Gene profile of virulence, antimicrobial resistance and action of enterocins in Campylobacter species isolated from broiler carcasses

Abstract

Campylobacteriosis is among the most reported zoonoses in the world, caused by species of Campylobacter, this disease is characterized by gastroenteritis in humans. The main species involved is Campylobacter jejuni, followed by Campylobacter coli. Contaminated chicken meat is often identified as an important source of infection related to human cases and Brazil is the largest exporter of chicken meat in the world, which makes the characterization of brazilian isolates crucial for the establishment of control measures. The objective was to evaluate the contamination of chilled and frozen carcasses sold in the Northeast of Brazil, by Campylobacter species, identify virulence genes, evaluate bacterial resistance to antibiotics and verify the antimicrobial action of the Crude Extract Containing Enterocins (CECE) produced by a probiotic strain of Enterococcus faecium. In this study, 12 chilled carcasses and 12 frozen carcasses were collected, sold retail in supermarkets. The following regions of the carcass were sampled: breast skin, wing skin, belly skin, neck skin, gizzard and liver. Samples of chicken carcasses were analyzed following ISO 10272-2 guidelines for the isolation of Campylobacter spp. The isolates were tested by PCR to identify genus, species C. jejuni, C. coli and C. lari and genes cdtA, cdtB, cdtC, sodB, dnaJ, cmeA, cmeB, cmeC. The assessment of susceptibility to antibiotics was carried out using the standard disk diffusion method and the antimicrobial activity of CECE was determined using the Minimum Inhibitory Concentration (MIC), the methodologies followed the recommendations and cutoff points according to EUCAST and CLSI. A total of 376 isolates of Campylobacter spp. were obtained, among these, 26 (7.0%) were positive for C. jejuni and no isolates were detected for C. coli and C. lari. The highest frequency of C. jejuni was obtained in chilled carcasses with 23 isolates (88.5%, p < 0.0001), in frozen carcasses three isolates were obtained (11.5%). The most frequency site of C. jejuni was the chest skin (7/27.0%), followed by skin of the wing (6/23.0%), skin of the cloaca (5/19.0%), gizzard (4/15.0%), skin of the neck (2/8.0%) and liver (2/8.0%), no significant differences were found between the sites sampled. The gene frequency was determined in: cdtA (3/11.5%), cdtB (3/11.5%), cdtC (5/19.0%), sodB (9/34.5%), dnaJ (3/11.5%), cmeA (4/15.0%), cmeB (4/15.0%) and cmeC (4/15.0%). The three efflux pump genes were amplified in four isolates (15.3%) and all tested genes were amplified in three isolates (11.5%). All C. jejuni isolates (26/100.0%) were found to be multiresistant to three or more classes of antimicrobials. The index of multiple resistance to antimicrobial drugs (IRMA) ranged from 0.4 to 1.0 among isolates of C. jejuni. The antimicrobial activity of CECE was able to inhibit at least 98.5% of the growth of all C. jejuni isolates. Therefore, chilled chicken carcasses present a greater risk of contamination than frozen carcasses, for this reason it is necessary to adopt practices that avoid cross-contamination during the preparation of chicken meat, in order to prevent campylobacteriosis. Furthermore, the presence of multiresistant and potentially virulent isolates highlights the need for further investigations to better understand the use of enterocins as alternative methods in the control of Campylobacter.

Introduction

The most reported zoonosis in the EU, campylobacteriosis is caused by species of Campylobacter sp. characterized by gastroenteritis in humans, with Campylobacter jejuni being the main species involved, followed by Campylobacter coli. According to EFSA’s Biological Hazards Panel (BIOHAZ) [1], the handling, preparation and consumption of chicken meat may be responsible up to 30% of human cases of campylobacteriosis [2]. In 2021, the number of confirmed cases of human campylobacteriosis increased by 2.1% compared to 2020, with an EU notification rate of 41.1 per 100,000 population [3].

Campylobacter may still be related to Hemolytic Uremic Syndrome [4, 5] and it is estimated that 1 in every 1,000 people infected with Campylobacter is diagnosed with Guillain-Barré Syndrome in the United States [6]. In addition to the damage generated to human health, the occurrence of this disease causes a series of losses to the sectors involved, in low- and middle- income countries, approximately 600 million people get sick and with that are lost in productivity and medical expenses, around US$ 110 billion each year resulting from the consumption of unsafe food [7]. Brazil occupies a prominent place on the world stage in food production, as the largest exporter and second largest producer of chicken meat in the world [8].

Poultry is widely recognized as the natural host of Campylobacter species. Colonization rates in broiler flocks range from 3 to 90%, with the highest rates found in flocks older than 3 weeks [9, 10]. The colonization of the gastrointestinal tract of poultry usually proceeds without any distinct clinical manifestations and affects the small intestine, the cecum, and the cloaca, however, the extent of the appearance of clinical signs can be attributed to the immune system’s responsiveness to Campylobacter spp infection [11].

Despite the zoonotic potential, Brazilian legislation does not recommend the control of Campylobacter spp., in addition, the underreporting of Campylobacteriosis cases represents an important risk factor for the world population. Therefore, interest in this pathogen in developing countries has been driven by the increasing resistance trend of Campylobacter spp. all around the world [12–15]. In this sense, there is a need for research to support preventive actions in the production chain to guarantee the safety of the final product offered to the consumer.

