Management succinate release through SDHA by G protein-coupled receptor 91 signal, TRAP1, and SIRT3 regulation in lung cancer cells by NAR nanoparticles

Graphical abstract

Abstract

Background

Cancer cells display oxidative metabolic dysregulation to fulfill their bioenergy requirements. Specifically, efforts were made to regulate the metabolite succinate and its negative effects as an inducer for neoplasm invasion and metastasis.

Methods

Binding affinity of naringenin (NAR) to mitochondria complex II (CΙΙ) subunits, sirtuin3 (SIRT3), tumor necrosis factor associate protein 1(TRAP1), and succinate receptor (SUCNR1) was studied by molecular docking. NAR nanoparticles (NARNPs) were synthesized and characterized by IR, X-ray, UV, drug release, zeta potential, TEM, and SEM. The IC₅₀ was evaluated in normal mice, normal fibroblast, and A549 cells by using the MTT technique. Moreover, the impact of NAR and NARNPs against 5-FLU on CΙΙ activity, SOD activity, and mitochondrial swelling was assessed. Apoptosis was also assessed using the flow cytometry method. While the expression of relevant genes such as SDHC, D, SIRT-3, TRAP1, SUCNR1, and ERK1/2 genes was determined by using RT-qPCR analysis. Western blot evaluated PI3K, NF-κB against β-actin.

Results

Theoretically, the binding affinity between NAR & SDHC, D, SIRT-3, TRAP1, and SUCNR1 proteins was stronger. Cytotoxic effects of NAR and NARNPs were evaluated. Also, the activity of SDH C, and D was inhibited more than SDH A, and B activity in the A549 than normal cell lines (NARNPs < NAR < 5-FLU), This was accompanied by downregulation of SDH C, D, TRAP1, SUCNR1, and ERK1/2 genes expression, and upregulation of SIRT-3 gene expression. Additionally, NF-κB and PI3K protein expression declined. On the other hand, there was a significant increase in apoptotic effects with mitochondria enlargement (NARNPs > NAR > 5-FLU) in A549 compared with normal cells.

In conclusion

Controlling succinate by SDH parallel with SUCNR1 signal regulation by NARNPs will be a novel understanding mechanism and candidate for therapeutic target in lung cancer.

1. Introduction

Lung cancer is recorded in around 15 % of all types of cancers which are distinguished by a startlingly high rate of proliferation, a significant predisposition for early metastasis, and a terrible prognosis.50, 47, 1 It is the most prevalent cancer, and with exposure to cigarette carcinogens, SCLC risk rises everywhere in the world. The metastatic illness affects most patients.⁵¹ As only one-third of patients have advanced disease when they are diagnosed, multimodality therapy has the potential to be curative.³⁷ Even though clinical advancement in the treatment of SCLC has traditionally been gradual, a greater understanding of the biology of the illness has shown certain vulnerabilities that may be amenable to certain therapy approaches.¹ Among the remarkable features of lung cancer is excessive cellular metabolism to match the bioenergetic needs associated with its growth rates.³⁶

To illustrate, the succinate dehydrogenase (SDH) is an enzyme that connects the electron transport chain (ETC) with the TCA round. In the first one, the SDH subunits took the oxidation of succinate to fumarate. SDH subunit dysfunction causes metastasis by reactive oxygen species (ROS) as a result of the electrons being removed and transported to ubiquinone via the electron-transport chain which has a role in the etiology and development of several human malignancies. Numerous cell signaling pathways, which have been connected to cellular transformation, inflammation, tumor survival, proliferation, invasion, angiogenesis, and cancer metastasis, are modulated by ROS and are mainly mediated by the transcription factors NF-κB and STAT3, hypoxia-inducible factor-1α, kinases, growth factors, cytokines and other proteins, and enzymes.24, 40 Moreover, Succinate is a major metabolite of the TCA round and is a key metabolite regulator. Moreover, it is an inflammatory signal, a carcinogenic initiator, and accumulates in large amounts in the location of the tumor.³² Certain malignancies including lung cancer were developed due to succinate buildup as a result of mutations or dysregulation in SDH subunits which is connected to adverse effects of cancer.⁶⁸ To investigate, the buildup of succinate that is carried to the cytoplasm and released into the extracellular space. According to recent research, succinate released by cancer increases the migration of cancer cells and encourages the spread of cancer by triggering signaling and transcription pathways controlled by succinate receptor-1 (SUCNR-1). Through the SUCNR-1 → PI-3 K → HIF-1α pathway, extracellular succinate generated from cancer promotes lung cancer cell motility. Through SUCNR-1-mediated ERK1/2 and STAT3 activation, extracellular succinate promotes tumor angiogenesis by upregulating the production of vascular endothelial growth factor (VEGF).23, 15

Through a variety of processes, particularly phosphorylation and acetylation, SDH activity is controlled at the post-translational stages. For complex II electron transfer to be effective.8, 29 Additionally, a significant and detected marker called Tumor necrosis factor receptor-associated protein 1 (TRAP1) belonged to the mitochondrial heat shock protein 90 family. It is active in a variety of biological functions in various tumor types, and its overexpression encourages cellular invasion and migration via the signaling pathway of STAT3/MMP2.⁶⁴ Therefore, in patients with lung cancer, prostate cancer, and ovarian cancer, TRAP1 may be a possible biomarker for prognosis and prediction. These proteins maintain the folding of essential controllers of membrane permeability transition, oxidative phosphorylation, and redox equilibrium.27, 14 Recently, TRAP1 has an inhibition role on SDH subunits A and B that catalyze succinate conversion.⁶⁴ As a result, Succinate develops after SDH inhibition caused by TRAP1 resulting in epigenetic alterations and HIF1 signal activation, which subsequently activates a pseudohypoxia process. Hence, TRAP1 goes down the activity of complexes II at subunits A. As a result, HIF1 signals enhance the TRAP1 transcription. Compared to normal tissues, lung tumor cells have increased quantities of the ATPase-directed chaperone heat shock protein 90 (Hsp90) in their mitochondria.27, 28 Sirtuin-3 (SIRT-3), which is a key NAD-dependent protein deacetylase, is the second regulator of SDH subunit A mostly found in the matrix of the mitochondria. As the main physiological regulator of SDH activity, SIRT-3 catalyzes the conversion of succinate to fumarate. It has been shown that reversible acetylation of several Lys residues in SDHA results in decreased SDHA enzyme activity, which lowers SDH activity and raises succinate levels. Deacetylation of SDHA promotes succinate dehydrogenase, or complex II, activity. Therefore, a rapidly developing area of research is figuring out how the molecular actions of TRAP1 affect survival and tumorigenesis.⁶⁰

