Skip to main content
NCBI home page
Scientific Reports logoLink to Scientific Reports
. 2025 Mar 4;15:7598. doi: 10.1038/s41598-025-92164-9

Enhanced hepatitis E virus infection of polarised hepatocytes in vitro

Hannah M Brown 1, Julien Marlet 2, Nancy León-Janampa 3, Denys Brand 2, Nicola F Fletcher 1,✉
PMCID: PMC11880378  PMID: 40038434

Abstract

Hepatitis E virus (HEV) is a leading cause of acute viral hepatitis worldwide, and the only zoonotic hepatitis virus. HEV genotype 3 (HEV3) is associated with a range of clinical presentations including chronic infection in immunocompromised individuals in developed nations as well as sporadic cases of autochthonous HEV3 in Europe. Current in vitro models support low levels of HEV infection, hampering our understanding of viral pathogenesis and development of therapeutics. We developed modified culture methods for two widely used hepatoma cell lines, PLC-PRF-5 and Huh-7.5, and evaluated HEV infection. Simple epithelial-like polarity and differentiation formed in PLC-PRF-5 cells, evidenced by localisation of tight junction proteins occludin and zona-occludin 1 to intercellular junctions, and increased albumin production. Complex hepatocyte-like polarity was observed in Huh-7.5 cells, with tight junction proteins localised to shared internal bile canaliculi-like structures and retention of the fluorescent molecule, 5(6)-Carboxyfluorescein diacetate. Cells were infected with genotype 3 HEV, and enhanced infection and replication of HEV was observed using RT-qPCR and immunofluorescent labelling of HEV ORF2 and dsRNA. We describe robust, accessible models for HEV infection in vitro. These models will allow studies to further our understanding of this emerging zoonotic pathogen and develop therapeutic interventions.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-92164-9.

Keywords: Hepatitis virus, Hepeviridae, Zoonoses, In vitro model, Polarity

Subject terms: Gastroenterology, Pathogenesis, Pathogens, Virology

Introduction

Hepatitis E virus (HEV) is an emerging zoonotic virus and is one of the most common causes of acute viral hepatitis worldwide1. Annually, 20 million cases of HEV are reported, with roughly 3.3 million symptomatic cases, causing approximately 44,000 deaths2. While many infections with HEV result in acute disease, individuals with pre-existing liver disease, pregnant women and immunocompromised individuals can develop severe disease and/or progress to chronic disease, with up to 10% developing liver cirrhosis3. HEV is a single-stranded positive-sense RNA virus that belongs in the Paslahepevirus genus, within the Hepeviridae family4. The Paslahepevirus balayani species consists of 8 genotypes, with genotypes 1 to 4 causing infections in humans. Genotypes 3 and 4 are zoonotic viruses, causing clusters of HEV outbreaks. These zoonotic infections may be associated with a range of clinical presentations including acute, self-limiting hepatitis and chronic infection in immunocompromised individuals in developed nations3. The leading mode of transmission to humans of HEV genotype 3 is the consumption of undercooked pork products that contain infectious virions5. Domestic pigs have been identified as the predominant animal reservoir. A United Kingdom study reported seroprevalence and HEV RNA levels in pigs at slaughter of 92.8% and 20.5%, respectively6. High seroprevalence in domestic pigs has also been reported throughout Europe, including Ireland7, France8, Italy9, Germany10, Spain11, Netherlands12, Belgium13 and Bulgaria14.

Currently, studying the HEV lifecycle remains challenging due to the lack of a universal culture system that supports the robust propagation of HEV clinical isolates15. To overcome this limitation, culture adapted viral isolates are commonly used, such as the genotype 3 Kernow-C1 isolate16, or the transfection of RNA transcripts from cDNA clones or replicons into target cells to initiate infection16,17. Limited success has been demonstrated with wild-type clinical strains and notably, successfully propagated clinical HEV isolates frequently contain well studied genetic insertions18,19. These isolates may not reflect the true pathobiology of wild-type HEV as these insertions often confer improved replication20,21. The successful propagation of HEV clinical isolates was recently demonstrated in PLC-PRF-5 cells. Sequencing of the isolates revealed no insertions typically associated with an in vitro growth advantage22, highlighting the potential of this model for HEV research.

Within the liver, hepatocytes are the major cell type that support HEV infection23. Hepatocytes in vivo are the main parenchymal cells of the liver and display a unique multipolar organisation and differentiation, with structurally and functionally distinct plasma membranes24. Membrane domains are separated by protein adhesion complexes, known as tight junctions, which form a functional barrier and prevent the paracellular flux of molecules25. Hepatocyte polarity is also maintained by intracellular cytoskeletal structure and trafficking machinery24. These features are not recapitulated in 2D hepatocyte culture models in vitro26, including those currently utilised for HEV infection studies.

Many features of differentiated, polarised hepatocytes have demonstrated importance in the virus-host interactions of hepatotropic viruses27–30. HepaRG cells, an immortalised human liver bipotent progenitor cell line, differentiate into hepatocyte-like and cholangiocyte-like cells with functional polarity. They provide a valuable model for infection with hepatotropic viruses including hepatitis B, C and E infection31, though establishment of differentiation as well as HEV infection can be time consuming and inconsistent across studies32. HepG2/C3A hepatoma cells develop epithelial-like columnar polarity when cultured on porous inserts. Following infection with a culture-adapted HEV isolate, the bilateral release of virions was shown, with significantly higher numbers of virions released from cells via the apical membrane33,34. HEV ORF3, the viral protein that facilitates virion egress, also relocalises to the apical membrane in polarised cells35. Furthermore, HEV exists as both a non-enveloped (nHEV) and quasi-enveloped (eHEV) virus within one host. Virions in faeces are non-enveloped, while virions in the serum possess a host-derived, membrane-like envelope known as a quasi-enveloped36. Taken together, these studies indicate that, both in vivo and in vitro, the HEV lifecycle may be influenced by the level of polarisation and differentiation of hepatocytes.

Therefore, we investigated the ability of two HEV permissive hepatoma cell lines, PLC-PRF-5 and Huh-7.5 cells, to polarise and differentiate, and investigated whether differentiated cell lines supported enhanced HEV infection. We determined the ability of these cells to form simple, epithelial-like polarity, or complex polarity similar to that observed in hepatocytes in vivo. Structural polarity was determined through the localisation of tight junction proteins, occludin and zona occludin-1 (ZO-1), to apical membranes or bile-canalicular like structures within cells. Functional polarisation and hepatocyte differentiation was assessed by evaluating the formation of intact bile canaliculi-like structures that retained a fluorescent molecule, 5(6)-Carboxyfluorescein diacetate (CFDA) and albumin secretion, respectively. Finally, using a panel of clinical and field isolates of HEV genotype 3, we assessed the ability of HEV to infect and replicate in polarised and non-polarised hepatoma cells.

Results

Hepatoma cells functionally polarise and differentiate

Hepatocytes within the liver develop unique polarity, with distinct apical and basolateral membranes located at bile canaliculi and adjacent to fenestrated endothelium, respectively (Fig. 1A). Culture of PLC-PRF-5 cells on cell culture treated plastic dishes for 21 days (‘polarised PLC-PRF-5 cells’) resulted in two distinct cell populations displaying different morphologies. Stratified cell clusters were observed covering approximately 30% of the culture area (Fig. 1B, area 1, red). The remaining areas consisted of a cell monolayer (Fig. 1B, area 2). In Huh-7.5 cultures cultured in the presence of 1% DMSO for 10 days (‘polarised Huh-7.5 cells’), approximately 75% of the culture consisted of multi-layered cells, in which cells were tightly packed and consisted of two or more layers of cells (Fig. 1B, area 1) while the remaining area was comprised of a cell monolayer without multiple layers (Fig. 1B, area 2).

