ( Figure 5A). In addition, the apoptotic rate of MLE-2 lung epithelial cells increased significantly after hypoxia for 3 h. After reoxygenation and Ger treatment for 24 h, the percentage of apoptotic cells decreased significantly ( Figure 5B,C). Therefore, Ger increased proliferation and reduced apoptosis in hypoxia-exposed MLE-2 lung epithelial cells.

Figure 5 .

Germacrone improved hypoxia-induced MLE-12 cell apoptosis in vitro

(A) Cell viability in each group was detected via CCK8 assay. (B) EC50 of Ger in MLE-12 cells. (C,D) Apoptosis in each group was detected via flow cytometry; cell apoptosis was shown in D. Con: control group; HR: hypoxia-treated group; HR + Ger: hypoxia-treated group administered with germacrone. All analyses were conducted via unpaired t tests. Data are shown as the mean ± SD, n = 3. *P < 0.05 and **P < 0.01.

Germacrone ameliorated mitochondrial dysfunction in MLE-12 lung epithelial cells in vitro

The protein expressions of HIF-1α, OGG1, and Nrf2 in MLE-2 lung epithelial cells were used to evaluate the effect of Ger in vitro. Consistent with the in vivo results, the protein levels of HIF-1α, OGG1, and Nrf2 increased significantly, whereas those of mnSOD and SIRT1 decreased significantly after 3 h of hypoxia. The protein expressions of mnSOD and SIRT1 were increased and completely reversed after reoxygenation and Ger treatment for 24 h, demonstrating the protective effect of Ger on hypoxic MLE-2 cells ( Figure 6A and Supplementary Figure S4). Moreover, consistent with the in vivo results, basal respiration, the OCR of oxidative phosphorylation, and maximum respiration in the hypoxia group were significantly inhibited. Basal respiration, the OCR of oxidative phosphorylation, and maximal respiration significantly were increased after Ger treatment ( Figure 6B‒D). Thus, Ger relieved mitochondrial dysfunction in hypoxia-challenged MLE-12 lung epithelial cells.

Figure 6 .

Germacrone ameliorated mitochondrial dysfunction in MLE-12 cells in vitro

(A) Protein levels of mnSOD, HIF-1α, SIRT1, OGG1, and Nrf2 in each group, as determined by western blot analysis. (B) OCR in each group. (C‒E) Basal OCR, ATP production, and maximal respiration in each group. Con: control group; HR: hypoxia-treated group; HR + Ger: hypoxia-treated group administered with germacrone. All analyses were conducted via unpaired t tests. Data are shown as the mean ± SD, n = 3. *P < 0.05 and **P < 0.01.

SIRT1 knockdown abolished the germacrone-mediated amelioration of HR-induced mitochondrial dysfunction in MLE-12 lung epithelial cells

As shown in Figure 7, basal respiration, the OCR of oxidative phosphorylation, and maximum respiration in the hypoxia group were significantly inhibited in the model group (HR) and SIRT1-knockdown groups, especially in the model group ( Figure 7A‒D). Compared with those in the model and HR-treated SIRT1-knockdown groups, basal respiration, the OCR of oxidative phosphorylation, and maximal respiration significantly increased after Ger treatment ( Figure 7A‒D). However, the Ger challenge-mediated restoration of these indices was inhibited by the knockdown of SIRT1. Therefore, Ger likely relieves mitochondrial dysfunction in hypoxia-challenged MLE-12 lung epithelial cells in a SIRT1-dependent manner.

Figure 7 .

SIRT1 knockdown restrains the germacrone-mediated improvement in mitochondrial dysfunction in MLE-12 cells

(A) OCR in each group. (B–D) Basal OCR, ATP production, and maximal respiration in each group. Con: control group; NC siRNA: negative siRNA; HR: hypoxia-treated group; SIRT1 siRNA: SIRT1-knockdown group; HR  +  Ger: hypoxia-treated group administered with germacrone; SIRT1 siRNA + HR + Ger: hypoxia-treated group administered with germacrone in SIRT1-knockdown cells. All analyses were conducted via unpaired t tests. Data are shown as the mean ± SD, n = 3. *P < 0.05 and **P < 0.01.

Discussion

I/R injury is one of the most common types of tissue and organ injury during surgery, generating ROS, cytokines, and chemokines, which in turn activate the immune system, leading to distal organ dysfunction, especially in the lungs, and triggering ALI [29]. No specific drugs are available for clinical therapy. Recently, several compounds have been reported for I/R-ALI therapy. Acetate has been reported to ameliorate I/R-induced ALI in mice [30], and tetrahydropalmatine restores PI3K/AKT/mTOR-mediated autophagy in mice to prevent I/R-ALI [31]. Our results showed that Ger exerted significant protective effects in an I/R-ALI mouse model, with reduced fibrosis level and an improved lung phenotype, suggesting that Ger might be an effective and potential drug for I/R-ALI therapy.