Succinate is an agonist at the G protein-coupled receptor (GPCR) known as succinate receptor 1 (SUCNR1/GPR91), which activates the signaling of the Gi and Gq proteins for many cellular functions such as metabolism.62, 57 Additionally, it has been shown that activating SUCNR1 causes the phosphorylation of ERK in kidney cells and Akt in platelets.¹⁸ It was discovered that SUCNR1 enhances cancer spread by activating the PI3K/Akt pathway and is highly expressed in lung cancer. These results indicate a pro-cancerous function of SUCNR1, which may be a possible target in cancer by limiting its activity by using antagonists.44, 41 Chemotherapy, such as 5-fluorouracil (5-FLU), which is used either alone or in combination with cancer treatments, is one of the main therapeutic approaches to the treatment of both locally advanced and metastasized cancer.⁵ High toxicity, quick clearance from the systemic circulation, accumulation in unintended organs and tissues, enzymatic and hydrolytic breakdown, and ineffective cell entrance. However, limit the use of chemotherapy medicines. Inhibiting tumor cell proliferation without causing side effects is thus acknowledged as a key goal of cancer therapy.²²

Dietary flavonoids are a diverse class of biphenolic chemicals that are derived from plants. Naringenin (NAR) has received much research and is thought to be antioxidant, antitumor, and antineoplastic,61, 70 NAR and the naringin aglycone have been shown to have aorta anti-ulcer properties,³³ antioxidant¹¹ and dilatory actions as well as preventing lung carcinogenesis growth.43, 22 Numerous investigations have shown that NAR and its derivatives have significant pharmacological potential. Cell cycle stoppage, carcinogen inactivation, and estrogen-like activity are some of these traits. Moreover, p53 and members of the mitogen-activated protein kinase (MAPK) family, which are overexpressed and essential for promoting apoptosis in a variety of cancers, cause apoptosis.4, 6 Its ability to modify signaling pathways including NF-κB and STAT3 is one of its anti-cancer qualities. It has shown promise in stopping lung cancer cells from proliferating and spreading.⁶⁹

Unfortunately, NAR's low solubility and low bioavailability caused by its mostly hydrophobic ring shape limit its therapeutic significance. NAR also failed to pass cellular barriers and had poor body distribution. NAR nanoparticles (NARNPs) were created as a result to get around some of the major problems with NAR bioavailability using a delivery mechanism that can target cancer cells only is one way to increase the selectivity and efficiency of free NAR. A naturally occurring polymer known as chitosan (CS) is created when chitin is partially N-deacetylated.³⁰ It has unique properties, including biodegradability, biocompatibility, hydrophilicity, and non-toxicity, as well as a nanocarrier.¹³ It has been discovered that CS possesses special qualities such as the capacity to affect different tissues and its cohesiveness power. Additionally, the CSNPs pro-test uses outside variables like pH and enzymatic activity.⁵⁴ Polymer nanoencapsulations are efficient drug-delivery vehicles because they have increased surface area for adsorption, binding, and carrying medicines.⁵⁴ Moreover, nano-encapsulations protect them from metabolic activity, encourage controlled and prolonged drug release, and boost their bioavailability. The flavonoid NAR has been contained in CS due to its distinct characteristics.46, 22 Therefore, our study aims to explore whether NAR and its nanoparticles can provide new strategies for lung cancer treatment by regulating SDH and succinate levels and it is signaling pathways.

2. Material and methods

2.1. Materials

Used chemicals are analytically graded. Low Mwt CS, Penta sodium tripolyphosphate (TPP), NAR ≥ 95, MTT, (3-(4,5-dimethylthiazol-2-yl) 2,5-diphenyl tetrazolium- bromide), were purchased from Sigma Aldrich, Germany. A superoxide dismutase (SOD) kit was obtained from the Egyptian company Bio-Diagnostic Co. From Immunocyte Co. in Spain, and an Annexin V detection kit was purchased. The RT-qPCR chemicals, which included ThermoFisher Scientific (USA) provided the primers, RNA extraction, and cDNA synthesis kits, and Evergreen Master mix. β Actin (1:3000, Cell Signalling Technology, #8457), PI3K (Abcam, Cambridge, UK), and NF-κB (Abcam, Cambridge, UK) (Abcam, Cambridge, UK) were the targets of the primary antibodies.

2.2. Methods

2.2.1. In silico studies

The patterns of ligand of the molecules' binding to the target proteins were studied using molecular docking tools.

2.2.1.1. Ligand preparation

These ligands' 3D chemical structures were taken directly from the PubChem database. The ligand structures underwent 3D optimizations. The ligands' geometry was optimized, and their energy was minimized using methods following the guidelines in Avogadro1.2 (https://sourceforge.net/projects/avogadro/).

2.2.1.2. Protein-grid box processing

The preparation of macromolecules for docking investigations was done as previously described.⁶³ Using the protein data bank, the crystal structures of the proteins SDH, SIRT3, SUCNR1, and TRAP1 were retrieved https://www.rcsb.org. Proteins were prepared by excluding ligands, atoms, and water molecules. After that, proteins were created by adding hydrogen, deleting the alternate conformations, and introducing the missing atoms in incomplete residues. According to the Auto dock protocol, grid creation around the binding site was accomplished https://vina.scripps.edu/.⁵⁹

2.2.1.3. Docking

NAR was docked with proteins. Also, the ligands were chosen for screening based on their potential energy predictions and their protein binding geometries. Docking postures for compounds were sorted based on their dock score function using the Discovery-studio programmed (Version 4.0) https://discover.3ds.com/discovery-studio-visualizer-download. For subsequent research, the conformation of the ligands with the lowest binding energies was chosen. To find the compounds' binding poses and energies, an extra precision (XP) investigation was done.⁵⁹

2.2.1.4. ADMET Descriptors analysis

Using five Lipinski's rules and the ADMET analysis, docked compounds were subjected to the previously described prediction of drug-like features using Discovery Studio 0.4 software.⁵⁹ Many molecular parameters, including the ligands' molecular masses and Log P values, are examined in Lipinski's rule. To gain insight into the various crucial elements of medication ability, such as water solubility, intestinal absorption, etc., ADMET profiling is used at http://www.swissadme.ch/index.php, https://admetmesh.scbdd.com/service/evaluation/cal. The ADMET Descriptors estimate the above-mentioned pharmacokinetic parameters using a variety of models.59, 63

2.2.2. Naringenin nanoparticles (NARNPs) preparation

The pure NAR powder had been dissolved in 96 % ethyl alcohol; the mixture was stirred magnetically while adding 0.1 % w/v chitosan solution in acetic acid (0.1 %) to get the pH up to 4.8. To generate chitosan nanoparticles with 0.5 mg/ml of NAR as the final concentration, 40 ml of 0.01 % w/v TPP and 1.075 mL of 0.01 % v/v Tween-80 were then added drop by drop to the solution. Following the appearance of a bright pellet, the solution was centrifuged at 12,000 r.p.m for 20 min at 4 °C. The supernatant was used for additional examination after the pellet underwent freeze-drying.66, 45

2.2.3. Physical characterization of NARNPs

2.2.3.1. UV analysis

The encapsulation efficiency (EE) of NAR was evaluated, and after centrifugation, the supernatant of NARNPs was examined for ultraviolet (UV) absorption.22, 66