Fig. 1.

Fig. 1

Open in a new tab

Polarised hepatoma cells develop distinct structure and morphology. (A) Schematic showing the arrangement of hepatocytes within a liver lobule, highlighting the location of distinct apical and basolateral membranes. (B) PLC-PRF-5 cells and Huh-7.5 cells were plated and polarised over 21 days and 10 days, respectively, and representative images of cellular morphology before and after polarisation were taken. Scale bar represents 100 μm. Cells displaying distinct morphologies within the same field of view are highlighted for PLC-PRF-5 (red) and Huh-7.5 (green) cells. Area 1 represents stratified cell layers, area 2 represents cell monolayers.

To assess functional membrane integrity, 5(6)-Carboxyfluorescein diacetate (CFDA) (21879-25MG-F, Sigma-Aldrich, USA) was utilised. CFDA permeates hepatocytes and is hydrolysed by intracellular esterases to carboxyfluorescein, a fluorescent molecule, which is subsequently excreted via the apical membrane by multidrug-resistant protein 2 (MRP2) into bile canaliculi. Retention of carboxyfluorescein serves as an indicator of membrane functionality37. Areas of fluorescence, indicating functionally intact bile canalicular-like structures capable of retaining 5(6)-Carboxyfluorescein diacetate (CFDA), were not observed in polarised PLC-PRF-5 cells following incubation with CFDA (Fig. 2A). In contrast, multiple areas of CFDA retention were visible within the stratified cell layers, but not adjacent monolayers, of polarised Huh-7.5 cells and these areas corresponded with discrete, circular or oval areas morphologically consistent with bile canalicular-like structures in brightfield images of the same areas (white arrows).

Fig. 2.

Fig. 2

Open in a new tab

Hepatoma cells develop functional polarisation and differentiation. (A) Polarised PLC-PRF-5 and Huh-7.5 cultures were treated with CFDA for 30 min and bile canalicular like structures visualised (white arrows). Scale bar represents 100 μm. (B) Supernatant albumin content was quantified in non-polarised and polarised PLC-PRF-5 (B) and Huh-7.5 (C) cells. Data was normalised to cellular GAPDH and presented as mean ± standard deviation (SD) of triplicate samples.

PLC-PRF-5 cells demonstrated a significant increase in the expression of hepatocyte marker albumin between non-polarised (seeded 24 h prior to experimentation) and polarised cells (Fig. 2B), gradually increasing over the time course (Supplementary Fig. 1A). No difference in albumin secretion was observed in polarised vs. non-polarised (seeded 24 h prior to experimentation or cultured for 10 days in the absence of DMSO and albumin levels adjusted for cell number) Huh-7.5 cells (Fig. 2C, Supplementary Fig. 1B).

Hepatoma cell lines form structural polarity

The development of structural polarity over time was determined by the localisation of tight junction protein occludin and tight junction scaffolding protein ZO-1. In non-polarised PLC-PRF-5 cell monolayers, occludin and ZO-1 were not expressed in non-polarised cells. The accumulation of occludin and ZO-1 at intercellular junctions was first observed 7 days post-seeding and was subjectively increased by day 14 in polarized PLC-PRF-5 cells (Fig. 3A and Supplementary Fig. 2). By 3 weeks post-seeding, occludin and ZO-1 were distinctly localised to intercellular junctions displaying a honeycomb-like distribution in PLC-PRF-5 cells (Fig. 3A and Supplementary Fig. 2).

Fig. 3.

Fig. 3

Open in a new tab

Polarised hepatoma cells express tight junction proteins. (A) PLC-PRF-5 cells and (B) Huh-7.5 cells were plated and polarised for 21 days and 10 days, respectively. Tight junction proteins zona-occludin 1 (ZO-1) and occludin were fluorescently labelled (orange) and visualised in non-polarised cells and over the course of polarisation. Sphere-like structures formed by Huh-7.5 cells are indicated by a white dotted circle in day 10 images. Scale bars represent 100 μm.

In non-polarised Huh-7.5 cells, occludin and ZO-1 were observed at intercellular junctions in areas containing cellular monolayers, with sparse expression throughout the stratified cell layers in non-polarised cells. The reorganisation of Huh-7.5 cells within stratified cell layers into sphere-like groupings was observed (Fig. 3B and supplementary Fig. 3) between 5 and 7 days post-seeding. This coincided with increased accumulation of occludin and ZO-1 within these areas. By day 10, occludin and ZO-1 were predominantly restricted to a shared internal membrane within Huh-7.5 cell sphere-like structures (Fig. 3B and supplementary Fig. 3). Comparatively, in control cells which are non-polarised and not treated with DMSO, the localisation of ZO-1 and occludin into a honeycomb-like arrangement indicates the development of simple polarity only, over a 10-day time course (Supplementary Fig. 4A).

HEV replication is increased in polarised hepatoma cells

Non-polarised PLC-PRF-5 cells, inoculated with human HEV isolate 14-1675322, exhibited a gradual increase (+ 2 log) in normalised intracellular viral genome copies between 3 and 9 days post infection (dpi) (Fig. 4A). Comparatively, polarised PLC-PRF-5 cells, infected 21 days post-seeding, contained 2-log higher viral genome copies by 1 dpi which remained consistent up to 10 dpi (Fig. 4A). Co-staining of HEV ORF2 with tight junction protein ZO-1 in polarised PLC-PRF-5 cells illustrated HEV infection of polarised PLC-PRF-5 cells (Fig. 4B).

Fig. 4.

Fig. 4

Open in a new tab

Polarised PLC-PRF-5 cells support enhanced HEV infection. (A) Polarised (black bars) and non-polarised (grey bars) PLC-PRF-5 cells were infected with HEV subtype 3c strain 14-16753 and HEV RNA in cell lysate was quantified by RT-qPCR and normalised to cellular GAPDH. Data presented as mean ± SD (n = 3 independent experiments). (B) Confocal images of HEV infected polarise PLC-PRF-5 cells show tight junction protein ZO-1 (orange) and HEV ORF2 (magenta. Scale bar represents 10 μm. (C) Polarised PLC-PRF-5 cells were infected in the presence or absence of 50ng/ml TNF-α and 50ng/ml IL-1β, non-polarised cells served as a control. At 4 days post infection HEV RNA in cell lysate was quantified by RT-qPCR and normalised to cellular GAPDH. Data presented as mean ± SD (n = 3). (D) To confirm the release of replication competent virions, supernatant from infected polarised PLC-PRF-5 cells at 6 days post infection was quantified (1.86 × 105 HEV RNA copies/µl) and used to inoculate polarised Huh-7.5 cells. Ribavirin (RIB) at 100µM was used to discern viral replication from residual inoculum. Intracellular HEV RNA was quantified, data normalised to cellular GAPDH and presented as mean ± SD of triplicate samples. p-values are indicated. ns = not significant.

The supernatant of HEV infected polarised PLC-PRF-5 cells (1.86 × 105 HEV RNA copies/µl) was used to inoculate naïve polarised Huh-7.5 cells to confirm the presence of replication competent HEV virions. A significant increase in intracellular viral genome copies was detected post infection, which was inhibited by 100µM ribavirin (Fig. 4D) confirming the presence of infectious viral particles in the supernatant. No cytotoxicity was observed when cells were treated with 100µM ribavirin (supplementary Fig. 5A,B).