Reports of antimicrobial-resistant strains of C. jejuni have been frequente [16, 17]. European Union (EU) data revealed a close association between antibiotics administered to animals and the development and spread of antimicrobial resistance (AMR) in humans [18]. Given the above, there is a particular need for new antimicrobial agents, specifically those directed against antibiotic-resistant bacteria, including Campylobacter [19, 20]. Research has demonstrated the efficiency of enterocins in controlling pathogenic bacteria and suggests a potential alternative to traditional antibiotics [21–23].

The objective of this study is to identify the contamination of chilled and frozen carcasses, sold at retail in supermarkets, by Campylobacter species and virulence genes related to human infections. As well as, evaluate the effectiveness of the Crude Extract Containing Enterocins (CECE) produced by E. faecium in the biological control of Campylobacter and the response of these isolates to antimicrobials used in poultry farming.

Materials and methods

Sample location and collection

The study analyzed broiler carcasses sold in three large supermarket chains, located in the Northeast region of Brazil. The samples were packed in isothermal boxes (2–8 °C) with recyclable ice and sent to the Meat and Milk Inspection Laboratory (LICAL) of the Department of Veterinary Medicine (DMV) of the Federal Rural University of Pernambuco (UFRPE). Carcasses from six Brazilian chicken brands were evaluated and all carcasses had the Federal Inspection Seal (SIF) or State Inspection Seal (SIE). In this study, 12 chilled carcasses and 12 frozen carcasses were collected, totaling 24 carcasses, the following samples were collected from each carcass: chest skin, wing skin, cloaca skin, neck skin, gizzard and liver.

Isolation de Campylobacter spp. and phenotypic identification

Samples were analyzed following ISO 10272-2 [24] guidelines for the isolation of Campylobacter spp. Initially, 10 g of each sample was kept in Bolton Broth (Neogen^® Culture Media – Lansing, USA) supplemented with vancomycin (10 mg) and amphotericin (10 mg), and stirred for 1 min in a Stomacher (Matoli^® 100M048 – Carapicuíba, Brazil), the samples were subjected to a shaking system using 2 blades (homogenizers), at a speed of 200 spm (strokes per minute). For the recovery of injured cells, the samples were kept at 41.5 °C ± 1 °C for 48 h, under microaerobic conditions, for this, the samples were kept in anaerobic jars containing a microarophilia generator (Anaeropack – Laborclin Products for Laboratories Ltda. Pinhais, Brazil). After enrichment, the samples were seeded on Charcoal Cefoperozone Desoxycholate - CCDA (Neogen^® Culture Media – Lansing, USA) and Campy Cefex agar (Neogen^® Culture Media – Lansing, USA), both supplemented with vancomycin (10 mg) and amphotericin (10 mg) and subsequently incubated under the same conditions of time and temperature already mentioned. Suspected colonies of Campylobacter spp., based on the colony morphology for each medium used, were selected and replicated for new cultures in Columbia Blood Aga (HiMedia Laboratories Pvt. Ltd. Thane, India) supplemented with defibrinated sheep blood, following the same incubation pattern. All isolates with typical colony morphology were subjected to the Gram staining procedure and catalase test for further identification by polymerase chain reaction (PCR).

DNA extraction

Genomic DNA from all isolates was extracted using a thermal extraction protocol [25]. The DNA obtained was quantified in a spectrophotometer with absorbance readings of 260 nm. Samples were stored in a freezer at -20 °C until PCR analysis; this storage time did not exceed 48 h.

Molecular identification

The identification of the genus Campylobacter spp. was carried out by PCR with amplification of 16 S rDNA. Samples positive for genus were directed to identify the species: C. jejuni, C. coli and C. lari, through amplification of the mapA, ceuE and glyA genes, respectively. In samples positive for the species researched, the virulence genes cdtA, cdtB and cdtC were investigated, responsible for the production of the Cytoletal Distending Toxin, composed of three subunits, which interact with each other to form an active tripartite holotoxin, responsible for damage to the host cell. The following genes were also investigated: sodB, involved in the production of the enzyme superoxide dismutase, promotes resistance to oxidative stress, related to bacterial survival in adverse conditions and the dnaJ gene, associated with adhesion and colonization to host cell and responsible for encoding a heat shock protein. Genes related to the efflux pump were also investigated: cmeA, cmeB, cmeC, which confers antimicrobial resistance through a mechanism that promotes the expulsion of toxic substrates from the interior of the bacterial cell. The sequence of primers and references are described below (Table 1). The reference strains C. jejuni (ATCC 29428), C. coli (CCAMP 1068), C. lari (CCAMP 1012) and the cmeA, cmeB, cmeC, cdtA, cdtB, cdtC, dnaJ, sodB genes (CCAMP1064 and CCAMP 1065), were kindly provided by the Bacterial Zoonoses Laboratory of Instituto Oswaldo Cruz - Fiocruz.

Table 1.