2.2.3.2. Entrapment efficiency assessment (EE)

Simply, it was detected after assay the UV absorbance of NARNPs in the supernatant that was collected after centrifugation. Moreover, NAR content in the supernatant was evaluated. The Folin-Ciocalteu (FC) method was used to create the relevant calibration curves. In brief, 5 mL of a 10 X (v/v) FC phenol reagent was mixed with 1 mL of the sample for 5 min at r.m. After that, 4 mL of (15 %) sodium carbonate was provided to every tube, which was then left for two hours before being assayed at 765 nm with a spectrophotometer. NAR standards with concentrations varying from 0.5 to 2.5 mg/ml were performed. Three tests were carried out on each standard and sample.²² The following formula is used to evaluate the EE of NAR: Entrapment efficiency (EE) (%) = (Wi – Wf / Wi) x 100 (1) Meanwhile, Wi is the total initial amount of NAR and Wf is the amount of free NAR in the supernatant after centrifugation (15.000 rpm, 80 min).21, 66, 22

2.2.3.3. Drug release studies

Briefly, 0.1 g NARNPs was dissolved in PBS (1x), pH 7.4; The release system was kept at 37 °C. While being continuously stirred at 100 rpm. 1 mL of the solution was taken out and replaced with 1 mL of buffer every 2 h for 24 h.⁵⁸ UV spectrophotometry was used to assess the amount of loaded NAR. The following calculation was used to calculate the amount of NAR emitted from microspheres during a specific period: NAR release (%) = NAR release from microspheres / NAR loading in microspheres) X 100.58, 22, 20, 45

2.2.3.4. FTIR analysis

Briefly, the formation of molecular bonding of NAR and Cs-NP was detected using the infrared (IR) spectra scored on KBr discs by using a Perkin Elmer- 1720 spectrophotometer in the region of 4000–400 cm⁻¹. Measurements were made of both pure and NAR-loaded chitosan nanoparticles.52, 22

2.2.3.5. X-ray powder diffractometry (XRD)

Using a monochromatic Cu K (1.5406 A) x-ray source and a Philips X PERT-PRO X-ray diffractometer, the XRD patterns of chitosan and NARNPs were produced (GNR, APD2000PRO, Italy). With a step size of 0.0167° and a voltage of 45 kV, the angle range was scanned from 5° to 35°.7, 66

2.2.3.6. TEM &SEM examinations

The characteristics of NARNP morphology were examined using a JEOL JEM-2100 high-resolution TEM running on a 200 keV activating voltage. Gaetan Digital Micrograph software was used to examine, collect, and interpret the TEM images. To create samples for TEM examination, NARNPs were suspended in ethanol at a low concentration and placed onto copper grids.12, 72 SEM analysis was used to determine the shape, size, and shape of the particle’s surfaces (TESCAN VEGA 3 SBH model). Using a scanning electron microscope and an ion sputtering, gold was sputtered onto a metal stub as the sample.²² A random scanning of the counterfoil was done for the NARNPs.³¹

2.2.3.7. Zeta potential

The Zeta potential (ζ) of NARNPs was measured using a foldable capillary cell and a Zettaliter Nano Series (Brookhaven, USA). Diluting NARNPs (1 ml) was used in the procedure for assay. Every measurement was done three times.3, 66

2.2.4. Animal experiment

2.2.4.1. Crude mitochondria separation from normal mice

Simply, mature male Swiss albino mice in the range of 30–32 g were purchased from Alexandria University in Egypt pharmacy Faculty. The mice were kept in a condition-controlled area with a 12-hour light/dark cycle. The Guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health were adhered to care for the experimental animals. The animal experimentation was approved by the Egyptian Ethics Committee at Tanta University's Faculty of Science (IACUC-SCI-TU-0287).⁵⁵ At the end of the experiment, The mice were decapitated by cervical dislocation after treatment with 300 mg/kg of sodium pentobarbital intraperitoneally (i.p) as an anesthetic.² Mitochondria isolated as shown in Fig. 1.10, 34

Fig. 1.

Schematic representation of mitochondria isolation mechanism from cell lines and adult mice.

2.2.4.2. Evaluating comparative 50 % inhibition constant IC₅₀ on complex II in normal adult mice

The inhibitory effects at various doses of NAR (0.02–2.85 µM), NARNPs (200–1000 nM), CNPs (200–1000 µg/ml), and 5-FLU (5–40 µM) were measured as described. The activity of succinate dehydrogenase was assessed using the MTT assay. Briefly, the previously stated NAR, CNPs, NARNPs, and 5-FLU concentrations were incubated with the mitochondrial solution (50 µL).⁴⁵ Finally, the absorbance was measured at 570 nm by utilizing the ELISA reader (Tecan, Rainbow Thermo, Austria).⁵⁶ The protein amount of the mitochondria was assessed by using the Bradford assay.19, 45

2.2.5. Cytotoxicity assay

Cell proliferation was detected using MTT- assays, which measure the developed cells. The obtained human pulmonary adenocarcinoma (A549) and primary lung normal fibroblast cells via Vacsera (Egypt).9, 45 The cells were numbered, followed by planting again at a final density of 1 x 10⁵ cells/mL (3 x 10⁴ cells/well) in plates with 96 wells. The cells were cultured for 48 hr after being treated with various concentrations of NAR (1.9–200 µM), NARNPs (1.9–200 µM), chitosan nanoparticles (CNPs) (100–1000 µM), and 5-FLU as reference drug (3.13–100 µ M). After 48 hr of drug treatment, the culture media were twice carefully rinsed in ice-cold PBS. After that, each well received the MTT solution (10 µL), which was then incubated for 3 h at 37 °C with 5 % CO₂. The culture media and MTT crystals of formazan were taken out of every well using 100 µl of acidified isopropanol (0.04 N HCl in 70 % isopropanol). The plate was lightly shaken for one minute after which the entire contents were aspirated using a multichannel pipettor. The plate was subsequently transferred to a fresh 96-well plate with 100 µL of 0.1 N NaOH in each well., and it was gently shaken for 15 min on an orbital shaker platform set at a low speed (100 rpm). Each well-aspirated content was fully transferred to new 96-well plates then the absorbance was measured at 550 nm.38, 45

2.2.6. Cell lines fractionation &mitochondria isolation

Mitochondria had separated from 60 × 10⁶ A549 and normal cells using a Precool gradient. as shown in Fig. 1.65, 45 A special isolation buffer is required for mitochondrial isolation because of the delicate nature of the membrane structures and their susceptibility to variations in temperature, osmolality, pH, and ionic concentrations. Typically, other organelles, like lysosomes and cell detritus, contaminate the isolated mitochondria obtained in this manner. Equilibrium density gradient ultracentrifugation is the method that is most frequently used to further purify mitochondria.¹⁶ The mitochondria must have plenty of time to reach their equilibrium densities and special tools are needed for this procedure. Moreover, strong centrifugal force during ultracentrifugation may harm mitochondria and lead to variations in the product's quality, viability, and yield.⁴⁹