Non-polarised Huh-7.5 cells, cultured in the absence of DMSO, sustained a low level of intracellular HEV genome copies up to 10 dpi. In contrast, in polarised Huh-7.5 cells, HEV genome copy number significantly increased from 3dpi, and at all timepoints up to 10 dpi (Fig. 5A). Co-staining of HEV ORF2 with tight junction protein ZO-1 in polarised Huh-7.5 cells (Fig. 5B) illustrated varying distribution patterns of HEV ORF2 within infected cells. The supernatant from HEV infected polarised Huh-7.5 (9.50 × 104 HEV RNA copies/µl) cells was used to inoculate naïve polarised Huh-7.5 cells to confirm the presence of replication competent HEV virions. Similar to PLC-PRF-5 cells, a significant increase in intracellular HEV was detected in Huh-7.5 cells which was inhibited by 100µM ribavirin (Fig. 5D).

Fig. 5.

Fig. 5

Open in a new tab

Huh-7.5 cells displaying complex polarity support enhanced HEV infection. (A) Polarised (black bars) and non-polarised (grey bars) Huh-7.5 cells were infected with HEV subtype 3c strain 14-16753, HEV RNA in cell lysate was quantified by RT-qPCR and normalised to cellular GAPDH. Data presented as mean ± SD (n = 3 independent experiments). (B) Confocal image of HEV infected polarised Huh-7.5 cells showing tight junction protein ZO-1 (orange) and HEV ORF2 (magenta). Scale bar represents 10 μm. (C) Polarised Huh-7.5 cells were infected in the presence or absence of 50ng/ml TNF-α and 50ng/ml IL-1β, non-polarised cells served as a control. At 4 days post infection HEV RNA in cell lysate was quantified by RT-qPCR and normalised to cellular GAPDH. Data presented as mean ± SD (n = 3). (D) To confirm the release of replication competent virions, supernatant from infected polarised Huh-7.5 cells at 6 days post infection was quantified (9.50 × 104 HEV RNA copies/µl) and used to inoculate polarised Huh-7.5 cells. Ribavirin (RIB) at 100µM was used to discern viral replication from residual inoculum. Intracellular HEV RNA was quantified, data normalised to cellular GAPDH and presented as mean ± SD of triplicate samples. p-values are indicated. Data presented for days 1 and 2 post infection were not significantly different.

To investigate the effect of disrupting cellular tight junctions on HEV infection, polarised PLC-PRF-5 or Huh-7.5 cells were infected in the presence or absence of inflammatory cytokines, TNF-α and IL-1β, which have previously been demonstrated to disrupt hepatoma cell polarity38,39. Non-polarised cells served as a control. No change was observed in intracellular HEV viral genome copies of cytokine treated vs. untreated PLC-PRF-5 cells (Fig. 4C). In contrast, a significant decrease in intracellular HEV was detected in polarised Huh-7.5 cells treated with 50ng/ml TNF-α and 50ng/ml IL-1β, compared to untreated, polarised Huh-7.5 cells (Fig. 5C).

HEV ORF2 expression is increased in polarised hepatoma cells

HEV ORF2 positive cells were quantified over the time course of infection in both non-polarised and polarised PLC-PRF-5 and Huh-7.5 cells (Fig. 6). In non-polarised PLC-PRF-5 cells, 1.2% of cells were ORF2 positive at 1 dpi, which increased to 6.7% by 7 dpi. Comparatively, in polarised PLC-PRF-5 cells, 16.7% and 26.1% of cells were ORF2 positive at 1 and 7 dpi, respectively (Fig. 6A and C). At every timepoint there were significantly more ORF2 positive cells in polarised vs. non-polarised PLC-PRF-5 cultures, with an overall average increase of 19.21% ± 4.48 (mean ± standard error [SE]).

Fig. 6.

Fig. 6

Open in a new tab

Polarised hepatoma cells support a spreading HEV infection. Polarised and non-polarised (A) PLC-PRF-5 and (B) Huh-7.5 cells were infected with HEV subtype 3c strain 14-16753. Infected cells were fluorescently labelled for HEV ORF2 (magenta). Representative images of each timepoint were taken. HEV ORF2 positive cells in non-polarised (grey bars) and polarised (black bars) cultures were enumerated in (C) PLC-PRF-5 cells and (D) Huh-7.5 cells and are presented as the percent of total cells of 5 image counts. Error bars represent mean ± SD. p-values are indicated. ns = not significant.

In non-polarised Huh-7.5 cells, 1.3% and 4.75% of cells were ORF2 positive at 1 and 7 dpi, respectively. In comparison, 2.8% and 17.7% of polarised Huh-7.5 cells were positive at 1 and 7 dpi, respectively (Fig. 6B and D). Polarised Huh-7.5 cells consistently had a significantly higher percentage of ORF2 positive cells compared with their non-polarised counterparts, with an average increase of 9.01% ± 3.39 (SE).

A panel of human clinical HEV isolates infect polarised hepatoma cells

Polarised PLC-PRF-5 cells were infected with HEV isolates P30, P2640 and C1741, from three serum samples collected from patients during acute HEV infection. Low levels of HEV RNA were detected post-infection for all three isolates, indicative of viral replication. Ribavirin (100µM) treatment was associated with a significant reduction of HEV RNA following infection with P30 and P26, confirming viral replication (Fig. 7A). HEV ORF2 protein was visualised in cells infected with all experimental isolates by immunofluorescence, confirming infection (Fig. 7C). A variety of ORF2 localisation patterns, resembling both small punctate and broad cytoplasmic staining, were observed in infected cultures. To confirm HEV replication, double stranded RNA (dsRNA) antibody was observed in cells inoculated with all isolates (Fig. 7C). Human clinical isolates 15-22016, 14-2270722 and serum isolate C17 were used to infect polarised Huh-7.5 cultures (Fig. 7B). Similar to PLC-PRF-5 cells, the three HEV strains successfully infected and replicated in the polarized Huh-7.5 cells, and their replication was inhibited by 100µM ribavirin. Multiple staining patterns were observed within cell populations infected with a single HEV isolate, suggesting heterogeneity in infection stages. However, both HEV ORF2 and dsRNA were visualised in infected cultures (Fig. 7C) demonstrating viral infection and replication of all isolates in polarised hepatoma cells.

Fig. 7.

Fig. 7

Open in a new tab

Diverse HEV clinical isolates infect polarised hepatoma cells. Polarised (A) PLC-PRF-5 cells and (B) Huh-7.5 cells were infected with HEV human clinical isolates P30 (3.39 × 103 HEV RNA copies/µl), P26 (9.22 × 103 HEV RNA copies/µl), C17 (9.55 × 103 HEV RNA copies/µl), 15-22016 (3.89 × 104 HEV RNA copies/µl) and 14-22707 (5.53 × 104 HEV RNA copies/µl). HEV RNA in cell lysate at day 6 was quantified by RT-qPCR. Ribavirin (RIB) at 100µM was used to differentiate viral replication from residual inoculum. Data was normalised to cellular GAPDH and presented as mean ± SD of triplicate samples. p-values are indicated. ns = not significant. (C) Representative confocal images of infected cells fluorescently labelled for HEV ORF2 (magenta) dsRNA (yellow) and DAPI (cyan) were taken, scale bar represents 20 μm.

Discussion

In this study, we have demonstrated enhanced HEV infection and replication, using clinical isolates of HEV gt3, in two polarised hepatoma cell lines. Frequently utilised in vitro liver models often fail to faithfully recapitulate the complex physiology of hepatocytes26 and do not support the propagation of HEV clinical isolates. Hepatocytes possess a unique multipolar organisation and complex polarity where tight junctions are located at hepatocyte bile canaliculi, shared by multiple cells, supporting the intricate multidirectional trafficking and signalling carried out by these cells24,42. This differs from the simple, columnar polarity typically observed in epithelial cells, where each cell has just two spatial poles, apical and basolateral43. In this study, we demonstrate that two widely used hepatoma cell lines, PLC-PRF-5 and Huh-7.5 cells, can develop simple and complex polarity, respectively, without the use of porous filters, extra-cellular matrix or other 3D culture methods such as hanging drops or non-adherent culture techniques44,45. Improved HEV infection and replication in these models highlights the potential role of hepatocyte differentiation and polarity in the HEV lifecycle.