Primer sequences used for the uniplex PCR assay and predicted sizes of PCR products

Target genes	Primer*	Sequence (5’-3’)	Size (bp)	Reference
Campylobacter spp. 16 S rDNA	16 S rDNA F	GGAGGCAGCAGTAGGGAAA	1.062	[81]
	16 S rDNA R	TGACGGGCGGTGAGTACAG
Campylobacter jejuni	mapA R	AGTCCTGGTGGTTTGAAGC	202	[82]
	mapA F	CCGCATTAAAATTCACATCG
Campylobacter coli	ceuE F	ATGAAAAAATCTTTAGTTTTTGCA	889
	ceuE R	ATTTTATTATTTGTAGCAGCG
Campylobacter lari	glyA F	TAGAGAGATAGCAAAAGAGA	251	[83]
	glyA R	TACACATAATAATCCCACCC
Toxin production
cdtA	cdtA F	CCTTGTGATGCAAGCAATC	370	[84]
	cdtA R	ACACTCCATTTGCTTTCTG
cdtB	cdtB F	CAGAAAGCAAATGGAGTGTT	620	[85]
	cdtB R	AGCTAAAAGCGGTGGAGTAT
cdtC	cdtC F	CGATGAGTTAAAACAAAAAGATA	182
	cdtC R	TTGGCATTATAGAAAATACAGTT
Stress response and survival
sodB	sodB F	AAGTACAGGCTGTGGCTGTG	300	[68]
	sodB R	AAATAAGCAGGGCGTGCATTG
Adhesion
dnaJ	dnaJ F	CCGCGTATGGTGGGTACTTT	646
	dnaJ R	AAGGCGGTGGATTTGGTTCT
Multidrug resistance genes (Efflux pump)
cmeA	cmeA F	TGTGCATCAGCTCCTGTGTAA	957	[68]
	cmeA R	ACGGACAAGCTTTGATGGCT
cmeB	cmeB F	TGCGGGTTGACCTTGAACTT	993
	cmeB R	TGTGCACTCTTTTTGCGACG
cmeC	cmeC F	CAACCGCAGCATTAAGCCAA	364
	cmeC R	TTGGGATTTGAAAGCGGGGA

* F = Forward, R = Reverse

The PCR thermal profile used for detection of the Campylobacter genus was as follows: 94 °C for 6 min for initial denaturation followed by 35 cycles of denaturation at 94 °C for 50 s, annealing temperature at 57 °C for 40 s, primer extension step at 72 °C for 50 s, and final extension step at 72 °C for 3 min. For detection of C. jejuni and C. coli, the following were used: 95 °C for 5 min for initial denaturation followed by 30 cycles of denaturation at 95 °C for 1 min, annealing temperature at 54 °C for 1 min, primer extension step at 72 °C for 1 min and final extension step at 72 °C for 10 min. The detection of C. lari was according to the thermal profile contained in the reference used for primer. For detection of virulence and resistance genes, the thermal profile used was: 95 °C for 1 min for initial denaturation followed by 35 cycles of denaturation at 95 °C for 1 min, annealing temperature at 55 °C for 1 min, primer extension at 72 °C for 1 min and final extension step at 72 °C for 5 min. Reference strains were used as positive controls and milli-q water as a negative control. The PCR products were subjected to electrophoresis in 1.5% agarose gel for 60 min at 80 V. At the end of the run, BlueGreen stained gels (LGC Biosearch Technologies™ – Middleton, USA) were visualized under ultraviolet light and photographed by a photodocumentation system (Loccus Biotecnologia^®, Model: L-PIX – Cotia, Brazil).

Antibiotic susceptibility profile

Antibiotic susceptibility assessment was performed for ten antibiotics by the standard disk diffusion method, according to [26]. Isolates were recovered and bacterial cells were removed from Columbia agar (HiMedia Laboratories Pvt. Ltd. Thane, India) and deposited in a 0.85% NaCl solution to prepare suspensions adjusted to the 0.5 MacFarland scale. Each suspension was inoculated onto Mueller-Hinton agar (HiMedia Laboratories Pvt. Ltd. Thane, India) supplemented with 5% defibrinated horse blood, incubated at 41.5 °C ± 1 °C for 48 h in a microaerobic atmosphere, for this, the samples were kept in anaerobic jars containing a microarophilia generator (Anaeropack – Laborclin Products for Laboratories Ltda. Pinhais, Brazil).

Antimicrobial susceptibility testing was performed for ampicillin (AMP), ciprofloxacin (CIP), clindamycin (CLI), doxycycline (DOX), erythromycin (ERY), fosfomycin (FOS), gentamicin (GEN), norfloxacin (NOR) and tetracycline (TET), and the cutoff points recommended by the European Committee for Antimicrobial Susceptibility Testing [18] were used. For enrofloxacin (ENR) the breakpoints recommended by the Institute of Clinical and Laboratory Standards for Veterinary Antimicrobial Susceptibility Testing [27] were used (Table 2). The choice of antimicrobials used in this study was based on the wide use of these antimicrobials in human and animal health.

Table 2.