2.2.7. Evolution of SDHA, B & SDH C, D subunits activities

A 50 µL mitochondrial solution was given various amounts of treatment following the IC₅₀ values for NAR (61 and 461 µg/mL), NARNPs (35.2 and 71 µg/mL), and 5-FLU (8.07 and 5.5 µg/ml) in A549 and normal cell lines, respectively. Each experiment was incubated for 30 min at 37 °C using 50 mM of phosphate buffer with a pH of 7.4 and 0.25 mg/mL of MTT, 20 mM succinate, 2 mM KCN, 0.4 mg/mL rotenone, 5 mM MgCl₂ and 0.02 mg/mL antimycin are the other ingredients. After that, (50 µL) of DMSO was used to dissolve the formazan crystals. All samples were measured at 570 nm.⁵⁶ The sample was included in the SDHC, D cocktail together with other ingredients such as succinate, EDTA, 2,6-dichlorophenol indophenol, KCN, and rotenone in a volume of 1 ml. For 10 min, the reaction was detected by a spectrophotometer. The response began after ubiquinone was added. After the initial five minutes, another five minutes were spent observing and recording the response. Finally, the complex II activity was provided as nmol/min/mg protein by a 2,6-dichlorophenol indophenol molar extinction coefficient of 21 mmol/L cm⁻¹.48, 47

2.2.8. SOD activity

The total mixture contains (300 x 10³ cells), sodium pyrophosphate buffer, and phenazine methosulfate (PMS), 0.3 ml of nitroblue tetrazolium (NBT), and 0.2 ml of the sample) that were collected by trypsinization and then added 2.8 ml of H₂O to complete the assay volume. After that, 0.2 ml of NADH was added to start the reaction. After 90 s of incubation at 30 °C, the mixture was quenched by putting 1 ml of glacial acetic acid. The intensity of color was measured at 560 nm.42, 47

2.2.9. Mitochondrial swelling

The mitochondria swelling was assessed by monitoring the decrease in absorbance at 540 nm for 10 min as explained by.²⁵ In a cuvette containing buffer (250 mM sucrose/5 mM HEPES, pH 7.4), the mitochondrial suspension was provided, and the variation was measured at 540 nm for 10 min by using a spectrophotometer after the contents were quickly mixed.71, 45, 25

2.2.10. Annexin V/PI by flow-cytometry technique

The apoptotic cells were examined according to the instructions of magnetars (BD Biosciences, Pharmingen, UK), PBS had been precooled and placed on ice was used to wash cells twice from each treatment group. The cell was added in 1X binding buffer and stained with Annexin V/PI for 15 min at r.m. After that, flow analysis was carried out immediately upon staining. To each cell solution (100 µl), 5 µml of propidium iodide (PI) and 5 µml of annexin V-FITC were added. Using this technique elaborates the healthy (FITC/PI-), apoptotic (FITC + PI-), and necrotic (FITC + PI + ) cells.17, 67

2.2.11. RT-qPCR evaluation

Using the Triazolam reagent from Ermo, USA, total RNA was extracted. The cDNA was produced using the Prime Script® RT master mix. Quantitative RT-PCR was carried out using the correct kit (QIAGEN), in line with the manufacturer's instructions, using GAPDH as a control. The level of RNA expression was detected by the CT methods. (https://blast.ncbi.nlm.nih.gov/Blast.cgi) Primer sequences are supplied together with the contents of the relevant qPCR assays (Table 1) (https://blast.ncbi.nlm.nih.gov/Blast.cgi).53, 67

Table 1.

Primers of genes were listed (1) Housekeeping gene GAPDH, (2, 3) SDH subunit C, D (4) Sirtuin 3 (SIRT3) (5) Succinate Receptor (SUCNR1) (6) Tumor necrosis factor associate protein 1 (TRAP1) (7) Extracellular-signal regulated kinases1/2 (ERK1/2).

Gene	Forward primer (/5 ------ /3)	Reverse primer (/3------ /5)	Size (bp)	Accession number
GAPDH	GATTCCACCCATGGCAAATTC	CTGGAAGATGGTGATGGGATT	87	NM_002046
SDHC	GATGGAGCGGTTCTGGAATAA	CATGGGAAGAGACCAACTGTAG	85	KR710834.1
SDHD	CATTTCTTCAGGACCGACCTATC	AACTTGTCCAAGGCCCAAT	88	NC_000011
Sirt3	AGGGACGATGATGTAGCTGA	GGCGATCTGAAGTCTGGAATG	110	NM_012239
SCUNR1	GATCATGGCATGGAATGCAACT	GACTCCCACAACGAACT CAATC	106	NM_033050
TRAP1	AGTGGGTTTCTACTCAGCTTTC	TTCAAACACTCCAGAACCATCT	115	NM_016292
ERk1	GCTGAACTCCAAGGGCTATAC	GTTGAGCTGATCCAGGT AGTG	118	NM_002746
ERk2	GTTGCAGATCCAGACCATGA	CTTGGTGTAGCCCTTGGAAT	105	NM_002745

2.2.12. The Western blotting analysis

Simply, The protein content was detected using a quantification kit after cell lysis. Protein lysates were separated using SDS-polyacrylamide gel electrophoresis and a PVDF membrane. After blocking with 5 % w/v nonfat dry milk in 1xTBST for two hours, the membrane was added to the specific primary antibodies (1:1,500 dilution) at 4 °C. The primary antibodies were PI3K (Abcam, Cambridge, UK, # PA5-87398), NF-κB (Abcam, Cambridge, UK, # PA5-27617), and β-actin (1:3000, Cell-Signaling Technology, # AM4302). After a few rounds of washing with 1xTBST and the appropriate secondary antibody (goat anti-rabbit horseradish peroxidase (HRP) conjugated antibody; Abcam, Cambridge, UK), the membrane was incubated for two hours at r.m. Hence, adding HRP substrate, membranes were assayed by image and analysis equipment (ChemiDoc-610, UVP, UK). ImageJ evaluated each target protein band signal and normalized it (https://www.bio-rad.com/en-us/product/chemidoc-mp imaging system).⁶⁷

2.3. The statistical assessment

The GraphPad Prism 8 software (San Diego, CA, USA) was used to analyze the data https://www.graphpad.com/guides/prism/8/user-guide/new-organization.htm,Origin18 https://getintopc.com/softwares/3d-cad/originpro-2018. Data from the experiment are illustrated as mean SE. Two, one-way ANOVA and t-test were performed to detect whether there were any there are big variations among the treated and control groups. The threshold for significance was set at (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001). When the p-value was below 0.05, it stated that the significance was acceptable.

3. The results

3.1. Molecular docking (In silico studies)

The inhibitor's chemical structure was determined by semi-empirical calculations to be the optimal input file for a conformational search employing a systematic search strategy. We examined existing PDB structures for SDH, SIRT3, TRAP1, and SCUNR1 (PDB codes: 1Yq3, 5d7n, 7C7B, and 6Z10). To identify the SDH, SIRT3, TRAP1, and SCUNR1-like protein's binding pocket, the naturally occurring ligand is taken out of the active site of the enzyme and docked there (the grid dimensions are presented in Table 2). As revealed in (Fig. 2, Table 2), the active site amino acids of 4 proteins docked to NAR with binding affinities of (−9.2, −8.5, −8.3, −8.8). The docked compound's binding affinities were represented in terms of their negative binding energy in kcal/mol (Mol). NAR had the maximum binding energy to the proteins SDH, SIRT3, TRAP1, and SCUNR1. Fig. 2 also depicts the intermolecular interactions of NAR with target proteins via interactions between the amino acid residues and H-bonds and −cations in 2D and 3D.

Table 2.