Intestinal I/R results in enhanced tissue inflammation, with the concomitant release of IL-6 and IL-8 into the circulation [32]. During reperfusion, the expression of intercellular adhesion molecule 1 (ICAM-1) significantly increases, promoting the influx of neutrophils into IR-injured villus tips [33]. Secondary lung inflammation plays a key role in the pathogenesis of intestinal I/R acute lung injury [ 34– 36], and the accumulation of neutrophils in the lungs is a prominent feature of I/R-ALI [37]. Our results suggest that intestinal I/R-induced lung injury can increase the release of inflammatory cytokines and reduce the expressions of immune-related markers. Several compounds can exert significant anti-inflammatory effects, thereby alleviating I/R-ALI. For example, VPA treatment prevented the development of ALI and decreased serum IL-6 levels and lung tissue CINC concentrations compared with those in the control group [38]. In our study, Ger treatment reduced the secretion of M1 macrophage-related proinflammatory cytokines and elevated the levels of M2 macrophage-related anti-inflammatory factors, suggesting that Ger participates in the process of macrophage polarization to ameliorate I/R-ALI.

Mitochondria have important physiological functions, such as oxidative phosphorylation, electron transfer, Ca ²⁺ storage, and energy metabolism, and are the source of intracellular oxidative stress and the main target of apoptosis [39]. The main mechanism of intestinal I/R is cellular oxidative stress injury, which manifests as a massive accumulation of intracellular ROS [ 40, 41]. The downregulation of mnSOD can aggravate the mitochondrial injury caused by excessive ROS [42]. In this study, Ger administration significantly elevated mnSOD levels in vitro and in vivo, which indicated that Ger possibly inhibits the accumulation of ROS by increasing mnSOD activity. Ischemia and hypoxia interrupt these oxidative phosphorylation reactions, forcing lung cells to rely on glycolysis, which results in mitochondrial swelling and disintegration, endoplasmic reticulum swelling, and vesicle formation, eventually leading to lysosomal rupture and autolysozyme release [43]. Pulmonary IRI usually manifests with increased microvascular permeability, elevated pulmonary vascular resistance, and decreased oxygenation function [44]. These changes can lead to irreversible lung damage, resulting in pulmonary edema, hypoxemia, and multiple organ failure [45]. These studies suggest that mitochondrial damage plays a major role in the pathogenesis of I/R-ALI. In this study, Ger ameliorated mitochondrial function defects, oxidative stress, and hypoxia-induced apoptosis in vitro and in vivo. The prevention of mitochondrial injury may be a potential mechanism of action during Ger-mediated amelioration of I/R-ALI.

Importantly, SIRT1 activation can improve cell survival in the context of oxidative stress and protect organ function in neurodegenerative diseases, diabetes, myocardial damage, and renal I/R [46]. Rosenberger et al. [47] reported that in an isolated mouse model of renal I/R injury, HIF-1α could activate the expressions of various enzymes in the glycolytic pathway to reduce mitochondrial ROS generation. Induction of the Nrf2 pathway in NOX1-expressing adenocarcinoma A549 cells enhances HIF-1α signaling during intermittent hypoxia [48]. In the I/R-ALI model, HIF-1α and Nrf2 levels were reduced, whereas SIRT1 levels were increased following Ger administration. SIRT1 knockdown abolished the effects of Ger on I/R-ALI, suggesting that Ger may affect mitochondrial function through the SIRT1-HIFα-Nrf2 signaling pathway in MLE-12 lung epithelial cells. Moreover, we observed similar effects of Ger in hypoxic MLE-12 cells, in which apoptosis decreased and mitochondrial defects improved, further verifying the results obtained in the animal model.

In summary,we evaluated the therapeutic effect of Ger in an animal model of I/R-ALI and found that Ger could regulate the inflammatory process by regulating macrophage polarization and improving mitochondrial defects and oxidative damage in lung tissue. We evaluated the effect of Ger on I/R-ALI in an animal and cell model and preliminarily explored its underlying signaling pathway. Whether its effect depends on the HIF-1α/Nrf2 signaling pathway needs to be further studied using a HIF-1α/ Nrf2 knockdown model. Furthermore, the specific target of Ger remains to be clarified. In addition, the therapeutic effect of Ger in clinical practice needs to be verified. In summary, Ger may regulate macrophage polarization and improve subsequent mitochondrial defects via the SIRT1-HIFα-Nrf2 signaling pathway in MLE-12 lung epithelial cells, which ultimately affects inflammation in the I/R-ALI mouse model.

Supplementary Data

Supplementary data is available at Acta Biochimica et Biphysica Sinica online.

COMPETING INTERESTS

The authors declare that they have no conflict of interest.

Funding Statement

This work was supported by the grants from the Huadong Medicine Joint Funds of the Zhejiang Provincial Natural Science Foundation of China (No. LHDMY24H270002), the Zhejiang Provincial Medical and Health Technology Project (No. 2023KY158), the Cultivation Program for Excellent Young Talents of Hangzhou First People’s Hospital (No. YQNYC202131), and the Hangzhou Health Science and Technology Plan-Major Project (No. Z20220026).