Breakpoints used for antimicrobial susceptibility testing by disk diffusion method

Antimicrobial groups	Antimicrobial agent	Zone diameter breakpoints (mm) – EUCAST 20231
		Susceptible ≥	Susceptible, increased exposure	Resistant <
Penicillins	Ampicillin 10 µg 3	14	-	14
Fluoroquinolones	Ciprofloxacin 5 µg 2	50	26–49	26
	Norfloxacin 10 µg 3	24	-	24
Lincosamides	Clindamycin 2 µg 4	19	-	19
Tetracyclines	Doxycycline 30 µg 2	30	-	30
	Tetracycline 30 µg 2	30	-	30
Macrolides	Erythromycin 15 µg 2	20	-	20
Fosfomycin	Fosfomycin 200 µg 3	21	-	21
Aminoglycosides	Gentamicin 10 µg 3	17	-	17
		Zone diameter breakpoints (mm) CLSI-VET 2020 1
		Susceptible ≥	Intermediary	Resistant ≤
Fluoroquinolones	Enrofloxacin 5µg 5	23	17–22	16

¹ CLSI-VET = CLSI breakpoints used in veterinary medicine (CLSI, 2020); EUCAST = European antimicrobial susceptibility testing (EUCAST, 2023)

² Antibiotic with interpretative breakpoint based on Campylobacter jejuni data in EUCAST (EUCAST, 2023)

³ Antibiotic with interpretative breakpoint based on Enterobacterales data in EUCAST (EUCAST, 2023)

⁴ Antibiotic with interpretative breakpoint based on anaerobic bacteria data in EUCAST (EUCAST, 2023)

⁵ Antibiotic with interpretative breakpoint based on Enterobacterales data in CLSI-VET (CLSI,2020)

The multiple antimicrobial resistance index (IRMA) was calculated according to the methodology described by Kruperman [28]. This index is determined by the ratio between the number of antimicrobials that the sample is resistant to and the total number of antimicrobials tested.

Obtaining the crude extract containing enterocins (CECE)

The probiotic strain Enterococcus faecium EF141V was used [29–31], which belongs to a bacteriotheque of the Bioactive Products Technology Laboratory (LABTECBIO) at UFRPE. E. faecium 141v strains at a concentration of 20% (v/v) were added to MRS broth (deMan, Rogosa and Sharpe – HiMedia Laboratories Pvt, Ltd. Mumbai, India) and incubated at 37 °C for 18 h. After this time, the culture was centrifuged at 6,500 rpm for 20 min at 4 °C, obtaining the supernatant containing enterocins, called Crude Extract Containing Enterocins (CECE).

Antimicrobial activity of crude extract containing enterocins (CECE)

For the Concentration Method (MIC), CECE was used against isolates of C. jejuni, at a concentration of 0.5 on the McFarland scale (equivalent to 10⁸ cells/mL), according to CLSI [32]. The following CECE concentrations were tested: 500, 250, 125, 100, 62.5, 50, 31.25, 25, 15.25, 12.5 and 6.25 mg/Ml, these serial dilutions of CECE were performed in Mueller Hinton Broth (HiMedia Laboratories Pvt, Ltd. Mumbai, India); the experiment was carried out in triplicate, with repetitions for checks. The samples were kept at 41.5 °C ± 1 °C for 48 h in anaerobic jars containing a microarophilia generator (Anaeropack – Laborclin Products for Laboratories Ltda. Pinhais, Brazil). After incubation, optical densities (OD) were obtained using a Spectrophotometer (iMark Microplate Absorbance Reader – Bio-Rad Laboratories, Inc. Irvine, USA) with a 595 nm filter.

The percentages of growth inhibition and different concentrations of enterocins for each microorganism were calculated according to Gudiña et al. [33], according to the formula: Growth Inhibition: [1-(Ac/A0)] x 100. Where, Ac represents the absorbance of the well with a concentration of enterocins and A0 the absorbance of the control well (without CECE). For calculation, the average of the ODs obtained in triplicates was used. The result represents the percentage of microbial cells that the tested substance was able to inhibit. To confirm the quantitative findings, readings were performed with Resazurin developer at a concentration of 100 µg/mL, in which 30 µL were added to each well of the microplate with the MIC. After 2 h of incubation in a dark chamber, the absence of microbial growth was evaluated, represented by the blue color and the presence of growth by the pink color [34].

Statistical analysis

The statistical analysis used was the chi-square test and Fisher’s Exact Test using the SAS 9.4 statistical program. Differences were considered significant when p < 0.05.

Results

Frequency of Campylobacter species in chilled and frozen carcasses

According to molecular identification, a total of 376 isolates positive for Campylobacter spp. were obtained, of these 26 (7.0%) isolates were positive for C. jejuni and no isolate was positive for C. coli or C. lari. The highest frequency of C. jejuni was obtained in chilled carcasses with 23 isolates (88.5%, p < 0.0001) and in frozen carcasses 3 isolates were obtained (11.5%). The most frequency site of C. jejuni was the skin of the breast (7/27.0%), followed by skin of the wing (6/23.0%), skin of the cloaca (5/19.0%) and skin of the neck (2/8.0%), gizzard (4/15.0%), liver (2/8.0%) no significant differences were found between the sites sampled (Table 3). All evaluated carcasses from six brazilian chicken brands showed positive isolates for Campylobacter spp. and three brands had positive isolates for C. jejuni. The distribution of isolates is detailed in Fig. 1.

Table 3.

Frequency of Campylobacter species in chilled and frozen carcasses sold in Pernambuco

	Sampling location	N positive samples (%)*
		Campylobacter spp.	C. jejuni	C. coli	C. lari
Chilled carcasses	Chest skin	31	6	0	0
	Wing skin	31	5	0	0
	Cloaca skin	36	5	0	0
	Neck skin	34	2	0	0
	Gizzard	29	3	0	0
	Liver	33	2	0	0
	Total in chilled carcasses	194 (51.5%)	23 (88.5%)	-	-
Frozen carcasses	Chest skin	31	1	0	0
	Wing skin	32	1	0	0
	Cloaca skin	30	0	0	0
	Neck skin	32	0	0	0
	Gizzard	26	1	0	0
	Liver	31	0	0	0
	Total in frozen carcasses	182 (48.5%)	3 (11.5%)	-	-
Total		376 (100%)	26 (7%)	-	-

*Values in approximate percentages

Fig. 1.

Campylobacter spp. and C. jejuni of six Brazilian chicken brands sold in supermarkets

Antimicrobial resistance and multidrug profiles of C. Jejuni

The analysis of C. jejuni antimicrobial resistance shows isolates having higher resistance to clindamycin (26/100%), doxycycline (26/100%), erythromycin (26/100%), tetracycline (26/100%), ciprofloxacin (23/88.5%), enrofloxacin (23/88.5%) and norfloxacin (23/88.5%). Moreover, part of the isolates showed resistance to ampicillin (15/57.7%) and gentamicin (13/50.0%). The smallest number of isolates (2/7.7%) were resistant to fosfomycin.

Multidrug resistance to three or more classes of antimicrobials was found in 100% (n = 26) of C. jejuni isolates. All isolates were resistant to clindamycin, erythromycin, doxycycline and tetracycline, referring to the classes: lincosamides, macrolides and tetracyclines, respectively. The most frequent pattern of antimicrobial resistance was CLI-DOX-ERY-TET-AMP-CIP-GEN-NOR-ENR, present in 30.7% (8/26) of the isolates. Furthermore, one isolate was resistant to all tested antimicrobials (Table 4). In the present study, the multiple antimicrobial resistance index (IRMA) ranged from 0.4 to 1.0 among C. jejuni isolates, as described in Table 5.

Table 4.

Multi-resistant profiles of C. Jejuni from chilled and frozen carcasses

Antimicrobial resistance profile*	N° of resistant isolates (%)
CLI-DOX-ERY-TET-AMP-CIP-GEN-NOR-ENR	8 (30.7%)
CLI-DOX-ERY-TET-CIP-NOR-ENR	5 (19.2%)
CLI-DOX-ERY-TET-AMP-CIP-NOR-ENR	4 (15.3%)
CLI-DOX-ERY-TET-CIP-GEN-NOR-ENR	3 (11.5%)
CLI-DOX-ERY-TET-AMP-CIP-GEN-FOS-NOR-ENR	1 (3.8%)
CLI-DOX-ERY-TET-CIP-GEN-FOS-NOR-ENR	1 (3.8%)
CLI-DOX-ERY-TET-AMP	1 (3.8%)
CLI-DOX-ERY-TET-AMP-CIP-ENR	1 (3.8%)
CLI-DOX-ERY-TET-NOR	1 (3.8%)
CLI-DOX-ERY-TET	1 (3.8%)

* Acronyms: AMP = Ampicillin, CIP = Ciprofloxacin, CLI = Clindamycin, DOX = Doxycycline, ENR = Enrofloxacin, ERY = Erythromycin, FOS = Fosfomycin, GEN = Gentamicin, NOR = Norfloxacin, TET = Tetracycline

Table 5.

Description of the index of multiple antimicrobial drug resistance (IRMA) found in Campylobacter jejuni from broiler chicken carcasses

IRMA	C. jejuni
	Absolute value	Relative value (%)
0.4	1	3.8
0.5	2	7.7
0.7	6	23.1
0.8	7	27.0
0.9	9	34.6
1.0	1	3.8
Total	26	100.0

Virulence profile of C. Jejuni

C. jejuni isolates showed the highest frequency for the sodB gene, being detected in 10 isolates (34.5%). The genes encoding the cytolethal distending toxin showed different frequencys, cdtA and cdtB were detected in three isolates (11.5%), while cdtC was detected in five isolates (19.0%). With a similar frequency to cdtA and cdtB, the dnaJ gene was detected in the same three isolates (11.5%). Related to antimicrobial resistance, the presence of the three efflux pump genes (cmeA, cmeB and cmeC) was detected in four isolates (15.3%). Furthermore, three (11.5%) isolates were positive for all evaluated genes. Virulence profiles were determined through association of virulence genes (Table 6).

Table 6.

Association of virulence genes in C. Jejuni from chicken carcasses

C. jejuni	Virulence profile
3 (11.5%)	cdtA, cdtB, cdtC, dnaJ, sodB, cmeA, cmeB, cmeC
2 (7.7%)	cdtC, sodB
1 (3.8%)	cmeA, cmeB, cmeC

Resistance and virulence genes related to antimicrobial resistance of C. Jejuni

Only one isolate (3.8%) showed resistance to all antimicrobial groups tested and the cmeA, cmeB and cmeC genes were detected. In three isolates (11.5%) that presented all investigated genes, they also showed resistance to most antimicrobials, of these, two isolates (7.7%) were resistant to ampicillin, clindamycin, doxycycline, erythromycin, enrofloxacin, norfloxacin, tetracycline, ciprofloxacin and gentamicin and one isolate (3.8%) was resistant to ampicillin, clindamycin, doxycycline, erythromycin, enrofloxacin, norfloxacin and tetracycline.

Most of the isolates that presented virulence and/or resistance genes were resistant to seven or eight groups of antimicrobials, the description of the genetic profile of Multidrug Resistance (MDR) of C. jejuni isolates is detailed in Table 7.