While the exact mechanism by which HEV infection is increased in these hepatoma models remains unclear, studies of other hepatotropic viruses have demonstrated that receptor localisation and availability play a key role in viral entry. Hepatotropic viruses, including hepatitis A virus (HAV), hepatitis B virus (HBV) and hepatitis C virus (HCV), encounter hepatocytes via the basolateral membrane of highly polarised hepatocytes and viral attachment and entry occurs via engagement with receptors located at the basolateral membrane or with tight junction proteins, as in the case of HCV15,46. Therefore, hepatocyte polarity plays an important role in infection with these diverse hepatotropic viruses. While the entry pathway for HEV has yet to be fully elucidated, prospective entry factors include heparan sulfate proteoglycans47,48, asialoglycoprotein receptor49, integrin alpha-350 and epidermal growth factor receptor51. Importantly, epidermal growth factor receptor and asialoglycoprotein receptor are primarily restricted to the basolateral membrane of polarised cells52,53. Future studies could determine which regions of the cell membrane is initially exposed to HEV, which would further our understanding of early HEV interactions with the basolateral membrane and the role of tight junction constituents in viral attachment and entry.

In this study, we have demonstrated that polarity, a key feature of hepatocytes in vivo25,54 can be recapitulated in hepatoma cell lines and that these models support HEV infection with clinical isolates. These polarised hepatoma models provide an accessible culture system that is relatively simple to implement, robust and highly reproducible and commercially available15,55,56. The presence of intercellular tight junctions indicates the development of distinct polarised membrane domains57,58. To date, HepG2/C3A cells cultured on porous filters (e.g. Transwell filters) have been used as polarised hepatoma models for HEV research33–35. We investigated DMSO treatment of HepG2/C3A cells in a simple culture model and did not observe bile canaliculi-like structures or enhancement of HEV infection, in contrast to our observations with Huh-7.5 cells (data not shown).

When culturing HEV clinical samples in PLC-PRF-5 cells, viral replication is often delayed, in some cases up to 14 dpi17,59–62 and HEV RNA levels are often low63 or undetectable16,64, posing challenges for studying HEV in this models. We report similar findings in the present study with non-polarised PLC-PRF-5 cells. The lag in HEV RNA detection may be due to the delayed but eventual development of polarity in PLC-PRF-5 cells cultured for extended periods of time, relocation of entry receptors to the cell membrane which facilitates HEV infection or another mechanism associated with differentiation of these cells. It has been reported that culturing PLC-PRF-5 cells for 14 days prior to infection resulted in higher amounts of HEV RNA at earlier timepoints22. Compared to a previous study using the same HEV isolate as the present study, we observed that HEV replicated to higher levels in polarised PLC-PRF-5 cells in a shorter timeframe (by 5 days post infection), indicating that polarisation may facilitate HEV replication in this model22.

Inflammatory cytokines, such as TNF-α and IL-1β, have previously been shown to disrupt tight junctions and depolarise hepatoma cells38,39. TNF-α and IL-1β treatment of polarised PLC-PRF-5 cells did not reduce HEV infection, in contrast to the decreased HEV infection observed in polarised Huh-7.5 cells, which developed complex, hepatocyte-like polarity and supported high levels of HEV replication. This dynamic reorganisation into sphere-like structures was absent in control cells which were not treated with DMSO and exhibited simple, epithelial-like, polarity, characterised by a honeycomb-like arrangement of tight junction proteins over the same time period. Previous studies have identified that TNF superfamily members and IL-1β promote hepatitis C virus infection of polarised hepatoma cells through NF-kB and myosin light chain kinase activation38,39. Future studies to understand the mechanisms HEV infection of polarised hepatoma models will help determine the role of hepatocyte polarity in HEV infection.

Polarised PLC-PRF-5 cells secreted significantly increased levels of albumin by 21 days post seeding compared to non-polarised cells. The constitutive synthesis of the plasma protein albumin is one of the most frequently assessed markers of hepatocyte functionality and differentiation24,65,66. Collectively, these data indicate that the polarised PLC-PRF-5 cells described in the present study possess characteristics typically associated with a phenotype that more closely recapitulates differentiated hepatocytes, in addition to the formation of simple structural polarity, and that these features may contribute to increased HEV replication in this model.

In Huh-7.5 cells, supplementation of culture media with 1% DMSO resulted in features consistent with hepatocyte polarisation. DMSO has previously been used to initiate differentiation in both primary and immortalised hepatocytes67–72. The exact mechanism by which DMSO induces differentiation is still unknown, however in hepatoma cell lines DMSO treatment has been shown to alter both lipid and glucose metabolism69,73, as well as increase drug metabolising enzyme activity74. DMSO treated Huh-7 cells, the parental cell line of Huh-7.5 cells, exhibit increased expression of albumin, transthyretin, hepatocyte nuclear factor 4 alpha, and α1-antitrypsin, all markers of a differentiated hepatocyte phenotype74. Interestingly, in the present study, albumin secretion from Huh-7.5 cells remained unchanged regardless of polarisation and was consistently increased compared to PLC-PRF-5 cells. While the reason for the differences in albumin secretion from these cell lines is unclear, they originate from different patients and are derived from cells that have undergone neoplastic transformation, so may not have retained all of the features of normal hepatocytes. The parental cell line Huh-7 expresses the albumin gene at levels resembling primary hepatocytes75, however, longitudinal protein albumin secretion data for Huh-7 or Huh-7.5 cells is lacking. Therefore, multiple factors associated with DMSO treatment may contribute to the increased HEV infection observed in the present study.

The viral isolates used in this study, were derived from serum which predominantly contains eHEV, or isolated from the faeces of patients with clinical HEV infections, and therefore contain nHEV particles76. Serum and cell culture derived eHEV is less infectious than nHEV which typically infects new hosts via the oral route48,77. Regardless of the route of infection, HEV is likely to first encounter hepatocytes via the basolateral side, but the exact mechanisms by which these viruses enter and infect hepatocytes is unclear15,23. Using both eHEV and nHEV isolates, we observed viral replication in both polarised systems, demonstrating the utility of our culture models for studying infection of both forms of HEV.

In conclusion, this study describes two hepatoma models that develop polarity and support enhanced HEV infection in vitro. These model systems will be valuable tools for robust infection studies using clinical HEV isolates. Furthermore, these models will facilitate studies to advance our understanding of this emerging zoonotic pathogen, and develop antiviral strategies and new therapeutics.

Methods

Cell lines

PLC-PRF-5 cells were obtained from the American Type Culture Collection (CRL-8024, ATCC, USA) and Huh-7.5 cells were provided by Prof Charles Rice (Rockefeller University, New York, USA). Cells were initially cultured in maintenance media, Dulbecco’s Modified Eagle’s medium (DMEM) with Glutamax (31966-021, Gibco, Thermo Fisher Scientific, USA), supplemented with 10% foetal bovine serum (FBS) (10082-147, Gibco, Thermo Fisher Scientific, USA) and 1% non-essential ammino acids (NEAA) (11140050, Gibco, Thermo Fisher Scientific, USA) at 37 °C and 5% CO2.

Polarisation of PLC-PRF-5 cells

PLC-PRF-5 cells were seeded at 1 × 105 cells/cm2 on 48 well tissue culture treated plates (3548, Corning, USA) and Thermanox coverslips (150067, Thermo Fisher Scientific, USA). Cells were continually propagated for 21 days, with media refreshed three times a week. No additional supplements were added to the culture media. Non-polarised control cells were seeded 24 h prior to experimentation and were cultured in maintenance media.