Docking scores of SDH, SIRT3, TRAP1, and SCUNR1 with natural compound NAR. Highlighted G-Scores indicate the most minus energy according to protein–ligand interaction.

Protein	Protein Data Bank ID	Affinity (Kcal/mole)	Distance (A0)	Docked Amino Acids	Grid dimensions
Succinate dehydrogenase (SDH)	1Yq3	−9.2	2.7	ARG95, 279 CYS168, LEU75,98 TRP 84, TYR26,79	X = 40 Y = 40 Z = 60
Sirtuin3 (SIRT3)	5d7n	−8.5	3.1	CYS168 LEU75 TRP84 ARG95,276 TYR26,79	X = 94 Y = 70 Z = 80
Tumor Necrosis Factor Associateprotein1 (TRAP1)	7C7B	−8.3	3.3	CYS 168 LEU75,98 ARG95,276 TRP 26,79 ASN94	X = 30 Y = 30 Z = 30
Succinate receptor (SUCNR1)	6Z10	−8.8	2.4	PHE205 MET163 GLY162 ILE161 ASN119 THR251 ASP158,171 ALA120	X = 30 Y = 30 Z = 30

Fig. 2.

2D, 3D models of model’s interaction between NAR with active pocket (A) SDH (B) SIRT3 (C) SUCNR1 and (D) TRAP1-like protein's active site at left and right sides respectively.

3.2. ADMET results

Lipinski's rule of five and ADMET experiments were used to further filter the naturally occurring chemical NAR. We assessed the compound's physicochemical properties, which are necessary for drug development to determine how drug-like it is. Our top docked NAR achieves the acceptable range of physicochemical properties of drug-like molecules following the rule of 5 (Table 3). Moreover, NAR's pharmacokinetic characteristics, such as Bioavailability blood–brain barrier level, intestinal absorption, and toxicity level were assessed. The solubility of NAR was found to be optimal range.26, 39 The NAR was within the permitted limits of toxicity that is dose-dependent. It was interesting to see that NAR showed a positive profile (level 0) regarding human intestinal absorption (HIA), the scores are 0 (good), 1 (moderate), 2 (poor), and 3 (extremely bad). After oral administration 0.6 mol/kg is equivalent to that of the standards (UP to 3 mol/Kg).³⁵ Overall, assessment of physical, chemical, and pharmacological properties. According to (Table 3).

Table 3.

Drug-like characteristics of the most important natural ligand.

Drug-like properties	M wt. (g/mol)	Blood-brain barrier (Log BBB)	Caco-2 Permeability	Human intestinal absorption-on (HIA + )	TPSA A2	Bioavailability	GI absorption	Oral rat acute toxicity (LD50)	AMES toxicity	Carcinogenicity	Log p
Acceptable ranges	100–600	<1 BBB-	Higher than −5.1	−-	0–140	>10 %	−-	Up to 3 mol/kg	> 0 < 1	Non-carcinogenic < 1	0 ∼ 3
NAR properties	272.07	0.042	−4.8	High	86.9	0.5	High	0.6	0.342	0.5	2.56

3.3. Physical characterization of nanoparticle

3.3.1. Encapsulation efficiency (EE %)

Based on Eq. (1), the (EE) value was 96 % ± 0.24 %.

3.3.2. UV analysis & drug release study

NAR represented a peak at 290 nm, as shown in Fig. 3A. The NAR that released in vitro from NARNPs was detected in the release medium of PBS, pH 7.4 at 37 °C for stability and drug release Fig. 3B. The NAR excretion from NARNPs showed an initial explosion, then continued steadily after 18 h, according to their kinetics. In the first two hours, there was a 36 % NAR release, which was the initial burst release. At 14 h, a second burst with a 70 % NAR release was seen. The graph plateaus between 14 and 24 h within 20 h, the NPs released a total of 80 % NAR as shown in Table 3.

Fig. 3.

(A) Ultraviolet absorption spectrum of NAR. (B) The in vitro drug release profile of NAR from the NARNPs.

3.3.3. FT-IR evaluation and patterns generated by XRD

FTIR is used to assess the chemical stability prospects of NAR enclosed in a polymeric core. Fig. 4A displays the FTIR spectra of the NAR, polymer, physical mixture, and NAR-loaded nanoparticle. Due to the 5-hydroxyl and 4-carbonyl groups in its structure, NAR can establish intramolecular hydrogen bonds. Fig. 4A shows that in the case of NAR alone, a distinctive absorption band emerging between 3,310 cm1 and 3,120 cm⁻¹ is related to O–H stretching while absorption bands between 1,620 cm⁻¹ and 1,479 cm⁻¹ are related to C=O stretching.

Fig. 4.

(A) Fourier transform − infrared (FT-IR) spectroscopy. (B) The pattern of XRD of NARNPs, CS nanoparticles, and NAR, respectively.

Due to significant peak development, the X-ray diffractogram of NAR revealed its crystalline character. NAR displayed a clear and dramatic peak at15.8°, 18.5°, 20.4°, and 25.4°, indicative that it is crystalline. The X-ray diffractogram of chitosan nanoparticles demonstrated its amorphous nature. It presented a recognizable peak at 22°. The pronounced NAR characteristic peaks vanished from the chitosan nanoparticle diffractogram with NAR loading. The amorphization of chitosan and NAR because of its complete containing in Cs-Np. It resulted in the loss of structural arrangement of the lattice during its entrapment Fig. 4B.

3.3.4. Nanoparticle morphology and particle size

As noticed in Fig. 5A, the particle size and surface shape were verified by the TEM of NARNPs. The NARNPs, which ranged in size from 19 to 40 nm, displayed a more distinct structural arrangement. They had a smooth surface and a spherical shape. Finally, there was a noticeable improvement in the dispersion of medication particles. NARNPs' size, surface morphology, and homogeneity were assessed by SEM examination as shown in Fig. 5B.

Fig. 5.

(A) TEM micrograph showing right side chitosan –NAR nanoparticles (NARNPs) with size range 19–40 nm while left side chitosan nanoparticles (CNPs) with size range 30–40 nm. (B) Surface morphology of chitosan- NAR nanoparticles.

3.3.5. The zeta potential

Due to the cationic characteristics of the molecule chitosan, chitosan nanoparticles often exhibit a positive zeta potential. Overall, the positive zeta potential of our formulations ranged from + 30 mV to + 50 mV Fig. 6.

Fig. 6.

The zeta potential of chitosan- NAR nanoparticles.

3.4. The impact of 50 % inhibition constant (IC₅₀) on SDH in normal adult mice

The concentration that inhibits 50 % of SDH activity was 59.8, 19.5, 184.1, and 0.72 µg/ml for NAR, NARNPs, CNPs, and 5-FLU respectively as shown in Fig. 7.

Fig. 7.

The 50% inhibition constant of (A) NAR, (B) NARNPs, (C) CNPs (D) 5-FLU of CΙΙ in normal mice.