Table 7.

Genetic profile of multidrug resistance (MDR) C. Jejuni

Gene presence	MDR (%)
	3–4 groups	5–6 groups	7–8 groups	Total
sodB	2 (22.0%)	3 (33.5%)	4 (44.5%)	9 (100%)
cdtA	1 (33.5%)	0	2 (66.5%)	3 (100%)
cdtB	1 (33.5%)	0	2 (66.5%)	3 (100%)
cdtC	1 (20.0%)	0	4 (80.0%)	5 (100%)
dnaJ	1 (33.5%)	0	2 (66.5%)	3 (100%)
cmeA	1 (25.0%)	0	3 (75.0%)	4 (100%)
cmeB	1 (25.0%)	0	3 (75.0%)	4 (100%)
cmeC	1 (25.0%)	0	3 (75.0%)	4 (100%)

Response to the antimicrobial action of crude extract containing enterocins (CECE)

To indicate the antimicrobial activity of CECE against C. jejuni, results as from 80% inhibition were considered. At the highest concentration evaluated, 500 mg/mL, 13 isolates showed inhibition between 93 and 98% and seven isolates between 80 and 86% inhibition. The concentration of 250 mg/mL showed the best result, capable of inhibiting at least 98.5% of growth in all isolates (26 isolates). The lowest concentration obtained with inhibition capacity was 125 mg/mL, with three isolates showed between 94 and 97% inhibition and three isolates between 82 and 84% inhibition. Concentrations lower than 125 mg/mL were not capable of inhibiting the growth of C. jejuni. The results were confirmed by qualitative data using the chemical developer Resazurin. The distribution of the results of CECE’s antimicrobial action against C. jejuni isolates is shown in Fig. 2.

Fig. 2.

Antimicrobial activity of crude extract containing enterocins (CECE) against C. jejuni

Discussion

C. jejuni is, in general, the most prevalent species of thermotolerant Campylobacter in industrial poultry [35, 36]. In the present study, the presence of cultivable C. jejuni was verified in chilled and frozen carcasses, in three chicken companies from six evaluated in this study. The same did not occur with C. coli and C. lari, as the presence of cultivable cells was not found in any sample. Recent studies have demonstrated that contamination of carcasses in the slaughterhouse is mainly by C. jejuni and observed that contamination by C. coli decreases considerably after cooling the carcass, justifying this fact to a possible vulnerability of C. coli to the stress conditions found in poultry refrigerators [15, 37, 38].

Different strategies may be involved in the survival and persistence of C. jejuni along the poultry food chain, but in the slaughterhouse, which is the last step in the poultry meat production chain, before retail sale, it has been associated with the ability to form biofilms [39–41]. In addition, conservation methods can influence the survival of C. jejuni, our results demonstrated a greater probability of contamination in cooled carcasses than in frozen carcasses (p < 0.001), suggesting that freezing can inactivate cultivable cells.

Studies that evaluated C. jejuni in carcasses and other poultry products in different conservation methods, obtained similar results and indicated that freezing stress could induce the formation of the viable but non-culturable stage (VBNC), resulting in a decrease in the bacterial count viable during isolation, but despite the reduction, freezing did not completely eliminate the presence of C. jejuni [42, 43]. A study carried out in Brazil with chilled and frozen carcasses found similar results and concluded that chilled chicken carcasses represent a greater risk to public health in relation to the transmission of Campylobacter, in addition, it revealed a high contamination of the tested samples, which can be justified due to the collection site, since the samples were obtained from slaughterhouses, differing from the present study, whose samples were collected at consumer points of sale, subjecting the bacterial cell to a longer freezing time and consequent cell injury [44].

The breast skin was the site with the highest number of C. jejuni isolates and the sites with the least contamination were the liver and neck skin, even without obtaining significant values between the sampled carcass sites, the contamination of the breast area can be justified by greater area of exposure to cross-contamination. In Brazil, a similar study found that breast fillets exhibited the highest contamination rate (25%; 5/20), followed by wings (15%; 6/40), whole leg (15%; 3/20), drumstick (10%; 2/20), and drumette (5%; 1/20) [45]. Studies that evaluated the bacterial load in carcasses during the slaughter stages point to cross-contamination by Campylobacter as an important factor to be considered in the slaughter process [46, 47].

The high rate of MDR isolates found revealed alarming data regarding the use of antimicrobials in Brazilian industrial poultry. In this study all isolates (100%) were resistant to the three classes of antimicrobials: lincosamides, tetracyclines and macrolides. Often, the emergence of resistant strains has been associated with the use of antimicrobials in production animals [48–51]. A systematic survey in low- and middle-income countries (LMICs) between the years 2010 to 2021 found an overall mean multiple antibiotic resistance index of 0.34 ± 0.16, which is above the high-risk threshold, from 0.2 [52].

