Abstract
Background
Curcumin has been shown to inhibit renal fibrosis, but whether curcumin mediates renal fibrosis progression by regulating the circular RNA (circRNA)-related pathway remain unclear.
Methods
TGF-β1 was used to construct renal injury and fibrosis cell model. Cell growth was evaluated by cell counting kit 8 assay, EdU assay and flow cytometry. Fibrosis marker and interleukin 6 signal transducer (IL6ST) protein levels were measured using western bolt analysis. Inflammation factor concentrations were determined by ELISA. Circ_0008925, miR-204-5p and IL6ST expression was assessed by qRT-PCR. Unilateral ureteral obstruction (UUO) mice models were constructed to assess the role of curcumin in vivo.
Results
Curcumin treatment alleviated TGF-β1-induced HK-2 cell apoptosis, inflammation and fibrosis in vitro, as well as relieved renal injury in UUO mice models in vivo. Circ_0008925 was highly expressed in TGF-β1-induced HK-2 cells and its expression was inhibited by curcumin. Circ_0008925 could sponge miR-204-5p to positively regulate IL6ST. The inhibition effect of curcumin on TGF-β1-induced HK-2 cell injury and fibrosis was reversed by circ_0008925 overexpression, miR-204-5p inhibitor or IL6ST upregulation. Besides, circ_0008925 knockdown inhibited TGF-β1-induced HK-2 cell injury and fibrosis by suppressing IL6ST expression.
Conclusion
Curcumin relieved renal fibrosis through regulating circ_0008925/miR-204-5p/IL6ST axis.
Keywords: Renal fibrosis, curcumin, circ_0008925, miR-204-5p, IL6ST
HIGHLIGHTS
Curcumin inhibits renal fibrosis by reducing circ_0008925 expression.
Circ_0008925 sponges miR-204-5p.
MiR-204-5p targets IL6ST.
Curcumin regulates the circ_0008925/miR-204-5p/IL6ST axis.
Introduction
Chronic kidney disease (CKD), refers to various degrees of chronic renal structural and functional disorders, has become one of the main diseases threatening public health [1,2]. Renal fibrosis can lead to renal function loss and failure, characterized by glomerular mesangial cell proliferation, renal tubule atrophy, inflammatory cell infiltration, and excessive accumulation of extracellular matrix [3–5]. There is no effective treatment for renal fibrosis now, which can only be delayed by protecting the kidney [6]. Therefore, clarifying the underlying molecular mechanism may provide a theoretical basis for treating renal fibrosis.
Curcumin is a plant polyphenol extracted from turmeric, and is also the most important active component of turmeric [7,8]. Curcumin has anti-inflammatory, antioxidant, anti-tumor, and other pharmacological effects [9,10]. Curcumin has also been found to have kidney protective and anti-fibrosis properties [11,12]. However, the potential molecular mechanism of curcumin inhibiting renal fibrosis remains to be further studied.
Circular RNAs (circRNAs) has been confirmed to regulate human disease progression [13,14]. CircRNA acts as a microRNA (miRNA) sponge to mediate gene expression [15,16]. Many studies have suggested that circRNA is involved in the progression of renal fibrosis [17,18]. Circ_0008925 is located at chr6: 108222573-108246136, and is derived by the SEC63 gene. Circ_0008925 was remarkably overexpressed in urinary exosomes of patients with renal fibrosis and could be used as a potential biomarker of renal fibrosis [19]. However, the role and mechanism of circ_0008925 in renal fibrosis remain unclear.
In this, curcumin had an inhibition on circ_0008925 expression and could alleviate TGF-β1-induced HK-2 injury and fibrosis. Hence, we proposed hypothesis that curcumin hindered circ_0008925 expression to alleviate renal fibrosis. In addition, we also explored the circ_0008925-mediated miRNA/mRNA regulatory axis and improved the potential molecular mechanism of curcumin regulated renal fibrosis.
Materials and methods
Cell culture and treatment
HK-2 cells (ATCC, USA) were maintained in DMEM plus 10% FBS and 1% penicillin/streptomycin (Invitrogen, USA). Cells were stimulated with 5 ng/mL TGF-β1 for 48 h to induce renal cell injury and fibrosis model as previously described [20]. In addition, cells were treated with TGF-β1 and different concentrations of curcumin to screen the optical concentration of curcumin.
Cell counting kit 8 (CCK8) assay
HK-2 cells seeded into 96-well plates were cultured for 48 h. After incubated with CCK8 reagent (Beyotime, China), cell viability was assessed via a microplate reader at 450 nm.
EdU assay
As previously described [21], HK-2 cells in 6-well plates were stained by EdU solution and DAPI solution (RiboBio, China). Fluorescent images were captured under a microscope to count EdU positive cell rate.
Flow cytometry
As previously described [22], HK-2 cells suspended with Binding buffer were stained with Annexin V-FITC and PI solution (BD Biosciences, USA). Cell apoptosis was analyzed by flow cytometry with FlowJo software (BD Biosciences, USA).