3.5. Cytotoxic effect of NAR, CNPs, NARNPs, and 5-FLU

Using the MTT technique, cell proliferation was assessed. The outcomes were then compared with those obtained using 5-FLU as a positive control. It’s obvious that on increasing the concentration of treatment, the viability cells were significantly decreased (p ≤ 0.01). The IC₅₀ values of NAR, NARNPs, 5-FLU, and CNPs were evaluated at 461, 71, 8.07, and 311 µg/mL in normal fibroblasts, while A549 was 61, 35.2, 5.5, and 394 respectively Fig. 8.

Fig. 8.

The impact of IC₅₀ of (A) NAR, (B) NARNPs, (C) 5-FLU, and (D) CNPs on complex ΙΙ in A549 and normal fibroblasts.

3.6. Coenzyme Q reductase (complex II) and succinate dehydrogenase (SDH) activity by IC₅₀ of the tested compound

The relative activity of mitochondria complex II significantly decreased by NAR, NARNPs than 5-FLU in A549 than normal cells and mice which indicated that the ubiquinone reductase with more powerful inhibitory effect (Subunits C, D) than SDH (subunits A, B) Table 4, Table 5 Fig. 9. According to our findings, NARNPs are more effectively targeted to the ubiquinone site in A549 cells than NAR and 5-FLU.

Table 4.

The effect of NAR, NARNPs, and 5-FLU on SDHA, B activity by MTT Assay.

Treatment /Relative Activity %	A549	Normal
Untreated mean ± SEM.	100	100
NAR	90 ± 0.34 *P ≤ 0.02	92 ± 0.24
NARNPs	95 ± 0.57 *P ≤ 0.001	95 ± 0.34
5-FLU	85 ± 0.63 *P ≤ 0.001	91.4 ± 0.4

^*p value versus untreated cells.

Table 5.

The impact of NAR, NARNPs, and 5-FLU on SDHC, D activity.

Treatment /Relative Activity %	A549	Normal
Untreated	100	100
NAR	26.5 ± 0.34 *P ≤ 0.0001	69.44 ± 0.24
NARNPs	11 ± 0.3 *P ≤ 0.0001	51.5 ± 0.22
5-FLU	33.5 ± 0.63 *P ≤ 0.0001	88.8 ± 0.3

^*p value versus untreated cells.

Fig. 9.

(A) The inhibitory effect of NAR, NARNPs, and 5-FLU with IC₅₀ on SDH cells and (B) SQR activity in A549 and normal cells. (****p ≤ 0.0001, ***P ≤ 0.001, **P ≤ 0.01, *P ≤ 0.05, # for non– significant against control).

3.7. SOD activity

The influence of NAR, NARNPs, and 5-FLU on SOD activity within cells that are connected to free superoxide radicals. They showed a significant reduction in SOD activity (*p ≤ 0.001) following the administration of their IC₅₀ dose to A549 than normal cells Table 6, Fig. 10.

Table 6.

The effect of NAR, NARNPs and 5-FLU after 48 h administration on superoxide dismutase (SOD) activity.

Treatment	A549	Normal
Untreated	328.67 ± 0.33	347.3 ± 0.15
NAR	270 ± 0.36 *P ≤ 0.001	340.9 ± 0.2
NARNPs	230 ± 0.3 *P ≤ 0.0001	349 ± 0.22
5-FLU	290 ± 0.3 *P ≤ 0.01	320.1 ± 0.12

^*p value vs the negative control.

Fig. 10.

SOD activity after 48 h administration of NAR and NARNPs with 5-FLU in A549 and normal cell lines. When compared with the control group, there was****p ≤ 0.0001, ***P ≤ 0.001, **P ≤ 0.01, *P ≤ 0.05, # for non-significant against the control group.

3.8. Mitochondrial enlargement

According to our finding, treated A549 cells had significantly more swollen mitochondria than untreated normal cells (*p ≤ 0.0001), when NARNPs-induced enlarged mitochondria in cancer cells was greater than that in untreated cells. was larger than that caused by NAR or 5-FLU Fig. 11.

Fig. 11.

The impact of IC₅₀ value of NAR, NARNP, and 5-FLU on the degree of mitochondrial swelling in the normal and A549 cells. The data were presented by two-way ANOVA as (mean SEM) Non-significant differences from the equivalent control group are indicated by (mean SEM) by two-way ANOVA ** P ≤ 0.01, ***P ≤ 0.001 and ****P ≤ 0.0001, # for non-significant against the corresponding control group.

3.9. Apoptosis analysis by flow cytometry

The number of apoptotic and necrotic cells were observed after treating with drugs with IC₅₀ concentrations of NAR, NARNPs, or 5-FLU for 48 h. The effect of NAR, NARNPs, or 5-FLU on apoptotic cells was significantly upsurged compered to their necrotic effect. There was a significant apoptotic effect in A549 (*p ≤ 0.001, respectively) than in normal cells as shown in Fig. 12.

Fig. 12.

The graphical display of the percentage of the cells in each gate after 48 h of incubation with IC₅₀ concentration in the A549 (Left) and normal cell lines (Right) was shown graphically as A, B, C, and D for control, NAR, NARNPs, and 5-FLU, respectively. In a two-way ANOVA test, data were performed as mean SEM (n = 3), with # denoting non-significant differences from the matching control group (** P ≤ 0.01, ***P ≤ 0.001, and ***P ≤ 0.0001, # for non-significant versus the corresponding control group).

3.10. Real-time PCR analysis

Our data showed that significant reduction in mRNA expression level of SDH C, SDHD, TRAP1, SCUNR1, and ERK1/2 in A549 cells compared with that in control cells after 48 h of treatment with NAR, NARNPs, or 5-FLU at their IC₅₀. As indicated in Fig. 13, cells treated with NARNPs and NAR in A549 had the lowest expression of mRNA compared to cells treated with 5-FLU (NARNPs < NAR < 5-FLU), with no discernible effect on normal cells. In contrast, SIRT3 expression was considerably upregulated in A549 normal cells during a 48-hour treatment with (NARNPs > NAR > 5-FLU) versus untreated control cells.

Fig. 13.

The impact of NAR, NARNPs and 5-FLU after 48 h treatment on the expression of SDH (C, D), TRAP1, SUCNR1, ERK1/2 and SIRT-3 genes in A549 and normal cells.

3.11. Western blotting

In the present study, the western blotting analysis was performed to evaluate the PI3K and NF-κB levels in A549 after being treated with NAR, NARNPs, and 5-FLU in comparison with untreated cells (control). The expression of PI3K and NF-κB proteins was significantly decreased in A549 treated by NAR, NARNPs, and 5-FLU for 48 h Table 7(A), (B) and Fig. 14).

Table 7.

Band quantification of PI3K and NF-κB proteins expression after 48 h administration of IC₅₀ of NAR, NARNPs and 5 FLU treatment on A549.

Treatment	Protein Expression
	PI3K	NF-κB
Negative Control	0.78	0.72
NAR	0.47	0.61
NARNPs	0.44	0.69
5-FLU	0.46	0.00

The protein ratio is calculated as ratio after normalized to reference protein (β-actin).

Fig. 14.

Western blot analysis in A549 reveals variations in PI3K and NF-κB expression in comparison to actin protein (internal control). The findings are from one representative experiment out of three that were independent and revealed comparable patterns.