Polarisation of Huh-7.5 cells

Huh-7.5 cells were seeded at 1 × 105 cells/cm2 on 48-well tissue culture treated plates (3548, Corning, USA) and Thermanox coverslips (150067, Thermo Fisher Scientific, USA). Once the cells reached confluency, cellular polarisation was initiated by supplementing media with 1% Hybri-Max dimethyl sulfoxide (DMSO) (D2650, Sigma Aldrich, USA) and the cells were propagated for a further 10 days. DMSO supplemented media was refreshed three times a week. Cells seeded 24 h prior to experimentation acted as non-polarised controls and were cultured in maintenance media (Supplementary Fig. 2).

Determination of tight junction barrier function

Cell culture media was removed from wells, 0.5µM CFDA was added and plates incubated at 37 °C for 30 min, as previously described78. The CFDA was removed and each well was washed five times with phosphate buffered saline (PBS). Carboxyfluorescein retention capacity of the cells was visualised and imaged at a wavelength of 517 nm, using an inverted fluorescence microscope (GXM-XDS400, GT vision, U.K.).

Quantification of cellular albumin production

Cell culture supernatants were collected, in triplicate, and centrifuged at 1500 rpm for 10 min. Samples were stored at -20 °C until assayed. Culture supernatants were diluted 1:10 for PLC-PRF-5 cells and 1:250 for Huh-7.5 cells in maintenance media, based on previously optimised ranges for these cell lines to ensure values within the assay range were obtained. Albumin production was quantified using a human albumin ELISA kit (ab108788, Abcam, U.K.) according to the kit protocol. Briefly, diluted samples and the albumin standard curve samples were incubated on the plate, in duplicate, for 1 h. All incubation steps were carried out at room temperature. The plates were washed, albumin antibody added and incubated for 30 min. Following a further wash, conjugate was added and incubated for 30 min. A final wash was carried out and a chromogen substrate added and incubated for 25 min. The reaction was quenched by the addition of stop solution and the plate read on a plate reader at 450 nm (BioTek Epoch, Agilent, USA). Duplicate readings were averaged and the standard curve plotted with a line of best fit. Sample results were interpolated from the standard curve and multiplied by the initial dilution factor.

Corresponding cell lysates were collected for each sample and RNA extracted using an RNeasy mini kit (74106, Qiagen, Germany) using the spin procedure. Eluted RNA was quantified using a Nanodrop One (Thermo Fisher Scientific, USA), and all samples adjusted to 20ng/µl. RT-qPCR for the house keeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was carried out on RNA samples as an internal endogenous control. The primers and probe used were as follows; Forward: 5’ GGTGAAGGTCGGAGTCAACG 3’, Reverse: 5’ CTTCCCGTTCTCAGCCATGTAG 3’, Probe: 5’-HEX-TGCCATCAATGACCCCTTCA-BHQ1-3’. Cell supernatant albumin quantity was normalised to each sample’s associated cellular GAPDH.

Immunofluorescent staining and microscopy

Primary antibodies were mouse IgG1 anti-occludin at 2 µg/ml (33-1500, Invitrogen, USA), mouse IgG1 anti-zona-occludin 1 at 2 µg/ml (33-9100, Invitrogen, USA), mouse IgG2b anti-HEV ORF2 at 4 µg/ml (MAB8002, Sigma-Aldrich, USA) and mouse IgG2a anti-dsRNA monoclonal antibody K1 at 0.5 µg/ml (10020500, Scicons, The Netherlands). Secondary antibodies were Alexa-488 conjugated goat anti-mouse IgG2b at 1 µg/ml (A21121, Invitrogen, USA), Alexa-594 conjugated goat anti-mouse IgG2a at 1 µg/ml (A21135, Invitrogen, USA) and Alexa-633 conjugated goat anti-mouse IgG1 at 1 µg/ml (A21126, Invitrogen, USA).

Cells grown on Thermanox coverslips were fixed in ice-cold methanol for 20 min at 4 °C. All subsequent incubation steps were at room temperature. Cells were permeabilised for 30 min using 0.5% Triton X (T9284, Sigma-Aldrich, USA) followed by a 30 min incubation with a 0.5% bovine serum albumin (BSA) (A9418, Sigma-Aldrich, USA) blocking solution. Primary antibodies were applied for 1 h then wells were washed three times with blocking solution. Secondary antibodies were applied for 30 min and incubated in the dark. Wells were washed three times with blocking solution, counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 20 s, and washed three times with distilled water. Coverslips were mounted onto glass slides using ProLong Gold Antifade Mountant (P36930, Invitrogen, USA) and a glass coverslip applied. Images were captured using a Zeiss Axio Imager Epifluorescent microscope or a Zeiss Axio Observer 7 (Zeiss Group, Germany). Confocal data were collected as z-stacks, deconvolved and maximum intensity projected.

HEV infection assays

Clinical HEV isolates; subtype 3c strain 14-16753 at 8.45 × 104 HEV RNA copies/µl (GenBank accession number MK089849), subtype 3e strain 14-22707 at 5.53 × 104 HEV RNA copies/µl (GenBank accession number MK089848) and subtype 3f-like strain 15-22016 at 3.89 × 104 HEV RNA copies/µl (GenBank accession number MK089847), were obtained following viral propagation in cell culture22. Clarified faeces samples from patients with HEV infection were sterile filtered and stored at -80 °C. These samples were subtype 3c P30 at 3.39 × 103 HEV RNA copies/µl (collected 1 week post-infection (wpi)), subtype 3f P26 at 9.22 × 103 HEV RNA copies/µl (collected 1 wpi, GenBank accession number SAMN29886218)40 and subtype 3l C17 at 9.55 × 103 HEV RNA copies/µl (collected 27 wpi, paired serum isolate GenBank accession number SAMN22864821)41.

Polarised and non-polarised cells were inoculated with 100 µl of each HEV isolate and incubated for approximately 16 h at 37 °C. Cells were washed five times with PBS, the final wash step was collected and culture media replaced. HEV RT-qPCR was carried out on each final wash to confirm removal of residual HEV inoculum (data not shown). Culture medium was changed daily. Ribavirin (R9644, Sigma-Aldrich, USA; 100µM) was used as a positive antiviral control, added at the same time as the viral inoculum and maintained in the culture throughout the experiment. Cell viability following ribavirin treatment was measured using the CellTiter 96 AQueous One Solution Cell Proliferation MTS Assay (G3582, Promega, USA) according to the manufacturer’s instructions. Cell lysates of subtype 3c strain 14-16753 were collected every 24 h for 10 days to determine viral replication kinetics. Cell lysates of subsequent clinical samples were collected at 6 dpi. RNA was extracted using the RNeasy mini kit (74106, Qiagen, Germany) using the spin procedure. Eluted RNA was quantified using a Nanodrop One (ThermoFisher Scientific, USA), and all samples adjusted to a concentration of 20ng/µl total RNA.

The same concentration of HEV (calculated in RNA copies/µl) was used for both polarised and non-polarised infection experiments, and for both cell lines. While the cell number between polarised and non-polarised cultures was likely not identical at the time of infection, this was accounted for by normalising the HEV RNA copy number to the housekeeping gene GAPDH. We initially validated GAPDH as a stable housekeeping gene for normalising HEV RNA in infected cells, showing no significant variation in expression across experimental conditions, including HEV infection, extended time points, or ribavirin treatment.

Disruption of polarised cell tight junctions

Polarised cells were incubated with 50ng/ml recombinant human TNF-α (300–01 A, Thermo Fisher Scientific, USA) and 50ng/ml IL-1β (200-01B, Thermo Fisher Scientific, USA), at 37 °C for 1 h, to disrupt tight junction integrity. Cell viability and tight junction disruption following cytokine treatment had been confirmed previously38. Treated, untreated and non-polarised control cells were inoculated with clinical HEV isolate; subtype 3c strain 14-16753 at 8.45 × 104 HEV RNA copies/µl and incubated at 37 °C for approximately 5 h. Cells were washed five times with PBS, the final wash step was collected and culture media replaced. Cell lysates were collected at 6 dpi and RNA extracted and processed as described (Section “Hepatitis E virus RT-qPCR”).