Western blot (WB) analysis
As previously described [23], total proteins were extracted by RIPA buffer (Beyotime, China), separated using SDS-PAGE gels followed by transferred to PVDF membranes. After incubated with anti-α-SMA (ab5694, 1:1000, Abcam, USA), anti-collagen I (ab34710, 1:1000, Abcam, USA), anti-interleukin 6 signal transducer (IL6ST) (ab283685, 1:1000, Abcam, USA) and anti-GAPDH (ab9485, 1:2500, Abcam, USA), membrane was incubated with secondary antibody. Protein bands were visualized using ECL reagents (Beyotime, China).
ELISA assay
After centrifuged, cell supernatant was collected. The concentrations of IL-6 and TNF-α in cell supernatant were determined by Human IL-6 and TNF-α ELISA kits (Solarbio, China) according to kit instructions.
qRT-PCR
As previously described [24], total RNAs were extracted using TRIzol reagent (Invitrogen, USA), and cDNA was synthesized using a cDNA Synthesis Kit (Beyotime, China). Then, SYBR Green (Takara, China) was mixed with cDNA and specific primers (Table 1) to perform PCR. Fold change was analyzed by the 2−ΔΔCT method.
Table 1.
Primer sequences used for qRT-PCR.
| Name | Primers for qRT-PCR (5′–3′) | |
|---|---|---|
| hsa_circ_0008925 | Forward | GTTATGGCTGTCCTTGGGAGT |
| Reverse | AGCAGAACTATTTTCCCTGTGA | |
| IL6ST | Forward | TGGCTAGTGCAAGCCTTGTT |
| Reverse | AGGTGACACTGGATGCTGTT | |
| miR-204-5p | Forward | GTATGAGTTCCCTTTGTCATCCTA |
| Reverse | CTCAACTGGTGTCGTGGAG | |
| GAPDH | Forward | GACCACAGTCCATGCCATCAC |
| Reverse | ACGCCTGCTTCACCACCTT | |
| U6 | Forward | GCTTCGGCAGCACATATACTAA |
| Reverse | AACGCTTCACGAATTTGCGT |
Identification of circ_0008925
RNA extracted from HK-2 cells was additionally co-incubated with RNase R and used for qRT-PCR. To explore whether circ_0008925 had a poly-A tail, cDNA was synthesized by random primers or oligo (dT)18 primers in reverse transcription and then used for qRT-PCR. The cytoplasm and nuclear RNAs from HK-2 cells were isolated by PARIS Kit (Invitrogen, USA), and qRT-PCR was performed to detect circ_0008925 expression in the cytoplasm and nuclear.
Cell transfection
Circ_0056686 pCD5 overexpression vector or small interfering RNA (si-circ_0008925), miR-204-5p mimic, inhibitor (anti-miR-204-5p), pcDNA IL6ST overexpression vector and their negative controls (RiboBio, China) were transfected into HK-2 cells using lipofectamine 3000 (Invitrogen, USA).
Dual-luciferase reporter assay
As previously described [24], the wild-type and mutant-type segments of circ_0008925 or IL6ST 3’UTR were inserted into the pGL3 reporter vector. HK-2 cells were co-transfected with WT/MUT-circ_0008925 vectors or WT/MUT-IL6ST 3’UTR vectors with miR-204-5p mimic/miR-NC. Relative luciferase activity was quantified using a Dual-Lucy Assay Kit (Solarbio, China) 48 h later.
RNA pull-down assay
As previously described [24], the bio-miR-204-5p probe and bio-miR-NC probe (RiboBio, China) were transfected into HK2 cells for 48 h. Cell lysates were collected and incubated with Dynabeads M-280 Streptavidin (Invitrogen, USA). Then, the enrichments of bound circ_0008925 and IL6ST in each probe were detected by qRT-PCR.
Unilateral ureteral obstruction (UUO) models
As previously described [25], male C57BL/6 mice (Vital River, China) were anesthetized with 1% pentobarbital and ligated the left ureter with 4-0 silk thread to construct UUO model (n = 5). Sham-operated mice (n = 5) underwent the same procedure without ligation. Mice in the UUO+curcumin group (n = 5) were administered curcumin by gastric gavage at a daily dose of 50 mg/kg. After 14 d, blood samples and kidney tissues were collected after mice were sacrificed. The kidney samples were paraffin embedded and cut to 5 mm thick slices for hematoxylin and eosin (HE) and MASSON staining. The concentrations of IL-6 and TNF-α in mice blood samples were detected by corresponding Mouse ELISA Kits (Solarbio, China). Animal studies were approved by the Animal Ethics Committee of the Second Affiliated Hospital of Xi’an Jiaotong University.
Statistical analysis
Data are shown as means ± SD. Comparisons between groups were analyzed by Student’s t-tests or analysis of variance using GraphPad 7.0 software. p < .05 was regarded as statistically significant.
Results
Curcumin inhibited TGF-β1-stimulated HK2 cell injury and fibrosis
Firstly, we assessed the effect of curcumin on TGF-β1-stimulated HK2 cell injury and fibrosis. Under TGF-β1 treatment, HK2 cell viability was markedly reduced. After treated with different concentrations of curcumin, we found a gradual increase in cell viability (Figure 1A). In the follow-up study, 10 μM curcumin was used for cell treatment. TGF-β1 treatment inhibited EdU positive cell rate, and this effect was abolished by curcumin (Figure 1B). In addition, TGF-β1 promoted HK2 cell apoptosis rate, fibrosis markers (α-SMA and Collagen I) protein expression, and inflammatory factors (IL-6 and TNF-α) concentrations. However, curcumin treatment also alleviated TGF-β1-induced apoptosis, fibrosis and inflammation in HK2 cells (Figure 1C–F). Thus, we believed that curcumin might alleviate renal cell injury and fibrosis.