4. Discussion

Lung cancer is the most common cause of mortality, which is the most frequent type of disease (⁵¹). Among the leading causes of this cancer, metabolic changes to meet bioenergetic requirements continue to be a key pathway for increasing their rates of proliferation.⁴⁷ Succinate dehydrogenase (SDH), commonly referred to as succinate Coenzyme Q oxidoreductase (SQR), is a component of the oxidative process. SDH delivers electrons to the pool of ubiquinone (coenzyme Q) in the ETC and oxidize succinate to fumarate in the TCA cycle. In eukaryotes, the nuclear genome encodes four subunits that make SDH,⁸. The major catalytic component for the conversion of succinate to fumarate in SDHA, which comprises a succinate binding site, is formed through flavination of SDHA, which is necessary for the creation of the SDH complex. SDH depletion or dysregulation results in altered metabolism, because of succinate buildup and ROS/NF-κB activation,24, 8. TRAP1 is a paramount important marker of the mitochondrial shock protein 90 family, modulates the SDH reservoir and participates in numerous biological functions in a variety of tumor types. TRAP1 reduces the activity of OXPHOS complexes II at subunits A in mitochondria. Via the STAT3/MMP2 signaling pathway, TRAP1 overexpression promoted cellular invasion and migration.⁷³

Sirtuin-3 (SIRT-3) is also a significant NAD-dependent protein deacetylase. mostly found in the matrix of the mitochondria. Succinate is converted to fumarate by SIRT-3, which also serves as the main physiological regulator of SDH activity,⁸ (Ragab et al., 2022). SUCNR1 is abundantly expressed in lung cancer and promotes cancer metastasis by PI3K/Akt pathway. As a result, succinate is an agonist for succinate receptor 1 (SUCNR1/GPR91).8, 44 Therefore, our target was to regulate SDHA subunits that are responsible for succinate oxidation by TRAP1 and SIRT3. Also, succinate receptor signals pathway blockage to prevent adverse effects of succinate accumulations. In addition, a used inhibitor to target SDHC, D since deregulation of complex II at C, D subunits induce apoptotic cell death by ROS formation.⁸ NAR a polyphenolic component present in citrus plants, fruits, and vegetables, is one of these flavonoids’ compounds. However, their pharmacological activity in the treatment of diseases like allergies, diabetes mellitus, cancer, viral infection inflammations, and others, this class has drawn a lot of interest. It is efficient at stopping the growth of human lung tumors in vitro.⁴³ Most of these effects are attributed to enzymatic inhibition, anti-cancer and antioxidant activities, and disruption of processes like the production of free radicals,⁶¹. NAR also had poor body distribution and was unable to cross cellular barriers. To circumvent some of the primary issues with NAR bioavailability, NAR nanoparticles (NARNPs) were developed employing a delivery method that can specifically target cancer cells.⁶⁶ A naturally occurring polymer called chitosan (CS) incorporates the flavonoid NAR. Because of its distinctive qualities, including biodegradability, biocompatibility, hydrophilicity, and non-toxicity, as well as the fact that it is affordable, it is used as a nanocarrier.²²

Our purpose was achieved by theoretical and practical interaction of NAR and NARNPs and SDH, SIRT3, TRAP1, and SUCNR1. Theoretically, studies were done by molecular docking between NAR and SDH, SIRT3, TRAP1, and SUCNR1 proteins that showed the intermolecular interactions of NAR with the target proteins via interactions between the amino acid residues and H-bonds and cations with a binding affinity (−9.2, −8.5, −8.3, −8.8), respectively. This indicated that there is a stronger affinity between SDHC and D subunits. Also, strong interaction between NAR and SIRT3, TRAP1, and SUCNR1 amino acids. Lipinski's rule of five and ADMET experiments were used to further filter the naturally occurring chemical NAR. We assessed the physicochemical properties, which are necessary for drug development, to determine how drug-like it is. Our docked NAR are accepted in range of physicochemical properties, So the rule of 5. NAR has drug-like characteristics that can be used to further develop it as an SDH, SIRT3, TRAP1, and SCUNR1 inhibitors and as candidates in studying cancer diseases,39, 59. The creation of lightweight materials with high encapsulation effectiveness and stable nanoparticles has been made possible by the process of ionic gelation with chitosan (CS) percent 0.1 % and 2.5:1 ratio Cs: TPP.²²

According to prior work, the physicochemical characterization of NARNPs revealed a specific UV analysis peak at 290 nm.⁶⁶ The excretion of drugs After 18 h, NARNPs are released in an initial burst and then steadily, the graph plateaus between 14 and 24 h within 20 h, the NPs released a total of 80 % NAR. This contrasts with Kumar, Birundha, and colleagues'²² investigations, which found that chitosan capsules released NAR at a maximum of 15 %, suggesting that the most amount of NAR was retained through performing it. Moreover, the chitosan nanoparticle formulation was able to increase the bioavailability of the drug. When compared with other prior findings, our percentage of effectively loaded NAR in chitosan nanoparticles with a 2.5:1 CS: TPP ratio at 0.5 mg/ml concentration of NAR was significantly boosted by 96 % while, ²² demonstrated that CS: TPP ratio at 5:1 in 0.5 mg/ml of NAR concentration displayed a significantly higher percentage of encapsulation efficiency (80 %).22, 66

FTIR analysis is utilized to assess the chemical stability prospects of NAR enclosed in a polymeric core. The FT-IR measurement revealed that the unique bands of NAR and chitosan nanoparticles were also visible in NAR-loaded nanoparticles, indicating that NAR is largely encapsulated in nanoparticles and confirming the chemical stability of NAR in the formulation. The X-ray diffractogram of chitosan nanoparticles. Whilst revealing its amorphous character, it displayed a recognizable peak at 22°. Due to most of NAR encapsulating into chitosan nanoparticles, this supports the amorphization of chitosan. The structural arrangement of lattices was lost as a result of its entrapment. In the solid form, amorphization boosts the solubility and bioavailability of the drugs,⁶⁶. The NARNP's size and surface shape were verified using TEM. The size of the NARNPs ranged from 19 to 40 nm, and they seemed to be spherical with a smooth surface. It was found that the particle size reduced as the mass ratio rose. Thus, the particles' geometric mean diameter is found. These findings supported the earlier research which demonstrated that drug particles were substantially disseminated and that most of them were less than 60 nm. The spherical shape of the NARNPs was confirmed by TEM and SEM analysis, because, unlike a rod-shaped version, this one is easier for cells to digest.²²

Overall, our formulations' positive zeta potential ranged from + 30 mV to + 50 mV. Pattern 9. The reduced neutralization of NH₃ groups by the TPP cross-linker may be the cause of the rise in surface charge. High positive charge particles are more stable and can adhere to biological membrane acts as a physical wall dividing a cell's inside from the outside world. Because of its structural and biomolecular characteristics, the plasma membrane has a general negative charge due to the phospholipid-based bilayer membrane with spots of proteins and other materials,⁶¹ (Abd Elgadir et al., 2015; Md et al., 2019). Winarti, 2015 and colleagues demonstrated that the stability of NARNPs allows the nanoparticles to connect by negatively charged membrane, continue the process of endocytosis, and finally penetrate the cells,⁶⁶ (Ragab et al., 2023).

