The linc009 negatively regulates cell apoptosis in turbot (Scophthalmus maximus L.) during bacterial challenge

Highlights

• •Linc009 was mainly localized in the nucleus, where it may repress the expression of the corresponding genes by recruiting DNA methyltransferases (DNMTs) to specific gene promoters.
• •The expression of linc009 was significantly up-regulated after V. anguillarum infection and LPS stimulation.
• •Linc009 could play a negative regulatory role in the innate immunity of turbot by down-regulating the expression of pro-inflammatory factors.

Abstract

There is growing evidences indicating that long intergenic non-coding RNAs (lincRNAs) play key roles as regulatory molecules in a variety of cellular processes, including gene expression, splicing, apoptosis, and inflammatory regulation. It has garnered significant attention in recent years that lincRNAs could regulate the immune responses to pathogen infections in teleost. Here, we identified a lincRNA linc009 that significantly responded to the Vibrio anguillarum infection in turbot (Scophthalmus maximus). The length of linc009 was 1774 bp and located on turbot chromosome 19. Specifically, we found that linc009 was mainly localized in the nucleus, where it may repress the expression of the target genes by recruiting DNA methyltransferases (DNMTs) to specific gene promoters. In turbot, linc009 was constitutively expressed in the examined tissues, with the highest expression level in kidney and the lowest expression level in muscle. Furthermore, the expression of linc009 was significantly up-regulated after V. anguillarum infection and LPS stimulation. At the same time, the upregulation of linc009 expression inhibited the expression of proinflammatory cytokines (TNF-α and IL-1β), NF-κB, and IKKβ. Finally, apoptosis was analysed in turbot SMK cells. The apoptosis rate of SMK cells increased rapidly following linc009 overexpression. The results of apoptotic analyses suggested that the lncRNA linc009 played a negative role in regulating cell apoptosis. To sum up, our study showed that linc009 could play a negative regulatory role in the innate immunity of turbot by down-regulating the expression of pro-inflammatory factors, which strongly demonstrated that lincRNAs are involved in the antibacterial immune response of turbot. This study provided valuable insights into the function and regulatory mechanism of lncRNAs in teleost.

Introduction

LncRNAs are important epigenetic regulators involved in a variety of key biological processes such as apoptosis, posttranscriptional processing, and cell proliferation [[1], [2], [3], [4]]. It is well known that lncRNAs are divided into four groups: long intervention/intergenic non-coding RNAs (lincRNAs), intron lncRNAs, sense lncRNAs and antisense lncRNAs, according to their distribution in the genome, the relative position to nearby coding genes, and the direction of transcription [5]. LincRNAs are lncRNAs distributed among coding genes that do not overlap with any protein-coding sequence, accounting for over 50 % of lncRNAs, and have been widely identified in human (Homo sapiens), mouse (Mus musculus), zebrafish (Danio rerio), and chickens (Gallus gallus) [[6], [7], [8], [9], [10], [11]]. As a broader class of lncRNAs, lincRNAs performed physiological functions in cells, such as carcinogenesis, transcriptional regulation, cell cycle and apoptosis, bacterial infection and inflammation [[12], [13], [14], [15], [16]]. For example, the overexpression of lincRNA-73,240 had been demonstrated to promote the expression of genes associated with inflammatory processes, programmed cell death, autophagy and oxidative stress in chickens infected with avian pathogenic Escherichia coli (APEC) [17]. Inhibition of lincRNA Cox-2 ameliorated LPS-induced human peritoneal mesothelium cells (HMPCs) injury, increased cell viability, and inhibited apoptosis and inflammatory factor production; meanwhile, it could inhibit inflammatory injury by negatively regulating miR-21 and inactivating the TLR4/MyD88/NF-κB signaling axis [18]. However, the knowledge of immunological roles of teleost lincRNAs is still limited compared to higher vertebrates.