Figure 1.
Effects of curcumin on TGF-β1-stimulated HK2 cell injury and fibrosis. (A) CCK8 assay was used to detect cell viability in HK2 cells treated with TGF-β1 and different concentration of curcumin. (B-F) HK2 cells were treated with 10 μM curcumin and then induced by TGF-β1. (B) EdU assay was used to measure EdU positive cell rate. (C) Apoptosis rate was detected by flow cytometry. (D-E) WB analysis was performed to analyze protein expression. (F) The concentrations of IL-6 and TNF-α were examined by ELISA assay. *p < .05, **p < .01, ***p < .001, ****p < .0001.
Circ_0008925 was highly expressed in TGF-β1-stimulated HK2 cells and its expression was regulated by curcumin
Compared to non-treated cells, circ_0008925 was upregulated in TGF-β1-induced HK2 cells (Figure 2A). To confirm the circular feature of circ_0008925, we measured circ_0008925 expression under RNase R treatment and oligo (dT)18 primers treatment. The results showed that circ_0008925 expression had not any changed after RNase R treatment and it cannot be amplified by oligo (dT)18 primers (Figure 2B–C), suggesting that circ_0008925 could resist to RNase R digestion and did not contain poly-A tail. Besides, subcellular localization analysis and cellular immunofluorescence staining showed that circ_0008925 was mainly distributed in the cytoplasm (Figure 2D and Supplementary Figure 1). Curcumin treatment reduced circ_0008925 expression in TGF-β1-induced HK2 cells (Figure 2E), showing that curcumin might regulate renal fibrosis through circ_0008925.
Figure 2.
Circ_0008925 expression in TGF-β1-stimulated HK2 cells and curcumin treatment. (A) Circ_0008925 expression was detected by qRT-PCR in HK2 cells treated with or without TGF-β1. (B) After RNA was treated with RNase R, qRT-PCR was used to detect circ_0008925 and GAPDH expression. (C) After amplified by random primers and oligo (dT)18 primers, circ_0008925 and GAPDH expression was examined by qRT-PCR. (D) Subcellular localization analysis was used to analyze the distribution of circ_0008925 in the cytoplasm and nuclear of HK2 cells. (E) Circ_0008925 expression was determined by qRT-PCR in HK2 treated with TGF-β1 and curcumin. **p < .01, ***p < .001, ****p < .0001.
Circ_0008925 overexpression reversed the inhibition of curcumin on TGF-β1-mediated HK2 cell injury and fibrosis
To confirm whether curcumin regulated renal injury and fibrosis by mediating circ_0008925 expression, HK2 cells were transfected with pCD5 circ_0008925 overexpression vector and then treated with curcumin and TGF-β1. The addition of pCD5 circ_0008925 overexpression vector increased circ_0008925 expression inhibited by curcumin in TGF-β1-induced HK2 cells (Figure 3A). Overexpressed circ_0008925 reversed the increasing effect of curcumin on viability and EdU positive cell rate in TGF-β1-induced HK2 cells (Figure 3B,C). Also, the upregulation of circ_0008925 eliminated the suppressive effect of curcumin on the apoptosis rate, fibrosis markers protein expression, and inflammatory factors concentrations in TGF-β1-induced HK2 cells (Figure 3D–F). The above data revealed that curcumin might suppress renal injury and fibrosis via decreasing circ_0008925 expression.
Figure 3.
Effects of curcumin and circ_0008925 overexpression on TGF-β1-mediated HK2 cell injury and fibrosis. HK2 cells were transfected with pCD5-ciR or pCD5 circ_0008925 overexpression vector, and then treated with curcumin and TGF-β1. (A) Circ_0008925 expression was assessed by qRT-PCR. CCK8 assay (B), EdU assay (C) and flow cytometry (D) were used to determine cell proliferation and apoptosis. (E) Protein expression was measured by WB analysis. (F) ELISA assay was employed to examine the concentrations of IL-6 and TNF-α. *p < .05, **p < .01, ***p < .001, ****p < .0001.
Circ_0008925 served as miR-204-5p sponge
Using starBase2.0 software, circ_0008925 had binding sites with miR-204-5p (Figure 4A). MiR-204-5p mimic was used to overexpress miR-204-5p (Figure 4B). Only the luciferase activity of the WT-circ_0008925 vector was reduced by the miR-204-5p mimic (Figure 4C), and the highly enrichment of circ_0008925 was observed in the bio-miR-204-5p probe (Figure 4D). These data confirmed the interaction between circ_0008925 and miR-204-5p. The miR-204-5p level was decreased in TGF-β1-induced HK2 cells (Figure 4E). After confirmed that the pCD5 circ-0008925 overexpression vector could enhance circ_0008925 expression in HK2 cells (Figure 4F), we measured miR-204-5p expression, and found that circ_0008925 upregulation suppressed miR-204-5p expression (Figure 4G). Therefore, we confirmed that circ_0008925 sponged miR-204-5p to negatively regulate its expression.