Cell proliferation was measured using the MTT assay, and the outcomes were contrasted with those obtained using the positive control (5-FLU). While IC₅₀ values were evaluated by the MTT analysis. The 50 % inhibition constant was 59.8, 19.5, 184.1, 0.72 µg/ml for NAR, NARNPs, CNPs, 5-FLU respectively, in normal adult mice. On the other hand, in cell lines the increasing in concentration of treatment, the viability cells were significantly decreased (*p ≤ 0.01). The IC₅₀ values of NAR, NARNPs, 5-FLU and CNPs were evaluated 461, 71, 8.07 and 311 µg/mL in normal fibroblasts, while A549 was 61, 35.2, 5.5 and 394 respectively compared with untreated cells (Ragab et al., 2022). The vitality of the cells significantly decreased, our data agreed with other studies that indicate lung cancer cell proliferation is inhibited by NAR at doses between 6.25 and 100 μg/ml.⁴³ On the other hand, Kaur and Badhan, 2015, Md et al., 2019 showed the IC₅₀ of NARNPs changed nearly from range 5–25 μg/mL at 24 and 48 h in cancer cells. They supposed that higher concentration might be used safely (Md et al., 2019; Ragab et al., 2022; Ragab et al., 2023). Moreover, the effects of CNPs were nontoxic, the IC₅₀ was considerably reduced in NARNPs compared to free NAR based on drug load,¹⁹ (Ragab et al., 2023). These data are supported by⁵⁶ study. After 48 h of incubation, it can be concluded that chitosan nanoparticles-TPP conjugates have the potential to encapsulate NAR, increasing its cellular uptake and cytotoxicity against lung cell lines as compared to the free NAR. NAR absorption into cells and anti-cancer effects are both increased by nanoparticle formulation (Ragab et al., 2023).

After the IC₅₀ for ubiquinone reductase (CII) activities and SDH activity were both measured the relative enzyme activity of the SDHA, B, C, and D activities demonstrated that NAR, CNPs, NARNPs, and 5-FLU had more effective on the ubiquinone oxidoreductase (C, D subunits) activities than SDH (A, B subunits) in A549 than in normal cells. Our findings indicated that NARNPs were more effectively targeted to the ubiquinone site in A549 than were NAR and 5-FLU. Our findings concurred with earlier research,56, 8 (Ragab et al., 2022; Ragab et al., 2023) which stated a natural flavonoid was analyzed for its significant biological anti-cancer effects. Complex II activity in cancer has been demonstrated to be severely suppressed, although normal mitochondria are unaffected. Additionally, it was noted that complex II inhibition linked the rise in ROS production to apoptosis.

Furthermore, we investigated how NAR, NARNPs, and 5-FLU affected SOD activity in cells to determine when free superoxide radicals were being produced. After the delivery of IC₅₀ to A549 cells as opposed to normal cells, they demonstrated a significant inhibition in SOD activity which react with the SDHC and SDHD subunits, causing a significant loss of electrons from complex II and release oxygen and an excessive amount of superoxide ions to be produced,56, 8 (Ragab et al., 2022; Ragab et al., 2023). MMP collapsed because of the event, and mitochondrial swelling changed. We discovered that after treatment, A549 cells had more swollen mitochondria than normal cells compared with the swollen state of untreated cells, NARNPs-induced mitochondrial swelling in cancer cells was larger than that produced by NAR or 5-FLU,⁸ (Ragab et al., 2022; Ragab et al., 2023). Complex II (SDH) activity is inversely correlated with mitochondrial respiration, ATP production, and apoptosis induction rates (Nakatani et al., 1999).⁴⁸ The effect of NAR, NARNPs, or 5-FLU on apoptotic action was significantly larger than the necrotic action. A549 cells exhibited a considerably higher level of apoptosis than normal cells. According to Ragab et al., 2023, CCNPs enhanced the ability of NAR to induce apoptosis by increasing the permeability of mitochondrial transition pores, which opened pores and caused oxidative stress.⁵⁶

Following applying the IC₅₀ of NAR, NARNPs, or 5-FLU for 48 h compared to that in untreated cells, molecular analysis showed that there was a considerable downregulation of SDH C, SDHD, TRAP1, SCUNR1, and ERK1/2 mRNA levels in A549 than normal cells. The lowest mRNA level was in cells treated with NARNPs and NAR in A549 than in cells treated with 5-FLU (NARNPs < NAR < 5-FLU) while in normal cells there is no significant effect. In contrast, treatment by (NARNPs > NAR > 5-FLU) for 48 h significantly increased the expression of SIRT3 in A549 than normal cells relative to the untreated control cells. This was consistent with prior research (Ragab et al., 2023). SDH C and D expression is declining by NAR, and NARNPs appeared to target the ubiquinone site of mitochondrial complex II which agreed with molecular docking. In addition to TRAP1, SCUNR1, and ERK1/2 downregulation. However, upregulation of SIRT3 that responsible for SDHA activity. While TRAP1 which suppresses the function of SDHA was downregulated. Our results supported our target through elevated conversion of the oncometabolite succinate by a decrease in the protein expression of the NF-κB and PI3K in A549 cells treated for 48 h with NAR, NARNPs, and 5-FLU.⁴⁴ Nevertheless, our research mainly focuses on in vitro cell experiments and still needs in vivo animal model validation.

5. Conclusion

Although succinate has historically been thought of as a TCA cycle intermediary now that its importance in regulating gene expression and intercellular communication has become obvious. in addition to energy consumption. Succinate has been classified as an oncometabolite and SDH as a tumor suppressor because of recent research that shows the significance of succinate buildup in the development of cancer. Our findings suggest that TRAP1, SIRT3, and SUCNR1 are essential for succinate-dependent cancer cells, underlining these potential of molecules as pharmaceutical targets for cancer therapy. NARNPs solve the problem of succinate accumulation to somewhat by inhibiting SDH C, D subunits activity (ubiquinone oxidoreductase) and induce apoptosis by ROS accumulation in cancer cell with maintain SDHA, B (succinate dehydrogenase) that responsible for succinate oxidation. Also, TRAP1 downregulation and SIRT3 upregulation are the most important SDHA regulators. In addition, targeting SUCNR1 signaling pathway by PI3K that responsible for adverse effects of succinate. On the other hand, targeting TRAP1 and NF-κB prevents invasion and metastasis through ERK1/2 down regulation. Finally, we recommended SDH and SUCNR1 regulation by NAR and NARNPs that activate the cancer cell death machinery and with its function as a marker in invasion and metastasis of lung cancer, prevent succinate accumulation.

6. Ethics approval and consent to participate

The experiments will be monitored by the Egyptian Ethical Committee of Tanta University’s Faculty of Science (IACUC-SCI-TU-0287).

7. Consent for publication

Not applicable.

8. Availability of data and materials

All data generated or analysed during this study are included in this published article.

CRediT authorship contribution statement

Eman M. Ragab: Writing – review & editing, Writing – original draft, Methodology. Abeer A. Khamis: Visualization, Supervision, Conceptualization. Tarek M. Mohamed: Supervision. Doaa M. El Gamal: Investigation, Conceptualization.

Funding

Not applicable.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following are the Supplementary data to this article: