Protocol for the in vivo tracing of alveolar type I cells from mice using two distinct dual recombinase-mediated genetic approaches

Summary

Revealing the origins of alveolar epithelial stem cells is crucial for preventing and treating lung diseases. Here, we present a protocol for tracing alveolar type I (AT1) cells from mice in vivo using two distinct dual recombinase-mediated systems. We describe steps for model establishment, harvesting tissue, cryosection, immunofluorescence staining, and confocal imaging. We then detail procedures for analysis of image files and quantification. This protocol provides a foundation for elucidating the plasticity of AT1 cell fate during homeostasis and diseases.

For complete details on the use and execution of this protocol, please refer to Liu et al.¹

Graphical abstract

Highlights

• •Steps for characterizing the labeling profile of the single recombinase-based mouse lines
• •Procedure for developing dual recombinase-mediated nested mouse lines to label AT1 cells
• •Guidance on conducting fate mapping analysis of AT1 cells following lung injury

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Revealing the origins of alveolar epithelial stem cells is crucial for preventing and treating lung diseases. Here, we present a protocol for tracing alveolar type I (AT1) cells from mice in vivo using two distinct dual recombinase-mediated systems. We describe steps for model establishment, harvesting tissue, cryosection, immunofluorescence staining, and confocal imaging. We then detail procedures for analysis of image files and quantification. This protocol provides a foundation for elucidating the plasticity of AT1 cell fate during homeostasis and diseases.

Before you begin

Before you begin, there are three key points to consider:

• 1.Know the types of dual recombinase systems: intersectional reporters, exclusive reporters, and nested reporters.^2,3
• 2.Understand the working principles and applications of these systems to select the appropriate type for your specific research needs.
• 3.Apply and get approval for animal studies from the Institution.

Background

Genetic lineage tracing primarily relies on recombinase systems, such as Cre-loxP, Dre-rox, Flp-frt, and Nigri-nox. Conventional lineage tracing mainly depend on a single recombinase system, with the specificity of target cell labeling determined only by the cell-specificity promoter.^3,4 Our team has been dedicated to developing more precise lineage tracing technologies. In cases where a single recombinase system, like Cre-loxP, fails to achieve specific labeling of target cells, we incorporate another system, such as Dre-rox, to create a dual recombinase lineage tracing technique.² This method enhances the specificity of target cell labeling and circumvents the non-specific labeling issues often encountered with conventional methods.

Alveolar type II cells (AT2 cells) are alveolar epithelial stem cells,⁵ and some studies have proposed that AT1 cells can transdifferentiate into AT2 cells to facilitate lung regeneration.^6,7,8 However, we discovered that conventional genetic tools for AT1 cells result in non-specific labeling, leading to controversial conclusions.¹ To address this issue, we achieved specific labeling of AT1 cells by developing dual recombinase-mediated lineage trace technologies based on Cre-loxP and Dre-rox (Figures 1 and 2). This allowed us to clarify that AT1 cells belong to terminally differentiated cells and do not transdifferentiate into AT2 cells after lung injuries.¹ In the following sections, we will elaborate on how to achieve AT1 cell-specific genetic targeting, and we hope that our technology will find widespread application in life science research.

Figure 1.

Lineage tracing of AT1 cells by intersectional and nested dual recombinase–mediated genetic tracing systems

(A and B) A schematic diagram showing the intersectional dual recombinase–mediated genetic lineage tracing strategy.

(C) A cartoon image showing that the Hopx⁺Ager⁺ AT1 cells were specifically labeled by tdT in Hopx-2A-DreER;Ager-CreER;R26-RSR-LSL-tdT mice.

(D and E) A schematic diagram showing the nested dual recombinase–mediated genetic lineage tracing strategy.

(F) A cartoon image showing that the Hopx⁺ AT1 cells were specifically labeled by ZsG, while the ciliated, club, BASCs, and AT2 cells were labeled by tdT in Hopx-2A-DreER;Sox2-CreER;Sftpc-CreER;NR2 mice.

Figure 2.

Flowchart representing different steps of the protocol and mouse breeding strategy needed to complete the steps

(A) The workflow of fate mapping AT1 cells by dual recombinase lineage tracing system.

(B) The mouse breeding strategy.

Institutional permissions

All mouse experiments in this protocol were approved by the Institutional Animal Care and Use Committee (IACUC) of the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences. All animal experiments were strictly performed within the committee’s guidelines. Both 6–10 weeks old male and female mice were randomly used for experiments.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Goat anti-GFP (dilution 1:500)	Abcam	Cat#ab6662; RRID: AB_305635
Rabbit anti-GFP (dilution 1:500)	Invitrogen	Cat#A11122; RRID:AB_2307355
Rabbit anti-tdTomato (dilution 1:1,000)	Rockland	Cat#600-401-379; RRID: AB_2209751
Goat anti-tdTomato (dilution 1:1,000)	Rockland	Cat#200-101-379; RRID: AB_2744552
Rat anti-tdTomato (dilution 1:200)	Proteintech	Cat#5f8(abin334653);RRID: AB_2336064
Rabbit anti-Scgb1a1 (dilution 1:300)	Abcam	Cat#ab213203; RRID:AB_2650558
Goat anti-Scgb1a1 (dilution 1:200)	Santa Cruz	Cat#SC-9772; RRID:AB_2238819
Rat anti-AGER (dilution 1:200)	R&D Systems	Cat# MAB1179; RRID:AB_2289349
Mouse anti-acetylated-tubulin (dilution 1:300)	Sigma	Cat# T7451; AB_609894
Rabbit anti-Sftpc (dilution 1:200)	Millipore	Cat# ab3786; RRID:AB_91588
Alexa donkey anti-rabbit 488 (dilution 1:1,000)	Invitrogen	Cat#A21206; RRID: AB_2535792
Alexa donkey anti-rabbit 555 (dilution 1:1,000)	Invitrogen	Cat#A31572; RRID: AB_162543
Alexa donkey anti-rabbit 647 (dilution 1:1,000)	Invitrogen	Cat#A31573; RRID: AB_2536183
Alexa donkey a-mouse 488 (dilution 1:1,000)	Invitrogen	Cat#A21202; RRID: AB_141607
Alexa donkey a-mouse 647 (dilution 1:1,000)	Invitrogen	Cat#A31571; RRID: AB_162542
Donkey anti-rat 647 (dilution 1:1,000)	Abcam	Cat#ab150155; RRID: AB_2813835
Donkey anti-rat 488 (dilution 1:1,000)	Invitrogen	Cat#a21208; RRID: AB_2535794
Donkey anti-goat 488 (dilution 1:1,000)	Invitrogen	Cat#A11055; RRID: AB_2534102
Donkey anti-goat 555 (dilution 1:1,000)	Invitrogen	Cat#A21432; RRID: AB_2535853
Donkey anti-goat 647 (dilution 1:1,000)	Invitrogen	Cat#A21447; RRID: AB_141844
Chemicals, peptides, and recombinant proteins
Tamoxifen	Sigma	Cat#T5648
Bleomycin	Sigma	Cat#B8416
Tris	Ameresco	Cat#77-86-1
EDTA	Sinopharm	Cat#60-00-4
SDS	Sinopharm	Cat#751-21-3
NaCl	Sinopharm	Cat#7647-14-5
Triton X-100	Sinopharm	Cat#9002-93-1
Glacial acetic acid	Sinopharm	Cat#64-19-7
Ethanol	Sinopharm	Cat#64-17-5
EDTA	Sinopharm	Cat#60-00-4
NaCl	Sinopharm	Cat#7647-14-5
KCl	Sinopharm	Cat#7447-40-7
Na2HPO4·12H2O	Sinopharm	Cat#10039-32-4
NaH2PO4·2H2O	Sinopharm	Cat#7558-80-7
Proteinase K	Roche	Cat#3115852001
2× Taq PCR mix	Vazyme	Cat# p213-03
Phosphate-buffered saline (PBS)	Invitrogen	Cat# C10010500BT
100 bp DNA ladder	Vazyme	Cat# MD104-02
Experimental models: Organisms/strains
Mouse: Ager-CreER (6–10 weeks old, male & female)	The Jackson Laboratory	JAX: 032771
Mouse: Hopx-2A-DreER (6–10 weeks old, male & female)	Han et al.9	N/A
Mouse: Sox2-CreER (6–10 weeks old, male & female)	The Jackson Laboratory	JAX: 017593
Mouse: Sftpc-CreER (6–10 weeks old, male & female)	The Jackson Laboratory	JAX: 028054
Mouse: R26-tdTomato (6–10 weeks old, male & female)	Madisen et al.10	JAX: 007909
Mouse: R26-RSR-tdTomato (6–10 weeks old, male & female)	Zhang et al.11	N/A
Mouse: R26-RSR-LSL-tdTomato (6–10 weeks old, male & female)	Madisen et al.12	N/A
Mouse: R26-NR2 (6–10 weeks old, male & female)	He et al.2	N/A
Oligonucleotides
Primers for Hopx-2A-DreER, see Table 3	GENEWIZ	N/A
Primers for R26-RSR-tdT, see Table 4	GENEWIZ	N/A
Primers for Ager-CreER, see Table 7	GENEWIZ	N/A
Primers for R26-tdT, see Table 7	GENEWIZ	N/A
Primers for R26-RSR-LSL-tdT, see Table 8	GENEWIZ	N/A
Primers for Sox2-CreER, see Table 9	GENEWIZ	N/A
Primers for Sftpc-CreER, see Table 9	GENEWIZ	N/A
Primers for R26-NR2, see Table 9	GENEWIZ	N/A
Software and algorithms
Prism 9.3.1	GraphPad Software, Inc.	https://www.graphpad.com/
PhotoLine 23.02	Computerinsel GmbH	https://www.pl32.com/
ImageJ	NIH	https://imagej.nih.gov/ij/
Other
Pipette, 0.5–10 mL	Eppendorf	Cat#3120000020
Pipette, 2–20 mL	Eppendorf	Cat#3120000038
Pipette, 10–100 mL	Eppendorf	Cat#3120000046
Pipette, 20–200 mL	Eppendorf	Cat#3120000054
Pipette, 100–1,000 mL	Eppendorf	Cat#3120000062

Materials and equipment

Prepare all solutions, media, and reagents according to the tables below and keep them at corresponding storage conditions until use.

Lysis buffer

Reagent	Final concentration	Amount
1 M Tris-HCl (pH 7.8)	100 mM	100 mL
0.5 M EDTA	5 mM	10 mL
10% SDS	0.2%	20 mL
2.5 M NaCl	200 mM	80 mL
Total	N/A	1000 mL

Note: The lysis buffer is prepared without proteinase K and can be stored at 20°C–25°C for about 6 months. Proteinase K is usually stored at −20°C and added prior to use, ensuring that the final concentration reached 100 μg/mL. It was freshly prepared each time before being used.

50× TAE buffer

Reagent	Final concentration	Amount
Tris base	2 M	242 g
glacial acetic acid (100% acetic acid)	1 M	57.1 mL
0.5 M EDTA (pH 8.0)	50 mM	100 mL
Total	N/A	1000 mL

Note: The 50× TAE buffer can be stored at 20°C–25°C for about 6 months. Dilute the 50× TAE buffer to 1× with distilled water just before use.

10× PBS solution

Reagent	Final concentration	Amount
Na2HPO4·7H2O	100 mM	26.8 g
NaCl	1.37 M	80 g
KCl	27 mM	2 g
KH2PO4	18 mM	2.4 g
Total	N/A	1000 mL

Note: Sterilize the solution using a 0.22 mm filter; store at 20°C–25°C for up to one year, freshly diluted in ddH₂O to prepare 1× PBS.

4% Formaldehyde (PFA) solution

Reagent	Final concentration	Amount
PFA	4%	40 g
10× PBS	1×	100 mL
Total	N/A	1000 mL

Store at 4°C for a few weeks or at −20°C for up to 1 year.

CRITICAL: PFA is highly toxic; avoid contact with skin and eyes. Use suitable protective gloves and a mask.

30% sucrose

Reagent	Final concentration	Amount
Sucrose	0.88 M	300 g
10× PBS	1×	100 mL
Total	N/A	1000 mL

Store at 4°C for about 6 months.

Step-by-step method details

Generation of the single recombinase mouse line labeling AT1 cells (Hopx-2A-DreER line)

Timing: ∼6 months

Conventional lineage tracing based on Cre-loxP or Dre-rox systems has been widely applied in tracing the cellular fate of specific cell populations. This step involves generating a conventional single-recombinase mouse line to target AT1 cells.

• 1.
  Select a gene marker for the labeling of AT1 cells (e.g., Hopx).

  • a.
    Check the website (http://www.informatics.jax.org/) to determine if the candidate DreER line has already been generated by other laboratories.
  • b.
    Review the detailed information to ensure the existing mouse line aligns with the research objectives.

Note: Multiple lineage tracing studies use the Hopx-gene tool for tracing AT1 cells; however, there is no absolute marker for AT1 cells. If future research identifies a more reliable AT1 cell marker, it can be substituted here.

CRITICAL: Because the specificity and efficiency of this DreER mouse line are critical for AT1 cells labeling, we recommend that researchers use existing and validated mouse lines to save time and prevent the risk of failure in new mouse generation.

• 2.Insert the 2A-DreER DNA sequence into the 3′ untranslated region of the Hopx gene to generate the Hopx-2A-DreER mouse line by using CRISPR-Cas9 technology.

Note: All genetic mice in this study were generated by Shanghai Model Organisms Center, Inc. (SMOC).

• 3.
  Genotype knock-in mouse lines.

  • a.
    Design the genotyping primers use Primer-BLAST on the National Center for Biotechnology Information website (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).

    Note: The genotyping primers should be placed across the 5′ end and the inserted sequence fragment. The size of the amplified product should range from 100 - 1000 bp. This allows for effective detection and characterization of the targeted genomic region modified by Cas9.

  • b.
    Cut the mice tail (∼0.5 cm) of the newborn offspring.
  • c.
    Genomic DNA extraction.

    • i.
      Incubate tissues with Lysis Buffer: Prepare the lysis buffer with proteinase K (100 μg/mL). Incubate the tissues in the lysis buffer for 12 h at 55°C.
    • ii.
      Centrifuge to Obtain Supernatants: After incubation, centrifuge the samples at maximum speed (21,130 x g) for 5 min to separate the supernatants containing genomic DNA.
    • iii.
      Precipitate the DNA by adding isopropanol to the supernatants.
    • iv.
      Wash the precipitated DNA with 70% ethanol.
    • v.
      Dissolve DNA in Deionized Water.

      Pause Point: DNA can be stored at −4°C for about 3–6 months.

  • d.
    Run a suitable PCR program.

    • i.
      Set up the PCR reaction mix as detailed in the Table 1.
    • ii.
      Set up the PCR cycling conditions as detailed in the Table 2.
  • e.
    Run PCR Products on an Agarose Gel.

    • i.
      Prepare a 1% (wt/vol) agarose gel in TAE buffer.
    • ii.
      Load the PCR products into the gel wells, along with a DNA ladder for size reference.
    • iii.
      Run the gel at 160 V for 30 min.
    • iv.
      Use a UV detector to visualize the gel results. Troubleshooting 1.
  • f.
    Match the product size with the predicted size.
• 4.Select mutant mouse for breeding and experiment purposes.

Note: The detailed information on the primers for the Hopx-2A-DreER mouse line, please refer to Table 3.

Table 1.

PCR reaction master mix

Reagent	Amount (μL)
2× Taq PCR mix	5
Genomic DNA (100–200 ng/μL)	0.5
Primer pairs (forward and reverse, 10 mM)	0.3
ddH2O	4.2
Total	10

Table 2.

PCR cycling conditions

Steps	Temperature	Time	Cycles
Initial Denaturation	94°C	4 min	1
Denaturation	94°C	30 s	30 cycles
Annealing	60°C	30 s
Extension	72°C	1 min
Final extension	72°C	10 min	1
Hold	4°C	forever

Table 3.

Primers for Hopx-2A-DreER mouse

Genotype	Primers
Hopx-2A-DreER
Mut 412 bp	Forward: ACCACACAGAAAACCCCTCAG
	Reverse: CTAGCGTGGCACCATCTAGC
WT 623 bp	Forward: ACCACACAGAAAACCCCTCAG
	Reverse: CCCACGTTCTCATTCAACCAC

Characterization of the single recombinase mouse lines labeling AT1 cells (Hopx-2A-DreER line)

Timing: ∼3 months

• 5.
  Cross Hopx-2A-DreER mice with Rosa26-rox-stop-rox-tdTomato (R26-RSR-tdT) mice to generate Hopx-2A-DreER;R26-RSR-tdT mice (Figures 3A–3C).

  • a.
    Mice mating.

    • i.
      Ensure that the mice are sexually mature (6–8 weeks old) and in good health. According to the Institutional Animal Care and Use Committee (IACUC) guidelines, house a maximum of two female mice and one male mouse in a single mating cage to prevent overcrowding.
    • ii.
      Once a female is found to be pregnant, transfer her to a separate holding cage to provide a quiet and stable environment for gestation and parturition.
  • b.
    Genotyping of the newborn mice.
    Follow Steps 5–8 of the genotyping protocol to determine the presence of both the Hopx-2A-DreER and R26-RSR-tdT alleles in the newborn mice.

    Note: The detailed information on the primers for the R26-RSR-tdT mouse line, please refer to Table 4. The primers for the Hopx-2A-DreER mouse line, please see Table 3.

  • c.
    Select double-knock-in mice for breeding and experiment purposes.

    CRITICAL: During the genotyping process, it is crucial to be meticulous in confirming the presence of both alleles.

• 6.
  Treat tamoxifen (Tam) at indicated time.

  • a.
    Prepare Tam: tamoxifen is dissolved into corn oil at a concentration of 20 mg/ml.
  • b.
    Treat Tam: Administer tamoxifen via oral gavage at a dose of 0.2 mg per gram of mouse body weight at the indicated time (e.g., adult).

Note: All adult experiments were performed on 7–20 weeks old that were kept in a C57BL6/ICR mixed background.

CRITICAL: Validate leakiness: before collecting tamoxifen-induced experimental samples, validate for leakiness by collecting lung tissue from adult double-knock-in mice treated without tamoxifen.

Figure 3.

Hopx- or Ager-based genetic tools are not specific for labeling AT1 cells

(A and B) A schematic diagram illustrating the experimental design in Hopx-2A-DreER;R26-RSR-tdT mice.

(C) Genotyping verification of Hopx-2A-DreER mice by PCR.

(D) Immunostaining of tdT, AGER, Scgb1a1, Sftpc, and Ace-Tub on lung sections.

(E) Cartoon image showing labeled pulmonary cells in Hopx-2A-DreER;R26-RSR-tdT mice.

(F) Quantification of the percentage of AT1, club, BASCs, ciliated and AT2 labeled by tdT in (D).

(G and H) A schematic diagram illustrating the experimental design in Ager-CreER;R26-tdT mice.

(I) Genotyping verification of Ager-CreER mice by PCR.

(J) Immunostaining of tdT, AGER, Scgb1a1, Sftpc, Ace-Tub, Krt5, and CGRP on lung sections.

(K) Cartoon image showing labeled pulmonary cells in Ager-CreER;R26-tdT mice.

(L) Quantification of the percentage of AT1, club, BASCs, ciliated and AT2 labeled by tdT in (J). Each immunostaining image is representative of 5 individual mice samples. Tam, tamoxifen. tdT, tdTomato. ZsG, ZsGreen. Data are presented as mean ± SD; n = 4–5 mice per group. Scale bars, 100 mm. Figure reproduced with permission from ref. ¹, CellPress.

Table 4.

Primers for R26-RSR-tdT mouse

Genotype	Primers
R26-RSR-tdT
Mut 609 bp	Forward: ACGGGTGTTGGGTCGTTTGTTC
	Reverse: TTCTTGTAATCGGGGATGTCGGCG
WT 297 bp	Forward: AAGGGAGCTGCAGTGGAGTA
	Reverse: CCGAAAATCTGTGGGAAGTC

Check for sex effects: test for any sex-related effects by collecting lung tissue from adult male and female double-knock-in mice treated with tamoxifen.

Tamoxifen is a chemical hazard, avoid contact with skin and eyes. Use biosafety cabinet and wear PPEs when making solutions. For Tamoxifen waste, place it in a suitable, labeled container for waste disposal.

• 7.
  Collect tissues.

  • a.
    Euthanize the mice.
  • b.
    Use 4°C pre-chilled 1× PBS to perfuse the lungs through the right ventricle of the heart to remove blood.
  • c.
    Perfuse the lungs with 4°C pre-chilled 4% PFA through the trachea to ensure thorough fixation.
  • d.
    Collect the lungs and place the collected lungs in 6-well plates.
  • e.
    Fix the lungs in 4% PFA for 1 h at 4°C.
  • f.
    Wash the lungs with 1× PBS three times for 5 min each time.
  • g.
    Capture bright-field and fluorescent whole-mount images of samples of interest using stereoscopic microscopy.

Optional: If the sample surface is not flat, employ z-stack imaging to obtain crisp, focused images of the entire sample.

Note: By following these steps, you will ensure that the lungs are properly collected, perfused, fixed, and dehydrated for further histological processing.

CRITICAL: Lung tissue is porous, and alveoli are filled with gas, making fixation challenging. Therefore, perfusion of the lung can ensure adequate fixation.

• 8.
  Tissue embedding and cryosection.

  • a.
    Dehydrate the lungs: Dehydrate the lungs in 30% sucrose (dissolved in 1× PBS) for 12 h at 4°C.
  • b.
    Pre-cool the sample: After removing the liquid, place the sample in a cryogenic mold and add OCT until the tissue is completely covered. Pre-cool the sample in OCT at 4°C for 30 min.
  • c.
    Embed tissues: Freeze the tissues on the metal stage within the cryostat.

    Pause Point: The frozen tissue samples can be stored at – 80°C for about 3–5 years.

  • d.
    Cryosectioning: Collect 10 μm frozen sections on slides by cryomachine (Thermo Fisher Scientific CryoStar NX70). Troubleshooting 2.

    CRITICAL: Lock the rocker bar before adjusting the orientation of the chuck to prevent injury from the blade.

• 9.
  Immunofluorescent staining (Figures 3D and 3E).

  • a.
    Dry the slides at 20°C–25°C.
  • b.
    Wash the slides with 1× PBS three times in a staining jar (for 5 min each time) to remove the OCT compound. Keep the slides covered with PBS.
  • c.
    Block the slides in 5% PBSST buffer (0.1% Triton X-100 and 5% donkey serum in 1× PBS) for 30 min at 20°C–25°C.
  • d.
    Incubate the slides with primary antibodies hours at 4°C. Use the primary antibodies in the following Table 5.
  • e.
    The next day, wash the slides three times with 1× PBS to remove the primary antibodies.

    • i.
      Incubate the slides with secondary antibodies for 40 min at 20°C–25°C.
    • ii.
      Use the secondary antibodies in the following Table 6.
  • f.
    Wash the slides three times with 1× PBS.
  • g.
    Mount the slides with a mounting medium. Troubleshooting 3.
• 10.
  Image the stained sections with a confocal microscope.

  • a.
    In our case we employ the Zeiss LSM 880 Airyscan along with its corresponding image acquisition software, ZEN blue.
  • b.
    Carefully pick the appropriate laser lines and filters. The excitation settings should be: 405 nm (suitable for DAPI), 488 nm (for FITC / GFP), 561 nm (for Alexa 568 / tdT), and 640 nm (for Alexa 647).
  • c.
    Adjust the pinhole to 1 airy unit to attain optimal imaging quality. This precise adjustment helps in capturing sharp and clear images.
  • d.
    In the ZEN blue image acquisition software, set the scanning speed value to 8, with a resolution of 1024 × 1024 and apply 2× averaging. These settings balance speed and image fidelity.
  • e.
    Fine-tune the laser intensity and voltage for each individual channel to highlight the specific details you aim to capture. It’s crucial to note that all the images should be taken with the same settings; otherwise, they cannot be compared.
  • f.
    Pinpoint your area of interest and configure the position as well as imaging tiles in a way that comprehensively covers the desired area.
  • g.
    Gather overall information: Capture images from a 10×/0.3w field of view. This wider perspective provides a broad overview of the sample.
  • h.
    Acquire detailed particulars: Take images from either 40×/1.1w or 63×/1.4 oil fields of view. These higher magnifications allow you to zoom in on the details, capturing precise co-localization or mutually exclusive signal details.
  • i.
    Save the resultant image in the .czi file format to preserve all the acquired data for further analysis. Troubleshooting 4.

Note: When capturing detailed information, stay within the boundaries of the 10× image.

CRITICAL: Handle the microscope with care, especially when turning the mercury lamp on and off; wait at least 30 min between switches. After using an oil immersion lens, clean the lens with alcohol.

Table 5.

Primary antibody list

Primary Ab	Dilution
Goat anti-GFP	1:500
Rabbit anti-GFP	1:500
Rabbit anti-tdTomato	1:1000
Goat anti-tdTomato	1:1000
Rat anti-tdTomato	1:200
Rabbit anti-Scgb1a1	1:300
Goat anti-Scgb1a1	1:200
Rat anti-AGER	1:200
Mouse anti-Acetylated-tubulin	1:300
Rabbit anti-Sftpc	1:200

Table 6.

Secondary antibody list

Secondary Ab	Dilution
Alexa donkey anti-rabbit 488	1:1000
Alexa donkey anti-rabbit 555	1:1000
Alexa donkey anti-rabbit 647	1:1000
Alexa donkey a-mouse 488	1:1000
Alexa donkey a-mouse 647	1:1000
Donkey anti-rat 647	1:1000
Donkey anti-rat 488	1:1000
Donkey anti-goat 488	1:1000
Donkey anti-goat 555	1:1000
Donkey anti-goat 647	1:1000

• 11.
  Analyze the image files by adjusting and merging channels in ImageJ.

  • a.
    Open the original file. Load the original file with separated channels into ImageJ.
  • b.
    Adjust each channel: Use the 'Image > Adjust > Color Balance' function to modify each channel.
  • c.
    Merge the channels: Combine the individual channels using the 'Image > Color > Merge Channels' function.
  • d.
    Set the output format: Configure the final image output to be in RGB format. Save the projected and stitched image as a new .tiff file.
  • e.
    Evaluate the images: The final images usually offer a clear indication of the labeling efficiency and any potential leakage.

Examine the initial labeling profile of the single recombinase mouse lines (Hopx-2A-DreER line)

Timing: ∼6 days

This step involves quantifying the percentage of AT1, club, BASCs, ciliated, AT2, basal, and NE cells labeled by tdT in Figure 3D. To detect the labeling efficiency of AT1 cells in the Hopx-2A-DreER;R26-RSR-tdT single recombinase mouse lines (Figure 3F).¹

• 12.
  Collect samples and quantifying the percentage for analysis.

  • a.
    Collect at least 20 sections per sample to ensure a comprehensive analysis according to the methods described in Step 8–10.
  • b.
    Quantify the percentage of AT1, club, BASCs, ciliated, AT2, basal, and NE cells labeled by tdT.

CRITICAL: Analyze at least five 10× fields per section to capture a representative sample of the tissue.

• 13.
  Use Prism software (GraphPad version 9.3.1) perform statistical analyses.

  • a.
    Test the normality of all samples using the Shapiro-Wilk test.
  • b.
    Present the data as mean values ± SD, as indicated in the figure legends.
  • c.
    Use a two-tailed unpaired Student’s t-test to determine the statistical significance of the differences between the two groups.
  • d.
    Use one-way ANOVA with Tukey’s multiple comparisons test to compare the differences between multiple groups.

Note: Ensure that all data are acquired from at least three independent experiments to enhance reliability.

CRITICAL: Even if tdT labeling of AT1 cells is not specific, it is necessary to calculate the proportion of tdT⁺ cells in each cell type, which can provide a basis for designing subsequent dual-system strategies.

Use another single recombinase mouse line to target AT1 cells (Ager-CreER line)

Timing: ∼9 months

Because genetic tools based on Hopx are not specific to AT1 cells, a second mouse line with a different gene promoter, Ager-CreER, could be utilized to target these cells (Figure 3G).

• 14.Generate Ager-CreER mouse lines according to the methods described in Step 1–4.
• 15.Characterize Ager-CreER;R26-tdT mouse lines according to the methods described in Step 6–11 (Figures 3G–3K). Troubleshooting 5.

Note: The detailed information on the primers for the Ager-CreER;R26-tdT mouse line, please refer to Table 7.

• 16.Examine the initial labeling profile of Ager-CreER mouse lines according to the methods described in Steps 12–13 (Figure 3L).

Note: Even if tdT labeling of AT1 cells is not specific, it is necessary to calculate the proportion of tdT⁺ cells in each cell type, which can provide a basis for designing subsequent dual-system strategies.

Table 7.

Primers for Ager-CreER and R26-tdT mouse

Genotype	Primers
Ager-CreER
Mut 500 bp	Forward: ATCGCATTCCTTGCAAAAGT
	Reverse: CCCCATAGAGCAAGAACCAG
WT 204 bp	Forward: GGACTCTTGTCCCAGAAGCA
	Reverse: CCCCATAGAGCAAGAACCAG
Rosa26-loxP-stop-loxP-tdTomato (R26-tdT)
Mut 196 bp	Forward: GGCATTAAAGCAGCGTATCC
	Reverse: CTGTTCCTGTACGGCATGG
WT 297 bp	Forward: AAGGGAGCTGCAGTGGAGTA
	Reverse: CCGAAAATCTGTGGGAAGTC

Generation of the dual recombinase-mediated intersectional mouse lines labeling AT1 cells

Timing: ∼6 months

Since single recombinase genetic tools are not specific to AT1 cells (Hopx-2A-DreER mice label AT1 cells, club cells, BASCs, ciliated cells, and few AT2 cells; Ager-CreER mice label AT1 cells, AT2 cells, BASCs but not club cells and ciliated cells), a dual recombinase-mediated system can be used to increase the specificity of the target cells. In this step, we employed the dual recombinase-mediated intersectional genetic reporter, Rosa26-rox-stop-rox-loxP-stop-loxP-tdTomato (R26-RSR-LSL-tdT), and generate Hopx-2A-DreER;Ager-CreER;R26-RSR-LSL-tdT triple-positive mice to label Hopx⁺Ager⁺ AT1 cells (Figure 4A).¹

• 17.Select an appropriate dual homologous recombination system based on the phenotypes of the genetic tools based on Ager and Hopx and experimental objectives (e.g., dual recombinase-mediated intersectional genetic system).

Note:Hopx-2A-DreER and Ager-CreER exhibit nearly mutually exclusive ectopic labeling of lung epithelial cells. Therefore, their intersectional labeling is highly restricted to AT1 cells (Figures 4A–4C). Consequently, we can label Hopx⁺Ager⁺ cells to achieve more precise targeting of AT1 cells.

CRITICAL: A variety of dual recombinase–mediated genetic labeling systems have been developed to improve the specificity and increase the number of cell types labeled simultaneously. These systems include intersectional reporters, exclusive reporters, and nested reporters. Selecting the appropriate system is essential for different experimental objectives.

• 18.
  Generate triple-positive mice. Follow the methods described in Step 5 to cross Hopx-2A-DreER mice with Ager-CreER mice, respectively, with R26-RSR-LSL-tdT mice (Figure 4B).

  Optional: There are two strategies you can choose (Figure 2B):

  • a.
    First strategy:

    • i.
      Cross Hopx-2A-DreER with R26-RSR-LSL-tdT mice to obtain Hopx-2A-DreER;R26-RSR-LSL-tdT double-positive mice.
    • ii.
      Then, cross Ager-CreER with Hopx-2A-DreER;R26-RSR-LSL-tdT mice to obtain Hopx-DreER;Ager-CreER;R26-RSR-LSL-tdT triple-positive mice.
  • b.
    Second strategy:

    • i.
      Cross Ager-CreER with R26-RSR-LSL-tdT mice to obtain the Ager-CreER;R26-RSR-LSL-tdT double-positive mice.
    • ii.
      Then, cross Hopx-2A-DreER with Ager-CreER;R26-RSR-LSL-tdT mice to obtain Hopx-2A-DreER;Ager-CreER;R26-RSR-LSL-tdT triple-positive mice.

      Note: The detailed information on the primers for the R26-RSR-LSL-tdT mouse line, please refer to Table 8. And primers for the Ager-CreER and Hopx-2A-DreER mouse line, see Tables 3 and 7.

      CRITICAL: Ensure you retain the double-positive mice Hopx-2A-DreER;R26-RSR-LSL-tdT and Ager-CreER;R26-RSR-LSL-tdT to test for any potential crosstalk in the system.

• 19.Characterize the triple-positive mice (Hopx-2A-DreER;Ager-CreER;R26-RSR-LSL-tdT) according to the methods described in Steps 6–11 (Figure 4C and 4D).

Note: After Dre-rox and Cre-loxP recombinations, the tdT reporter gene is activated to label Hopx⁺Ager⁺ cells.

CRITICAL: Validate crosstalk: Administer tamoxifen to the double-positive mice (Hopx-2A-DreER;R26-RSR-LSL-tdT and Ager-CreER;R26-RSR-LSL-tdT) to test for potential crosstalk in this system.

• 20.Investigate the labeling efficiency of specific AT1 cell types by triple-positive mice according to the methods described in Step 12–13 (Figure 4E).

Figure 4.

Intersectional genetics tools could specific for labeling AT1 cells

(A) A cartoon image showing the intersectional genetic strategy for lineage tracing of Hopx⁺Ager⁺ AT1 cells.

(B) A schematic diagram showing the lineage tracing strategy.

(C) A schematic diagram illustrating the experimental design.

(D) Immunostaining of tdT, AGER, Scgb1a1, Sftpc, and Ace-Tub on lung sections.

(E) Quantification of the percentage of AT1, club, BASCs, ciliated, and AT2 cells that were labeled by tdT in (D). Each immunostaining image is representative of 5 individual mice samples. Tam, tamoxifen. tdT, tdTomato. ZsG, ZsGreen. Data are presented as mean ± SD; n = 4–5 mice per group. Scale bars, 100 mm. Panels A, D and E reproduced with permission from ref. ¹, CellPress.

Table 8.

Primers for R26-RSR-LSL-tdT mouse

Genotype	Primers
R26-RSR-LSL-tdT
Mut 404 bp	Forward: ACGGGTGTTGGGTCGTTTGTTC
	Reverse: ATGTTTCAGGTTCAGGGGGAGGTG
WT 297 bp	Forward: AAGGGAGCTGCAGTGGAGTA
	Reverse: CCGAAAATCTGTGGGAAGTC

Generation of the dual recombinase-mediated nested mouse lines labeling AT1 cells

Timing: ∼6 months

Since the labeled Hopx⁺Ager⁺ cells failed to target all AT1 cells (approximately 80%), it is necessary to consider methods to exclude the “unwanted” club cells, ciliated cells, BASCs, and AT2 cells targeted by Hopx-2A-DreER. In this step, we employed an alternative dual recombinases-responding reporter, nested reporter 2 (R26-NR2), and generated Hopx-2A-DreER;Sox2-CreER;Sftpc-CreER;R26-NR2 quadruple knock-in mice (nested strategy) to label the entire Hopx⁺ AT1 cell population (Figure 5E).¹

• 21.Characterize Sox2-CreER and Sftpc-CreER by validating specificity and leakiness (Figures 5A–5D).

Note: Since single recombinase genetic tools are not specific to AT1 cells (Hopx-2A-DreER mice label AT1 cells, club cells, BASCs, ciliated cells, and few AT2 cells), a dual recombinase-mediated system can be used to increase the specificity of the target cells. This step show Sox2-CreER can block the labeling of ‘‘unwanted’’ Hopx⁺Sox2⁺ club cells and ciliated cells, as well as Sftpc-CreER can block ‘‘unwanted’’ Hopx⁺Sftpc⁺ AT2 cells and BASCs, respectively.

• 22.
  Generate Hopx-2A-DreER;Sox2-CreER;Sftpc-CreER;R26-NR2 quadruple knock-in mice. To generate quadruple knock-in mice, follow these recommended steps to obtain the necessary double-positive control groups.

  • a.
    Generate Double-Positive Control Groups: Cross Hopx-2A-DreER with R26-NR2 mice to obtain the double-positive mice Hopx-2A-DreER;R26-NR2.
  • b.
    Meanwhile, Cross Sox2-CreER with Sftpc-CreER mice to obtain the Sox2-CreER;Sftpc-CreER the double-positive mice.
  • c.
    Generate Quadruple Knock-in Mice:
    Cross the double-positive mice Hopx-2A-DreER;R26-NR2 with Sox2-CreER;Sftpc-CreER to obtain the quadruple knock-in mice Hopx-2A-DreER;Sox2-CreER;Sftpc-CreER;R26-NR2.

Note: The detailed information on the primers for the Sox2-CreER, Sftpc-CreER and R26-NR2 mouse line, please refer to Table 9 And primers for the Hopx-2A-DreER mouse line, see Table 2.

• 23.Characterize of Hopx-2A-DreER;Sox2-CreER;Sftpc-CreER;R26-NR2 quadruple knock-in mice according to the methods described in Steps 6–11 (Figures 5F–5H).

Note: In the R26-NR2 design: Dre-rox recombination leads to ZsGreen (ZsG) expression in Dre⁺ cells. Cre-loxP recombination removes the ZsG gene and the Stop sequence, leading to tdT expression in both Dre⁺Cre⁺ and Dre^–Cre⁺ cells (Figure 5E).

• 24.Investigate the labeling efficiency of specific AT1 cell types by nested strategy according to the methods described in Steps 12–13 (Figures 5I and 5J).

Figure 5.

The nested reporter system can specifically target AT1 cells with high labeling efficiency

(A and B) Characterization of the Sox2-CreER mouse line.

(C and D) Characterization of the Sftpc-CreER mouse line.

(E) A cartoon image showing cell labeling by different strategies.

(F) A schematic diagram illustrating the experimental design.

(G and I) Immunostaining for ZsG, tdT, Ace-Tub, Scgb1a1, Sftpc or AGER on lung sections of Hopx-2A-DreER;R26-NR2 mice (G) and Hopx-2A-DreER;Sox2- CreER;Sftpc-CreER;R26-NR2 mice (I) after tamoxifen treatment. Yellow arrowheads, ZsG⁺Sftpc⁺ AT2 cells.

(H and J) Quantification of the percentage of AT1, ciliated, club, and AT2 cells labeled by ZsG and tdT. Each immunostaining image is representative of 5 individual mice samples. Tam, tamoxifen. tdT, tdTomato. ZsG, ZsGreen. Data are presented as mean ± SD; n = 4–5 mice per group. Scale bars, 100 mm. Figure reproduced with permission from ref. ¹, CellPress.

Table 9.

Primers for Sox2-CreER, Sftpc-CreER, and R26-NR2 mouse

Genotype	Primers
Sox2-CreER
Mut 391 bp	Forward: AGGACTCGTGTTTGGGAACC
	Reverse: CGCCGCATAACCAGTGAAAC
WT 200 bp	Forward: CAATTGCACTTCGCCCGTC
	Reverse: ATCATGCTGTAGCTGCCGTT
Sftpc-CreER
Mut 210 bp	Forward: TGCTTCACAGGGTCGGTAG
	Reverse: ACACCGGCCTTATTCCAAG
WT 327 bp	Forward: TGCTTCACAGGGTCGGTAG
	Reverse: CATTACCTGGGGTAGGACCA
R26-NR2
Mut 686 bp	Forward: TGGAGGAGAACTGCATGTACCAC
	Reverse: TTGTGCTGGATGAAGTGCCAGTCG
WT 368 bp	Forward: TTGGAGGCAGGAAGCACTTG
	Reverse: CCGACAAAACCGAAAATCTGTG

Fate mapping of AT1 cells after injury

Timing: ∼6 months

This step demonstrates the application of the dual recombinase-mediated lineage tracing system for labeling AT1 cells. We examined the plasticity of AT1 cells after lung injury, such as bleomycin-induced injury (Figure 6).

• 25.
  Generate Hopx-2A-DreER;Ager-CreER;R26-RSR-LSL-tdT intersectional triple positive mice, and Hopx-2A-DreER;Sox2-CreER;Sftpc-CreER;R26-NR2 nested quadruple knock-in mice according to the methods described in Steps 17–23.

  Note: Set up single-system mice as control groups for bleomycin-induced lung injury experiments:

  • a.
    Generate Hopx-2A-DreER;Ager-CreER;R26-RSR-LSL-tdT and Hopx-2A-DreER;R26-RSR-tdT mice.
  • b.
    Generate Hopx-2A-DreER;Sox2-CreER;Sftpc-CreER;R26-NR2 and Hopx-2A-DreER;R26-NR2 mice.
• 26.
  Perform Tamoxifen induction and bleomycin-induced injury (Figures 6A and 6D).

  • a.
    Administer Tamoxifen according to the methods described in Step 6.
  • b.
    Prepare Bleomycin: Dissolve Bleomycin freshly in phosphate-buffered saline (PBS) at a concentration of 10 U/mL and store at −80°C.
  • c.
    Treat adult mice with 2 U/kg bleomycin or vehicle (PBS) by intratracheal instillation for alveolar injury after 3 weeks of tamoxifen induction.

Note: Bleomycin is a chemical hazard; avoid contact with skin and eyes. Use biosafety cabinet and wear PPEs when making solutions. For Bleomycin waste, place it in a suitable, labeled container for waste disposal.

• 27.Collect tissues and perform immunostaining according to the methods described in Steps 7–9 (Figures 6B and 6E).
• 28.Investigate the subset of tdT⁺ AT2 cells according to the methods described in Steps 12–13 (Figures 6C and 6F).

Figure 6.

AT1 cells lack cell plasticity to generate AT2 cells after lung injury

(A) A schematic diagram illustrating the experimental design.

(B) Immunostaining of tdT and Sftpc on lung sections after bleomycin injury.

(C) Quantification of the percentage of Sftpc⁺ AT2 cells labeled by tdT in (B). ∗∗∗∗p < 0.0001. n = 5.

(D) A schematic diagram illustrating the experimental design.

(E) Immunostaining of ZsG, tdT, and Sftpc on lung sections after bleomycin injury.

(F) Quantification of the percentage of Sftpc⁺ AT2 cells expressing ZsG or tdT in (E). ∗∗∗∗p < 0.0001. n = 5. Each immunostaining image is representative of 5 individual mice samples. Tam, tamoxifen. tdT, tdTomato. ZsG, ZsGreen. Data are presented as mean ± SD; n = 4–5 mice per group. Scale bars, 100 mm. Figure reproduced with permission from ref. ¹, CellPress.

Expected outcomes

In the Hopx-2A-DreER;R26-RSR-tdT single recombinase approach, our results demonstrated that in adult mice, tdT labeled 97.08 ± 1.04% of AT1 cells, 44.78 ± 5.36% of club cells, 8.22 ± 1.59% of BASCs, 70.92 ± 3.35% of ciliated cells, and 0.14 ± 0.04% of AT2 cells (Figures 3A–3F).¹

Regarding the Ager-CreER;R26-tdT single recombinase strategy, we observed that in adult Ager-CreER;R26-tdT mice post Tam treatment, tdT was detected in 90.64 ± 3.05% of AT1 cells, 19.92 ± 3.35% of AT2 cells, and 9.10 ± 1.94% of BASCs, while no expression was found in club, ciliated, basal, or NE cells (Figures 3G–3L).¹

In the dual recombinase-mediated intersectional strategy, we determined that tdT was expressed in 83.03 ± 4.23% of AT1 cells, 0.04 ± 0.03% of club cells, 0.41 ± 0.37% of BASCs, 0.04 ± 0.02% of AT2 cells, and 0.05 ± 0.03% of ciliated cells (Figures 4D and 4E). This indicated a high specificity in the labeling of AT1 cells with this particular strategy.¹