Figure 4.
Circ_0008925 sponged miR-204-5p. (A) The sequences of WT/MUT-circ_0008925 vectors were shown. (B) The transfection efficiency of miR-204-5p mimic was confirmed by qRT-PCR. Dual-luciferase reporter assay (C) and RNA pull-down assay (D) were used to confirm the interaction between circ_0008925 and miR-204-5p. (E) MiR-204-5p expression was analyzed by qRT-PCR in HK2 cells treated with or without TGF-β1. (F) The transfection efficiency of pCD5 circ_0008925 overexpression vector was confirmed by qRT-PCR. (G) MiR-204-5p expression was examined by qRT-PCR in HK2 cells transfected with pCD5-ciR or pCD5 circ_0008925 overexpression vector. **p < .01, ***p < .001, ****p < .0001.
Curcumin suppressed TGF-β1-induced HK2 cell injury and fibrosis by increasing miR-204-5p
Curcumin treatment enhanced miR-204-5p level in TGF-β1-induced HK2 cells (Figure 5A). To explore whether curcumin regulated TGF-β1-induced HK2 cell injury by mediating miR-204-5p expression, HK2 cells were transfected with anti-miR-204-5p and treated with curcumin and TGF-β1. The transfection of anti-miR-204-5p reduced miR-204-5p expression under curcumin treatment in TGF-β1-induced HK2 cells (Figure 5A). As presented in Figure 5B,C, miR-204-5p inhibitor eliminated the enhancing effect of curcumin on the viability and EdU positive cell rate of TGF-β1-induced HK2 cells. Te inhibition of curcumin on the apoptosis rate, fibrosis markers protein expression and inflammatory factors concentrations in TGF-β1-induced HK2 cells also were reversed by a miR-204-5p inhibitor (Figure 5D–F). Above all, we confirmed that curcumin relieved renal fibrosis through increasing miR-204-5p expression.
Figure 5.
Effects of curcumin and anti-miR-204-5p on TGF-β1-induced HK2 cell injury and fibrosis. HK2 cells were transfected with anti-miR-NC or anti-miR-204-5p, and then treated with curcumin and TGF-β1. (A) MiR-204-5p expression was tested by qRT-PCR. Cell proliferation and apoptosis were detected by CCK8 assay (B), EdU assay (C) and flow cytometry (D). (E) WB analysis was performed to detect protein expression. (F) The concentrations of IL-6 and TNF-α were tested using ELISA assay. *p < .05, **p < .01, ***p < .001, ****p < .0001.
MiR-204-5p targeted IL6ST
MiR-204-5p had binding sites with IL6ST 3’UTR predicted by starBase v2.0 software (Figure 6A). MiR-204-5p mimic inhibited the luciferase activity of WT-IL6ST 3’UTR vector (Figure 6B), and IL6ST enrichment was significantly increased in the bio-miR-204-5p probe (Figure 6C), confirming the interaction between miR-204-5p and IL6ST. TGF-β1 treatment enhanced IL6ST expression in HK2 cells (Figure 6D). The anti-miR-204-5p was used to decrease miR-204-5p expression in HK2 cells (Figure 6E). Further analysis confirmed that IL6ST protein expression was reduced by miR-204-5p mimic and increased by its inhibitor (Figure 6F). Then, si-circ_0008925 was constructed to reduce circ_0008925 expression in HK2 cells (Figure 6G). Function analysis showed that circ_0008925 knockdown inhibited IL6ST protein expression in TGF-β1-induced HK2 cells, and this effect was reversed by miR-204-5p inhibitor (Figure 6H). Above all, we confirmed that circ_0008925 positively regulated IL6ST expression by sponging miR-204-5p.
Figure 6.
MiR-204-5p targeted IL6ST. (A) The sequences of WT/MUT-IL6ST 3’UTR vectors were shown. Dual-luciferase reporter assay (B) and RNA pull-down assay (C) were used to confirm the interaction between miR-204-5p and IL6ST. (D) IL6ST protein expression was analyzed by WB analysis in HK2 cells treated with or without TGF-β1. (E) The transfection efficiency of anti-miR-204-5p was confirmed by qRT-PCR. (F) IL6ST protein expression was examined by WB analysis in HK2 cells transfected with miR-204-5p mimic or inhibitor. (G) QRT-PCR was used to confirm the transfection efficiency of si-circ_0008925. (H) IL6ST protein expression was tested by WB analysis in TGF-β1-induced HK2 cells co-transfected with si-circ_0008925 and anti-miR-204-5p. **p < .01, ***p < .001, ****p < .0001.
Circ_0008925 knockdown inhibited TGF-β1-induced HK2 cell injury and fibrosis by reducing IL6ST expression
To explore whether circ_0008925 regulated renal injury and fibrosis by regulating IL6ST, we performed rescue experiments. The addition of pcDNA IL6ST overexpression vector enhanced IL6ST expression reduced by si-circ_0008925 in TGF-β1-induced HK2 cells (Figure 7A). Function experiments indicated that circ_0008925 knockdown promoted the viability and EdU positive cell rate in TGF-β1-induced HK2 cells, while IL6ST overexpression reversed this effect (Figure 7B–D). Also, downregulated circ_0008925 could inhibit the apoptosis rate, the fibrosis markers protein expression and the concentrations of inflammatory factors in TGF-β1-induced HK2 cells, while these effects also were overturned by overexpressing IL6ST (Figure 7E–G). Therefore, circ_0008925 might promote renal injury and fibrosis by increasing IL6ST expression.
Figure 7.
Effects of circ_0008925 knockdown and IL6ST overexpression on TGF-β1-induced HK2 cell injury and fibrosis. HK2 cells were co-transfected with si-circ_0008925 and pcDNA IL6ST overexpression vector followed by treated with TGF-β1. (A) IL6ST protein expression was measured by WB analysis. CCK8 assay (B), EdU assay (C-D) and flow cytometry (E) were performed to measure cell proliferation and apoptosis. (F) Protein expression was tested using WB analysis. (G) ELISA assay was used to test the concentrations of IL-6 and TNF-α. *p < .05, **p < .01, ***p < .001, ****p < .0001.
Curcumin regulated TGF-β1-mediated HK2 cell injury and fibrosis via repressing IL6ST expression
To further confirm our conclusion, we explored whether IL6ST participated in the regulation of curcumin on TGF-β1-induced HK2 cell injury and fibrosis. Curcumin markedly decreased IL6ST protein expression, and the pcDNA IL6ST overexpression vector abolished this effect (Figure 8A). IL6ST overexpression eliminated the enhancing effect of curcumin on proliferation, as well as the reducing effect on apoptosis, fibrosis markers protein expression and the concentrations of inflammatory factors (Figure 8B–F). Hence, we confirmed that curcumin alleviated renal cell injury and fibrosis via reducing IL6ST expression.
Figure 8.
Effects of curcumin and IL6ST on TGF-β1-mediated HK2 cell injury and fibrosis. HK2 cells were transfected with pcDNA or pcDNA IL6ST overexpression vector, and then treated with curcumin and TGF-β1. (A) WB analysis was used to detect IL6ST protein expression. Cell proliferation and apoptosis were determined using CCK8 assay (B), EdU assay (C) and flow cytometry (D). (E) Protein expression was measured using WB analysis. (F) The concentrations of IL-6 and TNF-α were determined by ELISA assay. *p < .05, **p < .01, ***p < .001, ****p < .0001.
Curcumin alleviated renal fibrosis in UUO-induced mice via regulating circ_0008925/miR-204-5p/IL6ST axis
For further confirming the anti-fibrosis roles of curcumin, we performed animal study. Through HE and MASSON staining, we found that UUO induction could promote renal tubular dilation and fibrotic deposition, while curcumin treatment improved renal tubular dilation and reduced fibrotic deposition in UUO-induced mice (Supplementary Figure 2A). In UUO-induced mice, α-SMA, Collagen I, IL-6 and TNF-α levels were significantly enhanced in kidney tissues, while curcumin treatment reversed these effects (Supplementary Figure 2B,C). In addition, we observed the high circ_0008925, IL6ST, and low miR-204-5p expression in kidney tissues of UUO-induced mice, while these effects were eliminated by curcumin (Supplementary Figure 2D–F). Above all, we pointed out that curcumin might inhibit renal fibrosis through the circ_0008925/miR-204-5p/IL6ST axis (Figure 9).
Figure 9.
The mechanism diagram of this study.
Discussion
Many study has been reported the anti-fibrosis effect of curcumin. Previous research showed that curcumin could alleviate renal fibrosis by restraining inflammatory response [25]. Besides, curcumin hindered the EMT process to relieve the renal fibrosis process [26]. Here, we explored the role of curcumin in renal fibrosis. In TGF-β1-induced HK-2 cell apoptosis, inflammation and fibrosis, we confirmed that curcumin treatment suppressed cell injury and fibrosis. In animal study, we also confirmed the anti-fibrosis effect of curcumin in renal.
Although the anti-fibrosis effect of curcumin has been confirmed, but the specific molecular regulatory mechanisms of curcumin in renal fibrosis remains to be revealed. As an important regulatory factor, circRNA is a potential marker for many diseases, such as cardiovascular diseases [27], inflammatory diseases [28] and neurological diseases [29]. However, it has not been reported whether curcumin regulates renal fibrosis by regulating circRNA-related pathways. Here, we found that curcumin decreased the expression of circ_0008925, which was an overexpressed circRNA in patients with renal fibrosis [19]. After overexpressing circ_0008925, the suppressive effect of curcumin on TGF-β1-induced HK-2 cell injury and fibrosis were partially eliminated, confirming that curcumin relieved renal fibrosis by decreasing circ_0008925. Function analysis suggested that circ_0008925 knockdown also abolished TGF-β1-induced HK-2 cell injury and fibrosis, which indicated that circ_0008925 indeed contributed to the renal fibrosis process. In short, this study demonstrated for the first time that curcumin mediates renal fibrosis by regulating circ_0008925, which provided a new route for subsequent studies on the intrinsic mechanisms of renal fibrosis.
Through bioinformatics analysis, circ_0008925 had been confirmed to be a ceRNA for miR-204-5p. In many types of cancer, miR-204-5p acts as a tumor suppressor to regulate cancer development [30,31]. Upregulation of miR-204-5p alleviated inflammatory response in cerebral ischemia and reperfusion neuron injury [32]. MiR-204-5p knockdown is thought to aggravate kidney injury, so it is considered to be an important miRNA to protect the kidney from chronic injury [33]. Recently study suggested that miR-204 inhibited oxidative stress in HK-2 cells induced by H2O2 [34]. In acute kidney injury, miR-204-5p also had an inhibition on hypoxic-induced HK-2 cell apoptosis and inflammation [35]. Here, miR-204-5p was sponged by circ_0008925, and its level could be promoted by curcumin. In the rescue experiments, miR-204-5p knockdown revoked the negatively regulation of curcumin on TGF-β1-induced HK-2 cell injury and fibrosis. Therefore, we believed that curcumin inhibited renal fibrosis by mediating the circ_0008925/miR-204-5p axis.
With the rapid development of sequencing technology and bioinformatics methods, researchers have discovered different classes of non-coding RNAs (ncRNAs) [36]. Although ncRNAs do not encode proteins, they indirectly regulate a variety of biological processes, including cell metabolism and development [37]. It has been shown that circRNAs can sponge miRNAs to regulate the mRNAs expression, thereby modulating the cell physiological state [38]. To improve the assumption of the circRNA/miRNA/mRNA axis, we explored the target of miR-204-5p and confirmed that IL6ST could interact with miR-204-5p. IL6ST, also known as gp130, is a cytokine like receptor that is a founding member of a transmembrane protein [39]. Studies had shown that the Il6ST-related signaling axis mediated cancer progression, and targeting IL6ST might be a potential approach for cancer therapy [40]. In previous studies, IL6ST had been shown to be involved in fibrosis formation in multiple organs, including pulmonary [41] and liver [42]. IL6ST overexpression promoted fibrosis marker expression in high glucose-induced HK-2 cells [24]. Here, circ_0008925 sponged miR-204-5p to positively regulate IL6ST. IL6ST upregulation abolished si-circ_0008925-mediated the inhibition on TGF-β1-induced HK-2 cell injury and fibrosis, verifying that circ_0008925 promoted renal fibrosis by positively regulating IL6ST level. In addition, IL6ST expression was decreased by curcumin, and its overexpression also overturned the function of curcumin on renal fibrosis, confirming the conclusion of curcumin regulated circ_0008925/miR-204-5p/IL6ST axis in renal fibrosis.
This study reveals for the first time that curcumin mediates renal fibrosis by regulating circ_0008925. In addition, the circ_0008925/miR-204-5p/IL6ST axis is also proposed by us for the first time, which is a major discovery of this study. However, there are some limitations to this study. We have not yet revealed the downstream pathway of the circ_0008925/miR-204-5p/IL6ST axis to further refine our experimental results. In future studies, we will explore the downstream pathway of the circ_0008925/miR-204-5p/IL6ST axis to provide more evidence for an in-depth understanding of the anti-fibrotic effects of curcumin.
In summary, our study revealed the underlying molecular mechanism by which curcumin inhibited renal fibrosis. We showed that curcumin suppressed TGF-β1-induced HK-2 cell injury and fibrosis by circ_0008925/miR-204-5p/IL6ST axis. Our findings not only provide new evidence for curcumin to be used in anti-fibrosis therapy, but also the proposed circ_0008925-related regulatory axis provides a potential molecular target for treating renal fibrosis.
Supplementary Material
Funding Statement
This work was supported by the Qiao Chenglin National Famous Traditional Chinese Medicine Experts Inheritance Studio Construction Project of State Administration of Traditional Chinese Medicine (2019-41) and the Key R & D plan of Shaanxi Province (2020SF-340, 2021SF-37).
Authors contributions
Peng An and Xingyao Li designed and performed the research; Yanhong Zhao, Liuyun Li and Yafeng Wang and Wenfang Wang analyzed the data; Tao Zhang, Sicen Wang and Xili Wu wrote the manuscript. All authors read and approved the final manuscript.
Disclosure statement
No potential conflict of interest was reported by the author(s).
References
- 1.Charles C, Ferris AH.. Chronic kidney disease. Prim Care. 2020;47(4):585–595. doi: 10.1016/j.pop.2020.08.001. [DOI] [PubMed] [Google Scholar]
- 2.Wang Y-N, Ma S-X, Chen Y-Y, et al. Chronic kidney disease: biomarker diagnosis to therapeutic targets. Clin Chim Acta. 2019;499:54–63. doi: 10.1016/j.cca.2019.08.030. [DOI] [PubMed] [Google Scholar]
- 3.Martínez-Arias L, Panizo S, Alonso-Montes C, et al. Effects of calcitriol and paricalcitol on renal fibrosis in CKD. Nephrol Dial Transplant. 2021;36(5):793–803. doi: 10.1093/ndt/gfaa373. [DOI] [PubMed] [Google Scholar]
- 4.Ma TT, Meng XM.. TGF-beta/Smad and renal fibrosis. Adv Exp Med Biol. 2019;1165:347–364. doi: 10.1007/978-981-13-8871-2_16. [DOI] [PubMed] [Google Scholar]
- 5.Meng XM. Inflammatory mediators and renal fibrosis. Adv Exp Med Biol. 2019;1165:381–406. doi: 10.1007/978-981-13-8871-2_18. [DOI] [PubMed] [Google Scholar]
- 6.Nasri H. Renal cell protection of erythropoietin beyond correcting the anemia in chronic kidney disease patients. Cell J. 2014;15(4):378–380. [PMC free article] [PubMed] [Google Scholar]
- 7.Unlu A, et al. Curcumin (Turmeric) and cancer. J Buon. 2016;21(5):1050–1060. [PubMed] [Google Scholar]
- 8.Nelson KM, Dahlin JL, Bisson J, et al. The essential medicinal chemistry of curcumin. J Med Chem. 2017;60(5):1620–1637. doi: 10.1021/acs.jmedchem.6b00975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kotha RR, Luthria DL.. Curcumin: biological, pharmaceutical, nutraceutical, and analytical aspects. Molecules. 2019;24(16):2930. doi: 10.3390/molecules24162930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Song S-C, Mai Y-L, Shi H-H, et al. High anti-cancer activity, low animal toxicity, and structure activity relationships of curcumin analogs. LDDD. 2020;17(11):1439–1455. doi: 10.2174/2352096513999200714103641. [DOI] [Google Scholar]
- 11.Sun X, Liu Y, Li C, et al. Recent advances of curcumin in the prevention and treatment of renal fibrosis. Biomed Res Int. 2017;2017:2418671–2418679. doi: 10.1155/2017/2418671. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhu F-Q, Chen M-J, Zhu M, et al. Curcumin suppresses epithelial-mesenchymal transition of renal tubular epithelial cells through the inhibition of Akt/mTOR pathway. Biol Pharm Bull. 2017;40(1):17–24. doi: 10.1248/bpb.b16-00364. [DOI] [PubMed] [Google Scholar]
- 13.Han B, Chao J, Yao H.. Circular RNA and its mechanisms in disease: from the bench to the clinic. Pharmacol Ther. 2018;187:31–44. doi: 10.1016/j.pharmthera.2018.01.010. [DOI] [PubMed] [Google Scholar]
- 14.Hsiao KY, Sun HS, Tsai SJ.. Circular RNA – New member of noncoding RNA with novel functions. Exp Biol Med (Maywood). 2017;242(11):1136–1141. doi: 10.1177/1535370217708978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hong X, Liu N, Liang Y, et al. Circular RNA CRIM1 functions as a ceRNA to promote nasopharyngeal carcinoma metastasis and docetaxel chemoresistance through upregulating FOXQ1. Mol Cancer. 2020;19(1):33. doi: 10.1186/s12943-020-01149-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Kulcheski FR, Christoff AP, Margis R.. Circular RNAs are miRNA sponges and can be used as a new class of biomarker. J Biotechnol. 2016;238:42–51. doi: 10.1016/j.jbiotec.2016.09.011. [DOI] [PubMed] [Google Scholar]
- 17.Jin J, Sun H, Shi C, et al. Circular RNA in renal diseases. J Cell Mol Med. 2020;24(12):6523–6533. doi: 10.1111/jcmm.15295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Huang J, Zhang Z, Liu B, et al. Identification of circular RNA expression profiles in renal fibrosis induced by obstructive injury. Ren Fail. 2021;43(1):1368–1377. doi: 10.1080/0886022X.2021.1979040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Cao Y, Shi Y, Wang Y, et al. Exosomal hsa_circ_0008925 from urine is related to chronic renal fibrosis. Dis Markers. 2022;2022:1899282–1899210. doi: 10.1155/2022/1899282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Chen F, Xie Y, Lv Q, et al. Curcumin mediates repulsive guidance molecule B (RGMb) in the treatment mechanism of renal fibrosis induced by unilateral ureteral obstruction. Ren Fail. 2021;43(1):1496–1505. doi: 10.1080/0886022X.2021.1997764. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wang H, Huang S, Hu T, et al. Circ_0000064 promotes high glucose-induced renal tubular epithelial cells injury to facilitate diabetic nephropathy progression through miR-532-3p/ROCK1 axis. BMC Endocr Disord. 2022;22(1):67. doi: 10.1186/s12902-022-00968-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Song J, Chen Y, Chen Y, et al. DKK3 promotes renal fibrosis by increasing MFF-mediated mitochondrial dysfunction in Wnt/beta-catenin pathway-dependent manner. Ren Fail. 2024;46(1):2343817. doi: 10.1080/0886022X.2024.2343817. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Chen S-J, Wu P, Sun L-J, et al. miR-204 regulates epithelial-mesenchymal transition by targeting SP1 in the tubular epithelial cells after acute kidney injury induced by ischemia-reperfusion. Oncol Rep. 2017;37(2):1148–1158. doi: 10.3892/or.2016.5294. [DOI] [PubMed] [Google Scholar]