Similar results were found in India, with 92.3% (12/13) of MDR isolates, including C. jejuni and C. coli, with highest reported resistance against tetracyclines with 84.61% (11/13), followed by macrolides with 61.53% (8/13) of resistant isolates [14]. In China, C. jejuni isolates were mainly resistant to ciprofloxacin with 88.1%, (141/160), followed by resistance to tetracycline with 79.4% (127/160) and levofloxacin with 78.1% (125/160), with 91.3% (146/160) of MDR isolates [53]. In the same country, another study verified an infection rate of 10.8% (35/324) of C. jejuni, with greater resistance to ampicillin with 85.7% (30/35) and 88.6% (31/35) of MDR isolates [54]. In contrast, in Costa Rica, Campylobacter spp. isolates showed resistance to quinolones (64.9% – 96/148), followed by resistance to quinolones with tetracyclines (24.3% – 36/148) and none of the analyzed isolates showed a multiresistant profile [55]. Different results in relation to the levels of resistance found, perhaps reflect the adoption of different national and regional policies on the use of antimicrobial agents for animal feed, mainly in industrial poultry.

In this sense, Brazil has made efforts to combat resistance within the scope of One Health, the country has the National Action Plan for the Prevention and Control of Resistance to Antimicrobials in Agriculture, with specific actions to be developed by the agricultural sector in the fight against antimicrobial resistance (AMR) [56]. Since January 2020, the country has banned the import, manufacture, sale and use of performance-enhancing additives containing antimicrobials tylosin, lincomycin and tiamulin, classified as important in human medicine [57]. Despite being used more widely in veterinary medicine, they belong to the antimicrobial classes: macrolides, lincosamides and pleuromutilins, widely used in human clinical medicine [56].

In southern Brazil, MDR isolates of C. jenuni obtained from chicken meat in products sold at retail, showed similar results, with greater resistance to tetracyclines: TET (71.4% – 30/42) and DOX (61.9% – 26/42); however, they showed low resistance to macrolides (38% – 16/42) and justified this by the low use of this antimicrobial in poultry in the region, avoiding selective pressure [58]. Brazil has an extensive territorial area and this brings great differences in industrial poultry farming, some socioeconomic factors, production systems, relief, rainfall and meteorological indices, determining the challenges faced in the studied region and justifying the small variations found in relation to the multiresistance of isolates of C. jejuni in the same country.

In this study, the most frequent pattern of antimicrobial resistance was CLI-DOX-ERY-TET-AMP-CIP-GEN-NOR-ENR, present in 30.7% (8/26) isolates, and the second most frequent was CLI-DOX-ERY-TET-CIP-NOR-ENR present in 19.2% (5/26) of C. jejuni isolates. A similar study revealed the highest frequency for the AMP-NOR-CIP-LEV-TE-NA-CTX resistance profile present in 28.6% (10/35) of C. jejuni isolates, with the second highest frequency for the AMP-NOR-CIP-LEV-TE-NA-DA-CTX resistance profile present in 11.4% of isolates [54].

Despite the variations found, resistance to tetracyclines and macrolides is worrying, since they are important antimicrobials for animal and human health because they exhibit broad-spectrum activity against gram-negative and gram-positive bacteria [59]. One study demonstrated that the mean prevalence of antibiotic resistance (M50) of tetracyclines was higher in Campylobacter spp. (above 70%) among Gram-negative bacteria [52]. Macrolides, in turn, are one of the few available therapies for severe Campylobacter infections, particularly in children, for whom quinolones are not recommended for treatment [59].

Another worrying factor for public health is the ability of MDR strains to remain cultivable after heat stress. A study found that antimicrobial resistance could influence the response to heat stress, by verifying that Campylobacter (ATCC 33560) resistant to ciprofloxacin, showed greater survival in water at a temperature of 4 °C than susceptible strains [60]. In addition, resistant bacteria in animals can directly or indirectly infect humans through food, water, mud and manure, which are used as fertilizers [50]. In Brazil, a study revealed that the number of C. jejuni strains resistant to ciprofloxacin, tetracycline, doxycycline, and erythromycin was 51 (44%), 41 (35.3%), 41 (35.3%), and 6 (5.2%), respectively. Specifically, 22 C. jejuni strains isolated from animals (12), humans (7), and food (3) were resistant to ciprofloxacin, tetracycline, and doxycycline, simultaneously [61].

The frequent use of antimicrobials in food production provides selective pressure and favors the horizontal transfer of antimicrobial resistance genes, leading to the emergence of resistant strains [62, 63]. In 2030, it is estimated that the 10 largest animal protein producing countries will use 72% of the total antimicrobials consumed worldwide and Brazil occupies second place in this ranking, with an estimated value of 7.9% of the global consumption of antimicrobials, behind from China (43%), followed by the United States (6.5%), Thailand (4.0%), India (2.1%), Spain (1.9%), Russia (1.9%), Mexico (1.8%), Iran (1.5%) and Argentina (1.5%) [64].

The presence of MDR isolates carrying virulence and resistance genes observed in this study is worrying and revealed the highest frequency of the sodB gene (34.0%) among the C. jejuni. Under atmospheric conditions, Campylobacter is exposed to oxidative stress with the production of several toxic reactive oxygen species (ROS) and among the common defense enzymes against oxidative stress, the enzyme superoxide dismutase (sodB) stands out, which is directly involved in the degradation and removal of ROS [65]. Thus, a microaerophilic pathogen such as Campylobacter could survive under aerobic conditions depending on the expression of related virulence genes [66].

Another aspect related to virulence is the ability of Campylobacter strains to produce toxins [67]. In this study, the second highest frequency among the genes researched, was for the cdtC gene (19.0%), followed by cdtA (11.5%) and cdtB (11.5%). Called cytolethal distending toxin (CDT), it is composed of three subunits cdtA, cdtB and cdtC, all of which are necessary for cytotoxin expression, regardless of the origin and species of isolation [68]. Despite the low frequency found, 11.5% of the MDR isolates had the three genes necessary for expression of the cytotoxin, characterizing potentially virulent strains resistant to different classes of antimicrobials.

Furthermore, a study carried out in a slaughterhouse found that 80.0% (102/128) of the C. jejuni isolates had the cdt gene, however, it mentioned that the presence of genetic virulence factors is not a direct evidence that such strains are pathogenic for humans; but it strongly suggests that they may potentially be capable of inducing disease [69]. Campylobacter has complex multifactorial systems for multiplication in broilers, survival during food processing, and virulence in humans, including motility, chemotaxis, adhesion, invasion, antioxidant defense, heat shock, and the ability to enter the VBNC state [70].

In our study, a frequency of the dnaJ gene was observed in 11.5% of the C. jejuni isolates. When evaluating isolates from broiler chickens in Tunisia, there was a frequency of 100% for the cdtA, cdtB and cdtC genes, while the dnaJ gene showed a frequency of 50% (45/91) among the isolates of C. jejuni [71]. The dnaJ gene, which encodes a heat shock protein, is closely linked to adhesion and colonization in the host cell, as it was found that mutations in this gene caused a severe reduction in the colonization process [72]. The low prevalence of the dnaJ gene in our study was similar to another study carried out in Brazil, detected in 12% (10/83) of C. coli isolates [73]. In the same country, 20% (10/50) of human and animal samples showed the dnaJ gene [74], but a 100% (n = 68) occurrence in C. jejuni has been mentioned in human isolates from Chile [75].

Resistance genes were detected in 15.0% (4/26) of the C. jejuni isolates and it is noteworthy that in these isolates all the three genes were detected (cmeA, cmeB and cmeC). However, no significant relationship was found between MDR isolates and gene detection. Thus, the presence of resistance genes related to the efflux pump is not the only factor involved in bacterial resistance capacity, as we found a low frequency of these genes in MDR isolates, which suggests the presence of more genes that confer other resistance mechanisms.

Our data also revealed a potential antimicrobial activity of CECE against C. jejuni isolates. Despite being an initial study regarding the interaction of CECE with Campylobacter jejuni isolates, the results of antimicrobial activity were satisfactory at a concentration of 250 mg/mL in all isolates evaluated. The highest concentration evaluated (500 mg/mL) was not effective on all isolates, this can be justified by a possible interference from other components, as no purification process was used, which can be better elucidated through continued research, given these initial results. In a pioneering study, the potential for bacterial inhibition of the postbiotic produced by a strain of E. faecium was verified, by inhibiting the growth of reference strains of C. jejuni and C. coli, with satisfactory results at concentrations of 500 mg /mL to 25 mg/mL [76].

Such evidence suggests the possibility of using products from probiotic strains of E. faecium to mitigate Campylobacter in poultry farming. Since the bacterial resistance presented in this study to different classes of antimicrobials, used in both veterinary and human medicine, indicates the need for alternative methods to the use of antimicrobials.

In this study, the presence of cultivable isolates of C. jejuni in both chilled and frozen carcasses sold in supermarkets indicates a risk to public health. In the same country, Campylobacter has been reported in chicken meat and other foods of animal origin [77, 78], as well as in human feces [78]. In this sense, prevention methods include appropriate practices during domestic or industrial preparation, to avoid cross-contamination, since the consumption of raw meat is not a habit in most countries.

However, the absence or deficiency in control and inspection of the quality of food offered to the population has a significant impact on the transmission of foodborne and waterborne illnesses, requiring greater commitment from health surveillance bodies and companies producing and selling food [79, 80].

Although Brazil does not yet have a Campylobacter control system in industrial poultry farming, the country has a network of Central Public Health Laboratories (LACENs), which is structured to provide, among other attributes, laboratory analyzes to support the Brazilian system of epidemiological surveillance of foodborne diseases [56]. However, Campylobacter is not routinely tested in foodborne illness investigations. Therefore, the incidence of foodborne campylobacteriosis may be underestimated in Brazil.

Conclusion

Chilled chicken carcasses present a greater risk of contamination than frozen carcasses, therefore it is necessary to adopt practices that avoid cross-contamination during the preparation of chicken meat, in order to prevent campylobacteriosis. The detection of important virulence genes in multidrug-resistant C. jejuni emphasizes the risk to public health and highlights the need for alternative methods. Therefore, new investigations must be carried out to better understand the use of enterocins in the control of Campylobacter, as it has demonstrated promising results.

Author contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Saruanna Millena dos Santos Clemente, Samuel Fernando dos Santos, Priscilla Régia de Andrade Calaça, Maria Taciana Cavalcanti Vieira Soares, Webert Aurino da Silva, Renata Pimentel Bandeira de Melo, Rinaldo Aparecido Mota and Mércia Rodrigues Barros. The first draft of the manuscript was written by Saruanna Millena dos Santos Clemente and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Data availability

Data sharing not applicable, all data generated are described in this study.

Declarations

Ethical approval

This study was approved by the Animal Use Ethics Committee of the Federal Rural University of Pernambuco under license number 7403040122.

Consent to participate

No humans participated in the study.

Consent for publication

The authors are giving their consent to the publisher to publish their manuscript upon acceptance.

Conflict of interest

The authors declare no competing interests.