Recent studies have shown that lncRNAs played a key role in the immune responses of teleost against bacterial infection [19]. In grass carp (Ctenopharyngodon idella), lncRNA-WAS and lncRNA-C8807 interacted with miR-142a-3p to promote the release of inflammatory factors through activation of the NF-κB signaling pathway and thus participated in the inflammatory response following Aeromonas hydrophila infection [20]. In addition, 163 lncRNAs were specifically expressed in the spleen of large yellow croaker (Larimichthys crocea) by Vibrio parahaemolyticus challenge. These DE-lncRNAs may be related to the immune response [21]. It has been reported that lincRNAs in rainbow trout (Oncorhynchus mykiss) were expressed in a tissue-specific manner and shared many same characteristics as lincRNAs in mammalian species. Co-expression network analysis showed that many lincRNAs of rainbow trout were related to immune response, muscle differentiation and neural development [22]. As endogenous competitive RNAs (ceRNAs), lncRNAs played a role in immunity by competitively inhibiting the interaction of miRNAs with their mRNA targets and thereby controlling mRNA expression [23,24]. Recent studies in miiuy croaker (Miichthys Miiuy) have shown that the lncRNA IRL regulated the expression of IRAK4 at the protein and transcriptional levels by inhibiting the binding of miR-27c-3p to IRAK4, thus activating NF-κB-mediated signaling pathways, eliminating invading microbes, and promoting the host's immune response [25]. Similarly, the lncRNA TARL enhanced the TAK1-mediated antimicrobial response pathway by competitively adsorbing and boosting TAK1 inhibition, hence blocking the effects of the inhibitory miR-2188–3p [26]. However, the intricate signaling pathways mediated by lncRNAs in antibacterial immune responses across various vertebrate species, particularly in lower vertebrates, as well as their underlying regulatory mechanisms, are still need to be comprehensively investigated.

Turbot (Scophthalmus maximus), an important aquaculture fish with high economic value, is widely cultivated in the northern waters of China. With the continuous expansion of turbot farming scale and the increasing degree of intensification, bacterial diseases have also continued to break out, seriously restricting the development of its aquaculture industry [[27], [28], [29], [30], [31], [32]]. V. anguillarum is the most common Gram-negative bacterium and can cause disease in a wide range of crustaceans, bivalves and fish, including olive flounder (Paralichthys olivaceus), Atlantic salmon (Salmo salar L.), cod (Gadus morhua), turbot and halibut (Hippoglossus hippoglossus) [[33], [34], [35], [36], [37]]. Although many studies have been carried out to identify immune-associated lncRNAs in turbot, such as after the discovery of lncRNA SETD3-OT, it was presumed that SETD3-OT played a role in regulating apoptosis, immune cell development, and immune response to A. salmonicida and V. anguillarum infection; lncRNA BCO1-AS could respond to LPS stimulation and enhance caspase-1 expression at the transcriptomic and protein levels, inhibiting the expression of inflammatory cytokines. A comprehensive analysis of whole transcriptome sequencing of V. anguillarum infected turbot intestine showed that the target genes of DE-lncRNAs were highly enriched in immune-related signaling pathways, including NOD-like receptor signaling pathway, PPAR signaling pathway, cytokine receptor interaction [[38], [39], [40]]. However, the function of lincRNAs remains largely uninvestigated in turbot.

The aim of this study was to investigate the regulatory role of lincRNA linc009, a novel identified lincRNA in turbot, after infection with V. anguillarum. Therefore, we conducted a preliminary exploration of the role of linc009 in the immune response to V. anguillarum infection. Our study reveals novel insights into the regulatory mechanisms of turbot lincRNAs, providing a deeper understanding of their role in immune response regulation.

Materials and methods

Fish and challenge

Turbot (average weight of 15 g) was obtained from a fish farm in Haiyang, Shandong Province, China. All fish were kept in the aerated tank for a minimum of one week before experiments. The bacterial challenge was performed as described previously [41,42]. Briefly, the experimental group was immersed in V. anguillarum with the concentration of 1 × 10⁷ CFU / ml, while the control group was immersed in sterilized media only. After that, fish were slaughtered at various time points, and skin, gill, and intestine samples were obtained for RNA extraction. The animal study was reviewed and approved by Qingdao Agricultural University.

Cell culture and in vitro stimulation

Turbot kidney cells (SMK) were preserved by our laboratory. SMK cells were maintained in DMEM medium supplemented with 10 % FBS, 100 μg/ml penicillin, and 100 μg/ml streptomycin at 24 °C. For stimulation experiments, SMK cells were exposed to a concentration of 10 μg/ml of LPS and PGN and were individually collected at 0, 3, 6, 12, 24 h for RNA extraction [40].