- 24.Huang H, Zhang G, Ge Z.. lncRNA MALAT1 promotes renal fibrosis in diabetic nephropathy by targeting the miR-2355-3p/IL6ST axis. Front Pharmacol. 2021;12:647650. doi: 10.3389/fphar.2021.647650. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wang Z, Chen Z, Li B, et al. Curcumin attenuates renal interstitial fibrosis of obstructive nephropathy by suppressing epithelial-mesenchymal transition through inhibition of the TLR4/NF-small ka, CyrillicB and PI3K/AKT signalling pathways. Pharm Biol. 2020;58(1):828–837. doi: 10.1080/13880209.2020.1809462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Li R, Wang Y, Liu Y, et al. Curcumin inhibits transforming growth factor-beta1-induced EMT via PPARgamma pathway, not Smad pathway in renal tubular epithelial cells. PLoS One. 2013;8(3):e58848. doi: 10.1371/journal.pone.0058848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Chen Z, Song M, Wang T, et al. Role of circRNA in E3 Modification under Human Disease. Biomolecules. 2022;12(9):1320. doi: 10.3390/biom12091320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ye Y, Zhang L, Hu T, et al. CircRNA_103765 acts as a proinflammatory factor via sponging miR-30 family in Crohn’s disease. Sci Rep. 2021;11(1):565. doi: 10.1038/s41598-020-80663-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wang Y, Mo Y, Peng M, et al. The influence of circular RNAs on autophagy and disease progression. Autophagy. 2022;18(2):240–253. doi: 10.1080/15548627.2021.1917131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Qiu S, Li B, Xia Y, et al. CircTHBS1 drives gastric cancer progression by increasing INHBA mRNA expression and stability in a ceRNA- and RBP-dependent manner. Cell Death Dis. 2022;13(3):266. doi: 10.1038/s41419-022-04720-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Luo H, Lv W, Zhang H, et al. miR-204-5p inhibits cell proliferation and induces cell apoptosis in esophageal squamous cell carcinoma by regulating Nestin. Int J Med Sci. 2022;19(3):472–483. doi: 10.7150/ijms.67286. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Xiang P, Hu J, Wang H, et al. miR-204-5p is sponged by TUG1 to aggravate neuron damage induced by focal cerebral ischemia and reperfusion injury through upregulating COX2. Cell Death Discov. 2022;8(1):89. doi: 10.1038/s41420-022-00885-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Cheng Y, Wang D, Wang F, et al. Endogenous miR-204 protects the kidney against chronic injury in hypertension and diabetes. J Am Soc Nephrol. 2020;31(7):1539–1554. doi: 10.1681/ASN.2019101100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Xie Z, Chen J, Chen Z.. MicroRNA-204 attenuates oxidative stress damage of renal tubular epithelial cells in calcium oxalate kidney-stone formation via MUC4-mediated ERK signaling pathway. Urolithiasis. 2022;50(1):1–10. doi: 10.1007/s00240-021-01286-y. [DOI] [PubMed] [Google Scholar]
- 35.Lu H-Y, Wang G-Y, Zhao J-W, et al. Knockdown of lncRNA MALAT1 ameliorates acute kidney injury by mediating the miR-204/APOL1 pathway. J Clin Lab Anal. 2021;35(8):e23881. doi: 10.1002/jcla.23881. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Cech TR, Steitz JA.. The noncoding RNA revolution-trashing old rules to forge new ones. Cell. 2014;157(1):77–94. doi: 10.1016/j.cell.2014.03.008. [DOI] [PubMed] [Google Scholar]
- 37.Zhang Y, Zhang J, Xu Z, et al. Regulation of NcRNA-protein binding in diabetic foot. Biomed Pharmacother. 2023;160:114361. doi: 10.1016/j.biopha.2023.114361. [DOI] [PubMed] [Google Scholar]
- 38.Ma B, Wang S, Wu W, et al. Mechanisms of circRNA/lncRNA-miRNA interactions and applications in disease and drug research. Biomed Pharmacother. 2023;162:114672. doi: 10.1016/j.biopha.2023.114672. [DOI] [PubMed] [Google Scholar]
- 39.Martinez-Perez C, Leung J, Kay C, et al. The signal transducer IL6ST (gp130) as a predictive and prognostic biomarker in breast cancer. J Pers Med. 2021;11(7):618. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Xu S, Neamati N.. gp130: a promising drug target for cancer therapy. Expert Opin Ther Targets. 2013;17(11):1303–1328. doi: 10.1517/14728222.2013.830105. [DOI] [PubMed] [Google Scholar]
- 41.Knight DA, Ernst M, Anderson GP, et al. The role of gp130/IL-6 cytokines in the development of pulmonary fibrosis: critical determinants of disease susceptibility and progression? Pharmacol Ther. 2003;99(3):327–338. doi: 10.1016/s0163-7258(03)00095-0. [DOI] [PubMed] [Google Scholar]
- 42.Streetz KL, Tacke F, Leifeld L, et al. Interleukin 6/gp130-dependent pathways are protective during chronic liver diseases. Hepatology. 2003;38(1):218–229. doi: 10.1053/jhep.2003.50268. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.