Hepatitis E virus RT-qPCR

The hepatitis E virus Genesig Standard Kit (Path-HEV-standard, Primerdesign, U.K.) with TaqMan Fast Virus 1-Step Master Mix (4444434, Applied Biosystems, USA) was used according to the manufacturer’s instructions to quantify HEV RNA copies/µl in cell lysates and in cell culture medium from each experiment. For cell lysates, RNA was extracted using an RNeasy mini kit (52904, Qiagen, Germany), and RNA was eluted into 50 µl of buffer according to the manufacturer’s instructions. RNA concentration was adjusted to 20ng/µl total RNA. Supernatant samples were extracted using a QIAAmp Viral RNA mini kit (74106, Qiagen, Germany), using 200ul cell culture supernatant from each well, and also adjusted to 20ng/µl total RNA. RT-qPCR was performed using an ABI7500 Real-Time PCR machine (Thermo Fisher Scientific, USA). GAPDH RT-qPCR was carried out as described in “Quantification of cellular albumin production” section.

To normalise HEV RNA expression levels, GAPDH Ct values were transformed into relative quantities using the standard curve equation:

graphic file with name M1.gif

where EGAPDH ​ represents the amplification efficiency of the GAPDH assay. The HEV RNA copy number was then normalised against this calculated relative GAPDH quantity to account for variations in RNA input and amplification efficiency: Normalised HEV Expression = HEV Copy Number​ / Relative GAPDH Quantity. Non-normalised data is presented in Supplementary Fig. 6.

Statistical analysis

Statistical analyses were performed using one way ANOVA or unpaired t-test in GraphPad Prism v9 (GraphPad Software, USA). The p-value threshold was set at < 0.05 and corrected for multiple comparisons using the Holm-Šídák method.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1. (1.2MB, pdf)

Acknowledgements

The authors wish to acknowledge the University College Dublin Veterinary Medicine Containment Level 3 Laboratory and its managers for facilitating this study.

Abbreviations

ATCC

American type culture collection

BSA

Bovine serum albumin

CFDA

5(6)-Carboxyfluorescein diacetate

DAPI

4′,6-Diamidino-2-phenylindole

dpi

Days post infection

DMEM

Dulbecco’s modified Eagle’s medium

DMSO

Dimethyl sulfoxide

FBS

Foetal bovine serum

eHEV

Quasi-enveloped hepatitis E virus

GAPDH

Glyceraldehyde 3-phosphate dehydrogenase

HAV

Hepatitis A virus

HBV

Hepatitis B virus

HCV

Hepatitis C virus

HEV

Hepatitis E virus

MRP2

Multidrug resistant protein 2

nHEV

Non-enveloped hepatitis E virus

NEAA

Non-essential amino acids

PBS

Phosphate buffered saline

RIB

Ribavirin

SE

Standard error

wpi

Weeks post infection

ZO-1

Zona occludin 1

Author contributions

Conceptualization: H.M.B., N.F.F. Methodology: H.M.B., N.F.F. Investigation: H.M.B. Resources: J.M., N.L.J., D.B., N.F.F. Supervision: N.F.F. Writing, review and editing: H.M.B., J.M., N.L.J., D.B., N.F.F.

Funding

This work was supported by a University College Dublin Ad Astra studentship (R20554), Science Foundation Ireland Frontiers for the Future 2020 award (20/FFP-P/8659) and an Academy of Medical Sciences Starting grant for Clinical Lecturers (SGL021\1051). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Data availability