Cloning the full-length lncRNA and bioinformatics analyses

The partial turbot lncRNA sequence was captured from turbot transcriptome database [43]. The 5′ RACE and 3′ RACE experiment were performed by the SMARTer RACE cDNA Amplification Kit according to manufacturer's protocol. The first strand cDNA template synthesis was performed using PrimeScript 1st Strand cDNA Synthesis Kit. The coding potential and subcellular localization were then predicted using Coding Potential Calculator 2 (CPC2) and iLoc-LncRNA, respectively [44,45]. The obtained full-length sequences were compared with the genome database for validation and genome location analysis.

RNA extraction and quantitative real-time PCR

Total RNA was isolated from mixed samples of skin, gill, and intestine from one healthy turbot by using RNAisoPlus and the first strand cDNA was synthesized by PrimeScript RT reagent Kit. Quantitative real-time PCR was performed in an Applied Biosystems QuantStudio 5 using SYBR ExScript qRT-PCR Kit with specific primers (Table 1) under the following cycling parameters 30 s at 95 °C for denatured, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s, 65 °C for 5 s then up to 95 °C at a rate of 0.1 °C/s increment. All samples were run in triplicate. The relative expression ratios were calculated using the 2^−∆∆CT method. Using turbot 18S rRNA as internal controls to detect the expression levels, respectively.

Table 1.

Primers used in this study.

primer	Sequence (5′to 3′)
5′RACE-R1	GCCAGCAAGCCGCATTGTCTC
5′RACE-R2	CACTGTCCTCAGCGTCTCCGTAT
3′RACE-F1	GTCTGGTCTCAAAGCCGCTAACA
3′RACE-F2	TGAACTGGACAAGGAGGAGATGC
Full-F	CTCGTGGTCATTGAAGGTCAGATCA
Full-R	ACACACCCTCTCTCTCTTAATCTCT
qlinc009-F	TTTTTCGCCATCAATCACAA
qlinc009-R	AGCCTCACATTTGGAACACC
qTNF-α-F	GGGTGGATGTGGAAGGTGAT
qTNF-α-R	GGCCTCTGTTTGGCTTGACT
qIL-1β-F	TGGAGAGCATCGTGGAAGAAC
qIL-1β-R	CGCCCGTCCTGCTGAAC
qIKKβ-F	AGCTGTGGTATCCTTGCAGT
qIKKβ-R	TCAGAGAACCAGAAACGCCT
qNF-κB-P50-F	TCCAGAGCACGACACACTTC
qNF-κB-P50-R	ATCCCAGGAACCACTCCTCT
18S-F	TGTGGGTTTTCTCTCTCTG
18S-R	ATTCTTGGCAAATGCTTTC
β-actin-F	GTAGGTGATGAAGCCCAGAGCA
β-actin-R	CTGGGTCATCTTCTCCCTGTTG
U1-F	GAACGCAGTCCCCCACTAC
U1-R	TACTTACCTGGCAGGGGAGATAC
pcDNA3.1-linc009-F	AGACCCAAGCTGGCTAGCGTAAAATTAGAGTTCAGA
pcDNA3.1-linc009-R	GGGCCCTCTAGACTCGAGACACACCCTCTCTCTCTTAATCTCT

Plasmid construction and cell transfection

For eukaryotic expression, the lncRNA linc009 was cloned into a pcDNA3.1 vector with his-tag by using the NheI and XhoI restriction sites. SMK cells (2 × 10⁷ cells) were inoculated into a sterile six-well plate and transfected with linc009 - pcDNA3.1 expression plasmid or empty plasmid for 24 h according to Lipofectamine 2000 instructions. Afterwards, the cells were harvested by using RNAisoPlus for RNA extraction and real-time analysis.

Subcellular localization analysis

The SMK cells were collected and washed three times with ice-cold PBS. The PARIST kit was used to perform nuclear and cytosolic fractionation analysis in accordance with the manufacturer's instructions. The RNA was then isolated from the nuclear and cytoplasmic fractions by using RNAisoPlus. Finally, the relative expression of linc009 in nucleus and cytoplasm was detected by qRT-PCR using U1 and β-actin as reference genes, respectively.

ChIRP of linc009

We performed CHIRP assays to explore which proteins might specifically bind to linc009 and the interactions between them. The ChIRP analysis was performed by Chromatin Isolation by RNA Purification (CHIRP) Kit (Cat. No.Bes5001; BersinBio, Guangzhou, China). SMK cells were harvested in a 50 ml centrifuge tube and crosslinked with formaldehyde for 20 min at room temperature. After washing with PBS, SMK cells were lysed with lysis buffer (nuclear lysis buffer, protease inhibitor, DTT, and RNase inhibitor) to each tube and resuspended the pellet, left on ice for 10 min before sonication. Next, magnetic streptavidin beads were used to precisely pull down the lysates. The levels of the DNA ChIRP products were determined by sequencing.

The apoptotic assay

To examine the effect of overexpression of linc009 on apoptosis, SMK cells were seeded in 6-well plate according to 1 × 10⁶ cells per well. The cells were transfected with pcDNA3.1-linc009 vector or empty vector as above. After transfection for 24 h, trypsin-digested cells were washed three times with cold PBS and resuspended in 100 μl of Annexin V-FITC binding buffer. After adding Annexin V-FITC (5 μl) and Propidium Iodide (PI) (10 μl) to the cell suspension, the cells were incubated for 15 min at room temperature away from light. Flow cytometric analysis of treated cells was performed on Beckman Coulter CytoFLEX (California, USA). The apoptosis rate was calculated by determining the ratio of early and late apoptotic cells.

Statistical analysis

All data were analyzed in SPSS 20.0 with three independent replicates and data were expressed as mean ± standard error (SE). The p < 0.05 was considered to be statistically significant.

Results

Characterization of linc009

We firstly treated turbot with V. anguillarum and collected intestine tissues to construct sequencing libraries [46]. By comparing the expression levels of lncRNAs between experimental and control groups, we found that an intergenic lncRNA named linc009 was highly expressed after V. anguillarum infection. Then we performed 5′ and 3′ RACE experiments, and the results showed that the length of linc009 was 1774 bp with a poly(A) tail. LncRNA linc009 is located on chromosome 19 of the turbot and consists of one exon (Fig. 1A). Next, we performed the subcellular fractionation assays, it was confirmed that linc009 was mainly localized in the nucleus (Fig. 1B). According to the CPC2 (coding potential calculator 2) computational algorithm predicts that linc009 has no coding capacity in turbot (Table 2). Therefore, these results support that linc009 is a long noncoding RNA in turbot.

Fig. 1.

Characterization of linc009. (A) The genomic location of linc009 and its neighboring genes in the genome location within 100 kbp. (B) The cytoplasmic and nuclear distribution of linc009 in SMK cells were identified using qRT-PCR assay. All data represented the mean ± SE from three independent triplicated experiments.

Table 2.

The coding potential characterization of linc009 and linc009 (reverse) by Coding Potential Calculator 2 (CPC2).

Gene name	Label	Coding probability	Peptide length(aa)	Fickett score	ORF integrity
Linc009	noncoding	0.30	116	0.35	complete
Linc009(reverse)e)	noncoding	0.02	54	0.33	complete

Constitutive and V. anguillarum induced expression of linc009

The tissue expression pattern of linc009 was detected in healthy turbot, including skin, gill, intestine, blood, liver, spleen, kidney, muscle and brain. The highest expression level of linc009 was exhibited in kidney, followed by brain, spleen, gill, skin and was almost undetected in the muscle (Fig. 2A). Intestine, skin and gill samples were collected at 2, 6, 12, 24 and 48 h to examine the expression of linc009 after V. anguillarum challenge in turbot. The highest level of linc009 was observed in gill with 3.04 fold at 12 h, followed with 2.29 fold at 6 and 2.04 fold at 24 h in skin. However, there was no significant change in intestine (Fig. 2B).

Fig. 2.

The constitutive (A) and V. anguillarum challenge (B) expression of linc009 in turbot. All data represented the mean ± SE from three independent triplicated experiments and * indicated statistical significance at P < 0.05.

In vitro stimulation with PAMPs

We also investigated its expression patterns in LPS and PGN stimulated SMK cells to explore its role in immunity. As shown in Fig. 3, the expression level of linc009 was significantly upregulated in SMK cells after LPS stimulation and peaked with 3.22 fold at 12 h of LPS infection. Similarly, linc009 was significantly up-regulated after PGN stimulation, with 3.92, 3.69, 3.42, and 14.71 fold at each timepoint.

Fig. 3.

Results of the in vitro stimulation of linc009 in responses to LPS and PGN in SMK cells. All data represented the mean ± SE from three independent triplicated experiments and * indicated statistical significance at P < 0.05.

linc009 reduces the expression of inflammatory cytokines

Given that the expression of linc009 was elevated after LPS stimulation, so we further investigated the modulation of the antibacterial immune by linc009. Linc009 and pcDNA3.1 were transfected into SMK cells, respectively, RNA was extracted 24 h later, and the results showed that the expression of linc009 was significantly higher than that of the control (Fig. 4A). Meanwhile, the expression levels of IL-1β, TNF-α, IKKβ, and p50 were detected by overexpression of linc009 6 h after LPS stimulation. As shown in Fig. 4B, overexpression of linc009 significantly reduced the expression levels of IL-1β, TNF-α, IKKβ, and p50 under LPS stimulation. This suggested that the linc009 could regulate the antibacterial immune signaling pathway and play a negative regulation role in turbot.

Fig. 4.

SMK cells were transfected with linc009 plasmid which collected for RNA extraction after 24 h, and cells were treated with LPS for 6 h and pcDNA3.1 as control. The expression of linc009 (A), IL-1β, TNF-α, IKKβ and p50 (B) was analyzed by qPCR. All data represented the mean ± SE from three independent triplicated experiments and * indicated statistical significance at P < 0.05.

linc009 promotes apoptosis

We used chromatin isolation by RNA purification (ChIRP) and sequencing to determine the signaling pathways associated with linc009 in order to further clarify its mechanism of action. KEGG showed that linc009 might be involved in necroptosis, Notch signaling pathway, PPAR signaling pathway and other signaling pathways (Fig. 5A). Besides, the top 10 enrichment analysis also showed multi-similar relative signaling pathway (Fig. 5B). Furthermore, apoptosis analysis revealed that the apoptosis rate of SMK was significantly elevated to 60.4 % after overexpression of linc009 for 24 h compared to the control group (48.24 %). The apoptosis of SMK mainly occurred in the late apoptotic stage with an apoptosis rate of 40.96 % after overexpressing linc009. The ratio of early apoptotic cells to dead cells did not change significantly (Fig. 5C).

Fig. 5.

linc009 promotes apoptosis. (A) KEGG analysis of linc009 (B) The top 10 enrich factors of linc009. Statistical significance is indicated by different colors. The size of the circle represents the number of Peak overlap genes in each pathway. (C) The effect of linc009 overexpress on cell apoptosis was analyzed by flow cytometric cell apoptosis assays.

Discussion

LincRNAs are the largest class of lncRNAs and play critical roles as regulatory molecules in a variety of cellular processes, including gene expression, splicing, apoptosis, and inflammatory regulation [[47], [48], [49]]. Although the role of lincRNAs in cancer and other diseases in higher animals has been intensively studied, fewer studies have been carried out in fish, and, to the best of our knowledge, lincRNAs in turbot have not been systematically characterized or studied previously. In this study, we identified one lincRNA in turbot, which was named linc009 based on its genomic location and relative to the coding gene, it should provide a basis for further studies on the regulatory role of lincRNAs.

V. anguillarum is a facultatively anaerobic Gram-negative comma-shaped rod bacterium that causes haemorrhagic septicaemia and significant economic losses in marine fish farming, and infects fish mainly through skin adherence and ingestion of contaminated water or food [50]. In this work, we found that linc009 was significantly up-regulated in skin and gill after V. anguillarum infection, suggesting that linc009 may play an important role in the early immune response to V. anguillarum invasion in turbot. Tissue distribution analysis showed that linc009 was constitutively expressed in all organs of healthy turbot, with the highest expression level in kidney. In previous studies on lncRNA in turbot, SETD3-OT and BCO1-AS were expressed at the highest level in the intestine [38,40]. The fish kidney is a haematopoietic and immune organ containing B lymphocytes, T lymphocytes and various granulocytes involved in immune activities [51]. The high basal expression of linc009 in the kidney may indicate its involvement in immune cell-related activities in turbot. In addition, we found that the expression of linc009 was significantly increased after LPS stimulation. LPS is a pathogenic component carried by many Gram-negative bacteria that can cause an inflammatory reaction in the host [52,53]. The high expression suggests that linc009 can respond to LPS stimulation, hence maintaining antibacterial immunity and ensuring an adequate immune response.