In the dual recombinase-mediated nested strategy, it was found that ZsG was expressed in 97.82 ± 0.70% of AT1 cells. Notably, all ectopically labeled cells, namely ciliated cells, club cells, BASCs, and AT2 cells, were subsequently converted to tdT labeling.¹

The protocol described here provides detailed steps for specifically tracing AT1 cells in vivo. By performing immunostaining of different cell types in the lung (AT1 cells, AT2 cells, BASCs, club cells, ciliated cells, basal cells, and NE cells) with tdT and quantifying the proportion of double-positive cells among all tdT⁺ cells, you could find that the labeling of AT1 cells is highly specific when using the dual recombinase-mediated intersectional and nested strategies compared to the single recombinase-mediated strategies.¹

Then we employed dual recombinase system to investigate the plasticity of AT1 cells during lung repair and regeneration. In the control Hopx-2A-DreER;R26-RSR-LSL-tdT mice, tdT⁺ AT2 cells can be detected, but no tdT⁺ AT2 cells are observed in the triple-positive Hopx-2A-DreER;Ager-CreER;R26-RSR-LSL-tdT mice (Figures 6A–6C). Similarly, in the control mice, a subset of ZsG⁺ AT2 cells is observed near the bronchiolar region after injury. However, no ZsG⁺ AT2 cells are detected in either the alveolar or peribronchiolar regions in the Hopx-2A-DreER;Sox2-CreER;Sftpc-CreER;R26-NR2 mice (Figures 6D–6F). These findings hint at non-specific labeling in conventional tools contributing to false positives in the purported transition of AT1 to AT2 cells.¹

The labeling of AT1 cells as demonstrated in this protocol serves as a paradigm. The dual recombinase system is broadly applicable for tracing various cell populations that cannot be precisely identified using a single gene marker. The specific experimental design can be tailored based on the lineage tracing patterns of the target cells in conventional lineage tracing tools. By selecting the appropriate dual recombinase system, precise tracing of the target cell population can be achieved. This protocol also provides methodologies for studying cell fate in tissues development, regeneration, and diseases.

Limitations

Although the dual recombinase system is capable of achieving more precise genetic lineage tracing in contrast to the single recombinase system, it is not without its limitations. The generation of mice harboring the dual recombinase system necessitates more intricate breeding strategies. These strategies are not only time consuming but also highly labor intensive for researchers. The complex procedures involve multiple steps of genetic crossing and screening, which demand meticulous planning and continuous monitoring over an extended period. Furthermore, the elevated complexity and prolonged breeding durations invariably result in escalated costs. This cost increase encompasses expenses related to animal housing, maintenance, and the utilization of specialized genetic manipulation techniques. As a consequence, the application of this approach may be restricted in certain research settings, especially those with constrained financial and resource availability. These resource limited research entities may find it difficult to afford the high cost experimental requirements associated with the dual recombinase system, thereby impeding the implementation of relevant research projects.

Troubleshooting

Problem 1

No bands on the gel (related to Step 3d).

Potential solution

• •Poor DNA sample quality: Check the reagents used in the DNA extraction process. Ensure the ethanol has been completely evaporated before adding deionized water. Follow the DNA extraction protocol accurately and store the DNA properly to maintain its integrity.
• •Nonoptimal PCR annealing temperature: Add 5% (vol/vol) DMSO (dimethyl sulfoxide) to the PCR mix to improve primer binding. Alternatively, perform a temperature gradient PCR to determine the optimal annealing temperature for your specific primers.

Problem 2

Difficulty obtaining intact and high-quality tissue sections (related to Step 8d).

Potential solution

• •Dull blade: Use a new, sharp blade. Dull blades can cause the tissue to tear or curl, leading to incomplete sections.
• •Inadequate fixation of lungs: Ensure thorough fixation of the lungs by perfusing them with cold 4% PFA through the trachea during tissue collection. Proper fixation is crucial for maintaining tissue integrity and preventing curling or tearing during sectioning.

Problem 3

Few or incorrect immunostaining signals (related to Step 9).

Potential solution

• •Sample not fresh: If the sections have been stored for too long, they may no longer be fresh. Prepare new sections.
• •Inadequate fixation of lungs: Inadequate fixation of the lungs can lead to failed immunofluorescence staining. Ensure thorough fixation of the lungs by perfusing them with cold 4% PFA through the trachea during tissue collection.
• •Incorrect antibody usage: Check that the antibodies are used correctly. Ensure that the primary antibodies are from different species and that the secondary antibodies are labeled with different fluorophores to avoid cross-reactivity.

Problem 4

Target cells not labeled or minimally labeled (related to Step 10).

Potential solution

• •Incorrect genotype: If the target cells are completely unmarked, there might be an error in the genotype. Re-genotype the mice to confirm the correct genotype.
• •Insufficient tamoxifen dosage: The dosage of tamoxifen may be too low, leading to relatively low labeling efficiency. Treat mice with 0.2 mg tamoxifen per gram of body weight multiple times to increase labeling efficiency. However, excessive tamoxifen can be toxic to mice. Perform preliminary experiments to determine the appropriate tamoxifen dosage for your specific tissue type.

Problem 5

Incorrect labeling of non-target cells in the dual recombinase system (related to Step 15).

Potential solution

System leakage or crosstalk: Non-specific labeling may be due to system leakage or crosstalk. Test for leakage or crosstalk before conducting the main experiment to ensure the specificity of the labeling.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Kuo Liu (liukuo2015@sibcb.ac.cn).

Technical contact

Questions about the technical specifics of performing the protocol should be directed to the technical contact, Kuo Liu (liukuo2015@sibcb.ac.cn).

Materials availability

This study did not generate new unique reagents.

Data and code availability

No datasets or code was generated during this study.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (82088101, 32370897, and 32100648), Research Funds of Hangzhou Institute for Advanced Study (B04006C01600515 and 2024HIAS-V005), and National Key Research & Development Program of China (2024YFA1803302 and 2023YFA1800700). We thank Shanghai Model Organisms Center for mouse generation. We also thank the cell platform in CEMCS and SINH for microscope.

Author contributions

Conceptualization, B.Z. and K.L.; writing – original draft, X.Y. and X.M.; writing – review and editing, J.Z., Z.W., B.Z., and K.L.; funding acquisition, B.Z. and K.L.; supervision, B.Z. and K.L.

Declaration of interests

The authors declare no competing interests.