Data is provided within the manuscript or supplementary information files.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Izopet, J. et al. Hepatitis E virus infections in Europe. J. Clin. Virol.120, 20–26. 10.1016/j.jcv.2019.09.004 (2019). [DOI] [PubMed] [Google Scholar]
  • 2.WHO. Global Hepatitis Report. Report No. 978-92-4-156545-5 (Geneva, 2017).
  • 3.Aslan, A. T., Balaban, H. Y. & Hepatitis, E. virus: Epidemiology, diagnosis, clinical manifestations, and treatment. World J Gastroenterol 26, 5543–5560, (2020). 10.3748/wjg.v26.i37.5543 [DOI] [PMC free article] [PubMed]
  • 4.Purdy, M. A. et al. ICTV virus taxonomy profile: hepeviridae 2022. J. Gen. Virol.10310.1099/jgv.0.001778 (2022). [DOI] [PMC free article] [PubMed]
  • 5.EFSA, E. F. S. A. et al. Public health risks associated with hepatitis E virus (HEV) as a food-borne pathogen. EFSA J.15, e04886. 10.2903/j.efsa.2017.4886 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Berto, A., Martelli, F., Grierson, S. & Banks, M. Hepatitis E virus in pork food chain, united Kingdom, 2009–2010. Emerg. Infect. Dis.18, 1358–1360. 10.3201/eid1808.111647 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.O’Connor, M., Roche, S. J. & Sammin, D. Seroprevalence of hepatitis E virus infection in the Irish pig population. Ir. Vet. J.68, 8. 10.1186/s13620-015-0036-3 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Rose, N. et al. High prevalence of hepatitis E virus in French domestic pigs. Comp. Immunol. Microbiol. Infect. Dis.34, 419–427. 10.1016/j.cimid.2011.07.003 (2011). [DOI] [PubMed] [Google Scholar]
  • 9.Chelli, E. et al. Hepatitis E virus occurrence in pigs slaughtered in Italy. Anim. (Basel)1110.3390/ani11020277 (2021). [DOI] [PMC free article] [PubMed]
  • 10.Schlosser, J. et al. Natural and experimental hepatitis E virus genotype 3-infection in European wild Boar is transmissible to domestic pigs. Vet. Res.45, 121. 10.1186/s13567-014-0121-8 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Rivero-Juarez, A. et al. Familial hepatitis E outbreak linked to wild Boar meat consumption. Zoonoses Public. Health64, 561–565. 10.1111/zph.12343 (2017). [DOI] [PubMed] [Google Scholar]
  • 12.Boxman, I. L. A. et al. Monitoring of pork liver and meat products on the Dutch market for the presence of HEV RNA. Int. J. Food Microbiol.296, 58–64. 10.1016/j.ijfoodmicro.2019.02.018 (2019). [DOI] [PubMed] [Google Scholar]
  • 13.Wielick, C. et al. A randomized large-scale cross-sectional serological survey of hepatitis E Virus infection in Belgian pig farms. Microorganisms 11, (2023). 10.3390/microorganisms11010129 [DOI] [PMC free article] [PubMed]
  • 14.Palombieri, A. et al. A molecular study on hepatitis E virus (HEV) in pigs in Bulgaria. Vet. Sci.810.3390/vetsci8110267 (2021). [DOI] [PMC free article] [PubMed]
  • 15.Fu, R. M., Decker, C. C. & Dao Thi, V. L. Cell culture models for hepatitis E virus. Viruses1110.3390/v11070608 (2019). [DOI] [PMC free article] [PubMed]
  • 16.Shukla, P. et al. Cross-species infections of cultured cells by hepatitis E virus and discovery of an infectious virus-host recombinant. Proc. Natl. Acad. Sci. U S A108, 2438–2443. 10.1073/pnas.1018878108 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lorenzo, F. R. et al. Mutational events during the primary propagation and consecutive passages of hepatitis E virus strain JE03-1760F in cell culture. Virus Res.137, 86–96. 10.1016/j.virusres.2008.06.005 (2008). [DOI] [PubMed] [Google Scholar]
  • 18.Nguyen, H. T. et al. A naturally occurring human/hepatitis E recombinant virus predominates in serum but not in faeces of a chronic hepatitis E patient and has a growth advantage in cell culture. J. Gen. Virol.93, 526–530. 10.1099/vir.0.037259-0 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kenney, S. P. & Meng, X. J. The lysine residues within the human ribosomal protein S17 sequence naturally inserted into the viral nonstructural protein of a unique strain of hepatitis E virus are important for enhanced virus replication. J. Virol.89, 3793–3803. 10.1128/JVI.03582-14 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.van Tong, H. et al. Hepatitis E virus mutations: functional and clinical relevance. EBioMedicine11, 31–42. 10.1016/j.ebiom.2016.07.039 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sridhar, S. Use of S17 fragment containing hepatitis E virus infectious clones in cell culture experiments: The fine print does matter. J. Viral Hepat.25, 1105. 10.1111/jvh.12902 (2018). [DOI] [PubMed] [Google Scholar]
  • 22.Schemmerer, M., Johne, R., Erl, M., Jilg, W. & Wenzel, J. J. Isolation of subtype 3c, 3e and 3f-Like hepatitis e virus strains stably replicating to high viral loads in an optimized cell culture system. Viruses11 (2019). 10.3390/v11060483 [DOI] [PMC free article] [PubMed]
  • 23.Kapur, N., Thakral, D., Durgapal, H. & Panda, S. K. Hepatitis E virus enters liver cells through receptor-dependent clathrin-mediated endocytosis. J. Viral Hepat.19, 436–448. 10.1111/j.1365-2893.2011.01559.x (2012). [DOI] [PubMed] [Google Scholar]
  • 24.Treyer, A. & Musch, A. Hepatocyte polarity. Compr. Physiol.3, 243–287. 10.1002/cphy.c120009 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Gissen, P. & Arias, I. M. Structural and functional hepatocyte polarity and liver disease. J. Hepatol.63, 1023–1037. 10.1016/j.jhep.2015.06.015 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Godoy, P. et al. Recent advances in 2D and 3D in vitro systems using primary hepatocytes, alternative hepatocyte sources and non-parenchymal liver cells and their use in investigating mechanisms of hepatotoxicity, cell signaling and ADME. Arch. Toxicol.87, 1315–1530. 10.1007/s00204-013-1078-5 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Schulze, A., Mills, K., Weiss, T. S. & Urban, S. Hepatocyte polarization is essential for the productive entry of the hepatitis B virus. Hepatology55, 373–383. 10.1002/hep.24707 (2012). [DOI] [PubMed] [Google Scholar]
  • 28.Yan, H. et al. Sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis B and D virus. eLife110.7554/eLife.00049 (2012). [DOI] [PMC free article] [PubMed]
  • 29.Evans, M. J. et al. Claudin-1 is a hepatitis C virus co-receptor required for a late step in entry. Nature446, 801–805. 10.1038/nature05654 (2007). [DOI] [PubMed] [Google Scholar]
  • 30.Hirai-Yuki, A., Hensley, L., Whitmire, J. K. & Lemon, S. M. Biliary secretion of Quasi-Enveloped human hepatitis A virus. mBio710.1128/mBio.01998-16 (2016). [DOI] [PMC free article] [PubMed]
  • 31.Pellerin, M., Hirchaud, E., Blanchard, Y., Pavio, N. & Doceul, V. Characterization of a cell culture system of persistent hepatitis E virus infection in the human HepaRG hepatic cell line. Viruses1310.3390/v13030406 (2021). [DOI] [PMC free article] [PubMed]
  • 32.Rogee, S. et al. New models of hepatitis E virus replication in human and Porcine hepatocyte cell lines. J. Gen. Virol.94, 549–558. 10.1099/vir.0.049858-0 (2013). [DOI] [PubMed] [Google Scholar]
  • 33.Capelli, N. et al. Vectorial release of hepatitis E virus in polarized human hepatocytes. J. Virol.9310.1128/JVI.01207-18 (2019). [DOI] [PMC free article] [PubMed]
  • 34.Dao Thi, V. L. et al. Stem cell-derived polarized hepatocytes. Nat. Commun.11, 1677. 10.1038/s41467-020-15337-2 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sari, G. et al. The viral ORF3 protein is required for hepatitis E virus apical release and efficient growth in polarized hepatocytes and humanized mice. J. Virol.95, e0058521. 10.1128/JVI.00585-21 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Takahashi, M. et al. Monoclonal antibodies Raised against the ORF3 protein of hepatitis E virus (HEV) can capture HEV particles in culture supernatant and serum but not those in feces. Arch. Virol.153, 1703–1713. 10.1007/s00705-008-0179-6 (2008). [DOI] [PubMed] [Google Scholar]
  • 37.van der Kolk, D. M. et al. Activity and expression of the multidrug resistance proteins MRP1 and MRP2 in acute myeloid leukemia cells, tumor cell lines, and normal hematopoietic CD34 + peripheral blood cells. Clin. Cancer Res.4, 1727–1736 (1998). [PubMed] [Google Scholar]
  • 38.Fletcher, N. F. et al. Activated macrophages promote hepatitis C virus entry in a tumor necrosis factor-dependent manner. Hepatology59, 1320–1330. 10.1002/hep.26911 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Fletcher, N. F., Clark, A. R., Balfe, P. & McKeating, J. A. TNF superfamily members promote hepatitis C virus entry via an NF-kappaB and myosin light chain kinase dependent pathway. J. Gen. Virol.98, 405–412. 10.1099/jgv.0.000689 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Leon-Janampa, N. et al. A pig model of chronic hepatitis E displaying persistent viremia and a downregulation of innate immune responses in the liver. Hepatol. Commun.710.1097/HC9.0000000000000274 (2023). [DOI] [PMC free article] [PubMed]