A growing number of studies have also shown that lncRNAs play a positive or negative role in regulating the abnormal expression of proinflammatory factors such as TNF-α, IL-1β, and so on in the bacterial-induced inflammatory response [54,55]. In grass carp, lncRNA-adm2 inhibited the production of pro-inflammatory factors (IL-6 and IL-1β) by interacting with cid-miR-n3 and regulating its target gene adm2 [56]. LPS stimulation upregulates the expression of lncRNA NEAT1 and inhibition of lncRNA NEAT1 reduces inflammatory cytokine levels [57]. In addition, lncRNA LTCONS8875 could upregulate IRAK4 expression at both transcriptional and post-transcriptional levels and significantly increase the production of inflammatory factors such as TNF-α, IL-8, and IL-1β upon LPS stimulation [58]. NF-κB was a key signaling pathway that controlled many genes involved in immune and inflammatory responses. Part of the NF-κB signaling pathway that was essential was NF-κB kinase inhibitor (IKK). NF-κB inhibitor (IκB) and IKK regulate NF-κB in inactivated cells [59,60]. Previous studies have shown that lncRNA NKILA interacts with the NF-κB/IκB complex and inhibits IκBα phosphorylation, thereby inhibiting NF-κB activation [61]. In this study, overexpression of linc009 inhibited the production of pro-inflammatory cytokines TNF-α and IL-1β as well as IKKβ and P50, suggesting that linc009 may be a key factor involved in the immune and inflammatory response in fish, but the specific mechanism remains to be investigated.

KEGG analysis helped to better understand the complex networks in lincRNA regulatory mechanisms. Our results showed that linc009 target genes were highly enriched in immune-related signaling pathways, including the Notch signaling pathway, the PPAR signaling pathway, and other signaling pathways. Similar results of immune-associated KEGG enrichment were found in other fish during pathogen infection. Previous studies have shown that a total of 184 differentially expressed lncRNAs were identified in the livers of V. anguillarum-infected turbot and KEGG enrichment analyses of differentially expressed lncRNAs showed that lncRNAs were significantly enriched in several immune-related signaling pathways, including the NOD-like receptor signaling pathway, Toll-like receptor signaling pathway, Cytokine-cytokine receptor, MAPK signaling pathway, phagosome, PPAR signaling pathway, and the regulation of autophagy [62]. The Notch pathway is a signalling cascade that is essential for cell proliferation, differentiation and death [63]. Linc-OIP5 inhibited cell proliferation in vitro and tumor growth in vivo by regulating Yes1-associated transcriptional regulator (YAP) expression and Notch signaling cascade activity [64]. In addition, this study found that overexpression of linc009 significantly increased the rate of apoptosis, and these findings suggested that overexpression of linc009 could exacerbate cellular damage during V. anguillarum infection.

In conclusion, a novel lincRNA linc009 was differentially expressed during V. anguillarum infection in turbot, involved in promoting apoptosis and regulating the expression of various inflammation-related genes. These findings provided a basis for further investigation of the functional mechanism of linc009, thus deepening our understanding of the role of the novel linc009 in the antimicrobial immune response. However, further studies are needed to identify the specific target genes and functional mechanisms of linc009.

CRediT authorship contribution statement

Beibei Wang: Writing – original draft, Methodology, Investigation, Formal analysis. Xiaocheng Zhu: Writing – original draft, Software, Resources, Investigation, Formal analysis. Xinghua Zhuang: Writing – review & editing. Xiaoli Liu: Visualization, Validation, Software. Zhongyi Wang: Visualization, Validation, Resources. Ning Yang: Writing – review & editing, Methodology, Investigation. Chao Li: Writing – original draft, Project administration, Funding acquisition, Data curation, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

Data will be made available on request.