  • 41.León-Janampa, N. et al. Relevance of tacrolimus trough concentration and hepatitis E virus genetic changes in kidney transplant recipients with chronic hepatitis E. Kidney Int. Rep.10.1016/j.ekir.2024.01.054 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Schulze, R. J., Schott, M. B., Casey, C. A., Tuma, P. L. & McNiven, M. A. The cell biology of the hepatocyte: A membrane trafficking machine. J. Cell. Biol.218, 2096–2112. 10.1083/jcb.201903090 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Lee, J. L. & Streuli, C. H. Integrins and epithelial cell polarity. J. Cell. Sci.127, 3217–3225. 10.1242/jcs.146142 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Berto, A. et al. Replication of hepatitis E virus in three-dimensional cell culture. J. Virol. Methods187, 327–332. 10.1016/j.jviromet.2012.10.017 (2013). [DOI] [PubMed] [Google Scholar]
  • 45.Langhans, S. A. Three-dimensional in vitro cell culture models in drug discovery and drug repositioning. Front. Pharmacol.9, 6. 10.3389/fphar.2018.00006 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Khoshdel-Rad, N. et al. Modeling hepatotropic viral infections: Cells vs. Anim. Cells1010.3390/cells10071726 (2021). [DOI] [PMC free article] [PubMed]
  • 47.Kalia, M., Chandra, V., Rahman, S. A., Sehgal, D. & Jameel, S. Heparan sulfate proteoglycans are required for cellular binding of the hepatitis E virus ORF2 capsid protein and for viral infection. J. Virol.83, 12714–12724. 10.1128/JVI.00717-09 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Yin, X., Ambardekar, C., Lu, Y. & Feng, Z. Distinct entry mechanisms for nonenveloped and quasi-enveloped hepatitis E viruses. J. Virol.90, 4232–4242. 10.1128/JVI.02804-15 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Zhang, L. et al. Asialoglycoprotein receptor facilitates infection of PLC/PRF/5 cells by HEV through interaction with ORF2. J. Med. Virol.88, 2186–2195. 10.1002/jmv.24570 (2016). [DOI] [PubMed] [Google Scholar]
  • 50.Shiota, T. et al. Integrin alpha3 is involved in non-enveloped hepatitis E virus infection. Virology536, 119–124. 10.1016/j.virol.2019.07.025 (2019). [DOI] [PubMed] [Google Scholar]
  • 51.Schrader, J. A. et al. EGF receptor modulates HEV entry in human hepatocytes. Hepatology77, 2104–2117. 10.1097/HEP.0000000000000308 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Singh, B. & Coffey, R. J. Trafficking of epidermal growth factor receptor ligands in polarized epithelial cells. Annu. Rev. Physiol.76, 275–300. 10.1146/annurev-physiol-021113-170406 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Mu, J. Z., Gordon, M., Shao, J. S. & Alpers, D. H. Apical expression of functional asialoglycoprotein receptor in the human intestinal cell line HT-29. Gastroenterology113, 1501–1509. 10.1053/gast.1997.v113.pm9352852 (1997). [DOI] [PubMed] [Google Scholar]
  • 54.Zeigerer, A. et al. Functional properties of hepatocytes in vitro are correlated with cell polarity maintenance. Exp. Cell. Res.350, 242–252. 10.1016/j.yexcr.2016.11.027 (2017). [DOI] [PubMed] [Google Scholar]
  • 55.Katt, M. E., Placone, A. L., Wong, A. D., Xu, Z. S. & Searson, P. C. Vitro tumor models: Advantages, disadvantages, variables, and selecting the right platform. Front. Bioeng. Biotechnol.4, 12. 10.3389/fbioe.2016.00012 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Meister, T. L., Bruening, J., Todt, D. & Steinmann, E. Cell culture systems for the study of hepatitis E virus. Antiviral Res.163, 34–49. 10.1016/j.antiviral.2019.01.007 (2019). [DOI] [PubMed] [Google Scholar]
  • 57.Cereijido, M., Valdes, J., Shoshani, L. & Contreras, R. G. Role of tight junctions in establishing and maintaining cell polarity. Annu. Rev. Physiol.60, 161–177. 10.1146/annurev.physiol.60.1.161 (1998). [DOI] [PubMed] [Google Scholar]
  • 58.Shin, K., Fogg, V. C. & Margolis, B. Tight junctions and cell polarity. Annu. Rev. Cell. Dev. Biol.22, 207–235. 10.1146/annurev.cellbio.22.010305.104219 (2006). [DOI] [PubMed] [Google Scholar]
  • 59.Tanaka, T., Takahashi, M., Kusano, E. & Okamoto, H. Development and evaluation of an efficient cell-culture system for hepatitis E virus. J. Gen. Virol.88, 903–911. 10.1099/vir.0.82535-0 (2007). [DOI] [PubMed] [Google Scholar]
  • 60.Takahashi, M. et al. Hepatitis E virus (HEV) strains in serum samples can replicate efficiently in cultured cells despite the coexistence of HEV antibodies: characterization of HEV virions in blood circulation. J. Clin. Microbiol.48, 1112–1125. 10.1128/JCM.02002-09 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Shiota, T. et al. The hepatitis E virus capsid C-terminal region is essential for the viral life cycle: implication for viral genome encapsidation and particle stabilization. J. Virol.87, 6031–6036. 10.1128/JVI.00444-13 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Shiota, T. et al. Establishment of hepatitis E virus infection-permissive and -non-permissive human hepatoma PLC/PRF/5 subclones. Microbiol. Immunol.59, 89–94. 10.1111/1348-0421.12219 (2015). [DOI] [PubMed] [Google Scholar]
  • 63.Meng, X. J. et al. A novel virus in swine is closely related to the human hepatitis E virus. Proc. Natl. Acad. Sci. U S A94, 9860–9865. 10.1073/pnas.94.18.9860 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Locus, T. et al. A multifaceted approach for evaluating hepatitis E virus infectivity in vitro: cell culture and innovative molecular methods for integrity assessment. Vet. Sci.1010.3390/vetsci10120676 (2023). [DOI] [PMC free article] [PubMed]
  • 65.Hay, D. C. et al. Efficient differentiation of hepatocytes from human embryonic stem cells exhibiting markers recapitulating liver development in vivo. Stem Cells26, 894–902. 10.1634/stemcells.2007-0718 (2008). [DOI] [PubMed] [Google Scholar]
  • 66.Olsavsky Goyak, K. M., Laurenzana, E. M. & Omiecinski, C. J. Hepatocyte differentiation. Methods Mol. Biol.640, 115–138. 10.1007/978-1-60761-688-7_6 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Arterburn, L. M., Zurlo, J., Yager, J. D., Overton, R. M. & Heifetz, A. H. A morphological study of differentiated hepatocytes in vitro. Hepatology22, 175–187 (1995). [PubMed] [Google Scholar]
  • 68.Alizadeh, E. et al. The effect of dimethyl sulfoxide on hepatic differentiation of mesenchymal stem cells. Artif. Cells Nanomed. Biotechnol.44, 157–164. 10.3109/21691401.2014.928778 (2016). [DOI] [PubMed] [Google Scholar]
  • 69.Nikolaou, N., Green, C. J., Gunn, P. J., Hodson, L. & Tomlinson, J. W. Optimizing human hepatocyte models for metabolic phenotype and function: Effects of treatment with dimethyl sulfoxide (DMSO). Physiol. Rep.410.14814/phy2.12944 (2016). [DOI] [PMC free article] [PubMed]
  • 70.Belouzard, S. et al. Entry and release of hepatitis C virus in polarized human hepatocytes. J. Virol.9110.1128/JVI.00478-17 (2017). [DOI] [PMC free article] [PubMed]
  • 71.Dubois-Pot-Schneider, H. et al. Transcriptional and epigenetic consequences of DMSO treatment on HepaRG cells. Cells1110.3390/cells11152298 (2022). [DOI] [PMC free article] [PubMed]
  • 72.Sugahara, G. et al. Long-term cell fate and functional maintenance of human hepatocyte through stepwise culture configuration. FASEB J.37, e22750. 10.1096/fj.202201292RR (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Song, Y. M. et al. Dimethyl sulfoxide reduces hepatocellular lipid accumulation through autophagy induction. Autophagy8, 1085–1097. 10.4161/auto.20260 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Choi, S., Sainz, B. Jr., Corcoran, P., Uprichard, S. & Jeong, H. Characterization of increased drug metabolism activity in dimethyl sulfoxide (DMSO)-treated Huh7 hepatoma cells. Xenobiotica39, 205–217. 10.1080/00498250802613620 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Bhattacharyya, S., Tian, J., Bouhassira, E. E. & Locker, J. Systematic targeted integration to study albumin gene control elements. PLoS One6, e23234. 10.1371/journal.pone.0023234 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Ji, H. et al. The different replication between nonenveloped and quasi-enveloped hepatitis E virus. J. Med. Virol.93, 6267–6277. 10.1002/jmv.27121 (2021). [DOI] [PubMed] [Google Scholar]
  • 77.van de Garde, M. D. et al. Hepatitis E virus (HEV) genotype 3 infection of human liver chimeric mice as a model for chronic HEV infection. J. Virol.90, 4394–4401. 10.1128/JVI.00114-16 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Mee, C. J. et al. Hepatitis C virus infection reduces hepatocellular polarity in a vascular endothelial growth factor-dependent manner. Gastroenterology138, 1134–1142. 10.1053/j.gastro.2009.11.047 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (1.2MB, pdf)

Data Availability Statement

Data is provided within the manuscript or supplementary information files.

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES