Skip to main content
Parasitology logoLink to Parasitology
. 2024 Oct 30;151(11):1290–1297. doi: 10.1017/S0031182024001112

Morphological and molecular characterization of Henneguya cardii n. sp. (Cnidaria: Myxosporea) from the bulbus arteriosus of European seabass Dicentrarchus labrax (Teleostei: Moronidae)

Luis F Rangel 1,2,, Ricardo Severino 1, Maria J Santos 1,2, Sónia Rocha 3,4
PMCID: PMC11894001  PMID: 39473321

graphic file with name S0031182024001112_figAb.jpg

Keywords: aquaculture, heart infection, Myxobolidae, parasite, phylogeny

Abstract

A new species of Myxobolidae, Henneguya cardii n. sp., is described infecting the European seabass Dicentrarchus labrax, a fish of high commercial value intensively cultivated in southern Europe. Henneguya cardii n. sp. was found in the bulbus arteriosus and spleen with a prevalence of infection of 13.5%. In the heart, it forms irregular whitish plasmodia measuring 1 mm in size. Mature myxospores are broadly obovoid in frontal view and ellipsoidal in lateral view, with 2 equal caudal appendages. Polar capsules are ovoid and symmetric, with 3–4 polar tubule coils. Myxospores measure 10.2 ± 0.6 (8.8–11.6) μm in length, 8.0 ± 0.7 (5.3–8.8) μm in width and 5.6 ± 0.2 (5.1–6.4) μm in thickness. Caudal appendages are 36.6 ± 3.2 (27.4–42.9) μm long. Total spore length is 47.6 ± 3.2 (41.2–53.2) μm. Polar capsules measure 4.0 ± 0.2 (3.4–4.6) by 2.2 ± 0.1 (1.9–2.6) μm. Small subunit ribosomal RNA-based tree topologies position H. cardii n. sp. within a lineage of marine myxobolids that is mostly comprised of other Henneguya species. Host-relatedness is reinforced as the main evolutionary driver for myxobolids, with the positioning of H. cardii n. sp. further suggesting tissue tropism as another important evolutionary driver for marine heart infecting Henneguya. Nonetheless, the inner complexity of this lineage suggests that identification of the evolutionary patterns driving its phylogeny will require discovery of the true diversity of marine myxobolids.

Introduction

Myxosporeans are cnidarian parasites with a complex 2-host life cycle that involves annelid worms as definitive hosts and usually fish as intermediate hosts (Lom and Dyková, 2006). Several myxosporeans cause severe fish diseases that result in considerable economic losses in the fishing and aquaculture industries (Pote et al., 2000; Kent et al., 2001; MacKenzie et al., 2005; Feist and Longshaw, 2006). The genus Henneguya Thélohan, 1892 of the family Myxobolidae Thélohan, 1892, is one of the most diversified myxosporean taxa, comprising more than 250 species described worldwide (Rangel et al., 2023). Henneguya are predominantly histozoic parasites of freshwater fishes, occurring less frequently in brackish/marine hosts. The gills are the main site of infection for these parasites, but they have also been reported from the epidermis, heart, kidneys, intestine, fins, urinary bladder, brain, eyes, gallbladder, liver, gonads, swim bladder, abdominal cavity, cartilage, spleen, among other organs and tissues (Eiras, 2002; Eiras and Adriano, 2012; Rangel et al., 2023).

The European seabass, Dicentrarchus labrax (Linnaeus, 1758) (Moronidae), is an important commercial fish intensively cultured in Portugal and in the Mediterranean (Rocha et al., 2022). Several myxosporeans have been described or reported from this fish host: Sphaerospora testicularis Sitjà-Bobadilla and Álvarez-Pellitero, 1990 from the testis; Kudoa dicentrarchi (Sitjà-Bobadilla and Álvarez-Pellitero, 1992) from the connective tissue of all organs; Ceratomyxa labracis Sitjà-Bobadilla and Álvarez-Pellitero, 1993 and Ceratomyxa diplodae Lubat, Radujković, Marques and Bouix, 1989 from the gallbladder; Ortholinea labracis Rangel, Rocha, Casal, Castro, Severino, Azevedo, Cavaleiro and Santos, 2017 from the urinary bladder and a Myxobilatus sp. from the kidney and urinary bladder (Lubat et al., 1989; Sitjà-Bobadilla and Álvarez-Pellitero, 1990, 1992, 1993; Santos, 1996; Rocha et al., 2016; Rangel et al., 2017; Casal et al., 2019). Except for the latter, all these species have been reported to occur in stocks of D. labrax cultured in southern Portuguese fish farms (Rangel et al., 2016, 2017; Rocha et al., 2016; Castro et al., 2018). Two other myxosporeans, originally described from fish other than European seabass, have also been reported from this host in other geographic locations: Enteromyxum leei (Diamant, Lom and Dyková, 1994) in the gut (Palenzuela et al., 2002; Fioravanti et al., 2006), and Kudoa iwatai Egusa and Shiomitsu, 1983 in the muscle and other organs (Diamant et al., 2005). Additionally, an unnamed Henneguya species infecting the bulbus arteriosus of D. labrax has been reported from St. Gilla lagoon in Sardinia (Italy) (Culurgioni et al., 2010). A novel Henneguya species is described from the bulbus arteriosus of European seabass cultured in a southern Portuguese fish farm, based on a combination of morphological, biological and molecular data. This is the first description of a Henneguya species from Portugal, despite numerous myxobolids having been reported from Portuguese freshwater and estuarine environments (Saraiva and Chubb, 1989; Cruz et al., 1998, 2000; Molnár et al., 2012; Rocha et al., 2019a, 2019b; Guimarães et al., 2023). This species was discovered in the course of research projects on Myxozoa and Coccidia parasites in farmed fish species.

Materials and methods

Sampling of European seabass

Ninety-six specimens of European seabass (D. labrax) were obtained from a fish farm located in the Alvor estuary, Atlantic coast (37°08′N, 8°37′W), Portimão, in Algarve, southern Portugal, from May 2019 to July 2021. Fresh specimens were weighted (g) and measured (cm) prior to being dissected for performing a myxosporean survey of internal organs. Due to mandatory confinements related to the COVID-19 pandemic, fish samplings could not be performed periodically, rendering it impossible to determine the seasonal prevalence of infections.

Myxosporean survey and light microscopy analyses

Several organs, including the heart, spleen, gills, liver, kidneys, gallbladder, intestine and urinary bladder were examined macroscopically using a Zeiss Stemi 2000-C binocular microscope (Grupo Taper, Sintra, Portugal) to detect structural changes or the presence of plasmodia. Microscopic examination of fresh tissue smears was performed using a Zeiss Axiophot microscope (Grupo Taper). Fresh mature myxospores were measured and photographed using an optical microscope equipped with a Zeiss Axiocam digital camera Icc3 and Zeiss Axiovision 4.6.3 software (Grupo Taper). Measurements were performed as recommended by Lom and Arthur (1989) for Henneguya myxospores and are presented as mean ± s.d. (range), followed by the number of myxospores measured for each character.

DNA extraction, amplification and sequencing

DNA from ethanol-preserved myxospores of 2 isolates from 2 individual hosts (R1H and R2H) was separately extracted using the commercial kit GenElute™ Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, Merck Life Science S.L.U., Algés, Portugal), following the manufacturer's instructions. Amplification of the parasite's small subunit ribosomal RNA (SSU rDNA) gene was achieved through the polymerase chain reaction (PCR) using a combination of universal eukaryotic primers and myxozoan-specific primers (Table 1). PCRs were performed in 25 μL reactions containing 2.5 mm of MgCl2, 1×Taq DNA polymerase reaction buffer, 1.25 U of Taq polymerase (NZYTaq II DNA polymerase, NZYTech, Lisbon, Portugal), 0.2 mm deoxyribonucleotide triphosphates (dNTPs) and 0.2 μm of each primer (NZYTech). Amplifications were performed in a Bio-Rad-MJ Mini Gradient Thermal Cycler with initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 94°C for 35 s, annealing at 55°C for 35 s, extension at 72°C for 45 s and a final extension at 72°C for 7 min. Five microliters of the PCR products were screened in a 1% agarose gel in TAE buffer (NZYTech) to confirm amplification. PCR products were purified, and sequenced using the same PCR primers (Table 1) by STAB VIDA (Caparica, Portugal) in a BigDye Terminator v3.1 from the Applied Biosystems Kit and run on an ABI3730XL DNA analyser (Applied Biosystems, STAB VIDA Lda., Caparica, Portugal).

Table 1.

Primers used to amplify and sequencing the SSU rDNA of Henneguya myxospores found infecting the bulbus arteriosus of Dicentrarchus labrax

Name Sequence (5′–3′) Used with Source
18e CTGGTTGATCCTGCCAGT ACT3R, ACT1R Hillis and Dixon (1991)
18R CTACGGAAACCTTGTTACG ACT3F Whipps et al. (2003)
ERIB1 ACCTGGTTGATCCTGCCAG ACT1R Barta et al. (1997)
ACT3f CATGGAACGAACAAT 18R Hallett and Diamant (2001)
ACT3R ATTGTTCGTTCCATG 18e Hallett and Diamant (2001)
ACT1R AATTTCACCTCTCGCTGCCA 18e, ERIB1 Hallett and Diamant (2001)

Phylogenetic analysis

The partial sequences obtained from the PCR products of the 2 isolates were separately assembled using ClustalW in MEGA X software (Nei and Kumar, 2000; Kumar et al., 2018). The newly obtained SSU rDNA sequences were then subjected to BLASTn search (NCBI) to identify similar sequences deposited in the GenBank database. For phylogenetic analyses, 67 SSU rDNA sequences from myxobolids were retrieved, encompassing all sequences with higher than 85% similarity to the isolates under study. This included all other heart infecting Henneguya spp. that have been sequenced to date, namely Henneguya aegea Katharios, Varvarigos, Keklikoglou, Ruetten, Sojan, Akter, Cascarano, Tsertou and Kokkari, 2020, Henneguya akule Work, Takata, Whipps and Kent, 2008, Henneguya cynoscioni Dyková, Buron, Roumillat and Fiala, 2011, Henneguya lateolabracis Yokoyama, Kawakami, Yasuda and Tanaka, 2003, Henneguya mauritaniensis Khlifa, Miller, Adlard, Faye and Sasal, 2012 and Henneguya pagri Yokoyama, Itoh and Tanaka, 2005. The only exception was the sequence of Henneguya zikaweiensis Sikama, 1938 (KR020026), which infects the heart of the freshwater cyprinid Carassius auratus (Linnaeus, 1758) but shares only 75.1% similarity with the isolates under study. The SSU rDNA sequence with GenBank accession no. OR699454 was selected as representative of the several sequences (OR699454, OR699456, OR699457, OR699458, OR699460 and OR699463) deposited in this database, belonging to an unnamed Henneguya sp. from Chirodactylus variegatus (Valenciennes, 1833) in Peru, sharing 91.4–91.6% similarity with the isolates under study. Myxidium lieberkuehni Bütschli, 1882 (X76638) and Zschokkella auratis Rocha, Casal, Rangel, Severino, Castro, Azevedo and Santos, 2013 (KC849425) were used as outgroup. Alignments were performed using MAFFT version 7, available online. Phylogenetic trees were obtained using both maximum-likelihood (ML) and Bayesian inference (BI) analyses. ML analysis was performed using the PhyML 3.0 program (Dereeper et al., 2008; Guindon et al., 2010) available at https://www.phylogeny.fr/. The general time reversible (GTR) model was selected based on the lowest score of the Bayesian information criterion and corrected Akaike information criterion, and bootstrap confidence values were calculated from 1000 replicates. BI analysis was performed in MrBayes v.3.2.6 (Ronquist and Huelsenbeck, 2003), with the GTR model with gamma-shaped rate variations across sites (Invgamma) (GTR + I + G) model evolution. Posterior probabilities were calculated using the Markov chain Monte Carlo method, with 4 chains running simultaneously for 1 million generations, burn-in set at 25% and trees sampled every 500 generations.

Results

Ninety-six specimens of D. labrax were examined. The sample consisted of 35 females, 29 males and 32 fish of undetermined sex, weighing 145.0 ± 72.5 (38.0–340.2) g, and measuring 22.5 ± 3.8 (14.7–30.6) cm in length. Thirteen specimens (13.5%), 4 females, 3 males and 6 of undetermined sex, presented myxosporean infection in both the heart (bulbus arteriosus) and spleen. Infected fish weighed 149.2 ± 49.6 (74.0–218.4) g and measured 23.2 ± 2.6 (19.0–26.7) cm in length. Numerous immature and mature myxospores could be observed within whitish irregularly shaped plasmodia, around 1 mm in size, located in the bulbus arteriosus (Fig. 1), while only loose mature myxospores were detected in fresh smears of the spleen. Morphological examination of myxospores and molecular analyses of the SSU rDNA gene identified the parasite as a new member of the genus Henneguya, herein described as Henneguya cardii n. sp.

Figure 1.

Figure 1.

Irregular white plasmodia of Henneguya cardii n. sp. in the bulbus arteriosus (circle) of Dicentrarchus labrax.

Taxonomic summary

Myxobolidae Thélohan, 1892: Henneguya Thélohan, 1892: Henneguya cardii n. sp.

Type-host: European seabass Dicentrarchus labrax (Linnaeus, 1758) (Moronidae).

Type-locality: Alvor estuary, Atlantic coast (37° 08′ N, 8° 37′ W), Portimão, Algarve, Portugal.

Site of infection: Bulbus arteriosus.

Prevalence: 13.5% (13 out of 96).

Type-material: Series of phototypes of the hapantotype, deposited together with a representative DNA sample in the Type Material Collection of the Laboratory of Animal Pathology, Interdisciplinary Centre of Marine and Environmental Research, Porto, Portugal, reference CIIMAR.2024.90.

Representative DNA sequences: Two SSU rDNA sequences (GenBank accession nos. ON119140 and ON119141).

Zoobank registration: LSID urn:lsid:zoobank.org:act:3E4A797A-D8D1-4119-85F9-E0C2B0ACE859.

Etymology: The specific name ‘cardii’ refers to the heart as the site of infection.

Myxospore description

Myxospores broadly obovoid in frontal view and ellipsoidal in lateral view, with 2 equal caudal appendages forking slightly dislocated from the base. Suture line prominent. Two polar capsules, ovoid and symmetric, each comprising a polar tubule with 3–4 coils (Figs 2 and 3). Mature myxospores measuring 10.2 ± 0.6 (8.8–11.6) (n = 100) μm in length, 8.0 ± 0.7 (5.3–8.8) (n = 50) μm in width and 5.6 ± 0.2 (5.1–6.4) (n = 50) μm in thickness. Caudal appendages 36.6 ± 3.2 (27.4–42.9) (n = 28) μm long. Total spore length 47.6 ± 3.2 (41.2–53.2) (n = 20) μm. Polar capsules measuring 4.0 ± 0.2 (3.4–4.6) (n = 66) μm in length and 2.2 ± 0.1 (1.9–2.6) (n = 66) μm in width.

Figure 2.

Figure 2.

Mature myxospores of H. cardii n. sp. from the bulbus arteriosus of D. labrax: (A) myxospores from a ruptured plasmodium, (B) myxospore in valvular view and (C) myxospores in sutural view.

Figure 3.

Figure 3.

Line drawings of H. cardii n. sp. myxospores: (A) valvular view and (B) sutural view.

Remarks

Myxospore morphometric variation was not detected between different isolates. Morphological comparison with other heart infecting Henneguya species revealed similarities to Henneguya otolithi Ganapati, 1941 and H. lateolabracis (see Table 2). However, H. cardii n. sp. differs from H. otolithi by being slightly shorter (8.8–11.6 vs 10.0–12.0 μm), thicker (5.1–6.4 vs 4.0–5.0 μm) and lacking a thickening running the myxospore body transversally (Ganapati, 1941). Despite some measures of H. cardii n. sp. overlapping with those of H. lateolabracis (Yokoyama et al., 2003), the SSU rDNA sequence of these species share only 87.4% similarity. Although H. cardii n. sp. shares similar myxospore shape with the unnamed Henneguya sp. previously reported from the heart of D. labrax in Sardinia (Culurgioni et al., 2010), morphometric comparison to this species is impossible due to the lack of measurements in the species report.

Table 2.

Myxospore morphometry of Henneguya species infecting the heart, including the newly described Henneguya cardii n. sp.

Species Type host Type locality SBL SBW SBT PCS PCL PCW PTC CAL TSL Source
H. cardii n. sp. Dicentrarchus labrax Portugal 10.2 ± 0.6 (8.8–11.6) 8.0 ± 0.7 (5.3–8.8) 5.6 ± 0.2 (5.1–6.4) = 4.0 ± 0.2 (3.4–4.6) 2.2 ± 0.1 (1.9–2.6) 3–4 36.6 ± 3.2 (27.4–42.9) 47.6 ± 3.2 (41.2–53.2) Present study
Henneguya aegea Pagrus major Greece 12.8 ± 1.0 (10.0–14.9) 8.2 ± 1.1 (5.7–10.9) 6.2 ± 0.6 (5.2–7.0) 3.4 ± 0.6 (1.4–6.8) 1.7 ± 0.3 (0.8–2.5) 42.6 ± 6.5 (34.1–60.6) 64.9 ± 8.7 (53.6–82.8) Katharios et al. (2020)
Henneguya akule Selar crumenophthalmus Hawaii 12.1 ± 0.8 (10.0–14.0) 7.4 ± 0.7 (5.0–9.0) 5.3 ± 0.6 (3.0–7.0) 3.4 ± 1.0 (2.0–6.0) 1.4 ± 0.5 (1.0–2.0) 3–4 40.8 ± 5.2 (29.0–52.0) Work et al. (2008)
Henneguya brachideuteri Brachydeuterus auritus Senegal 11.5 (10.0–12.0) 8.3 (7.0–9.0) = 4.3 (4.0–5.0) 2.6 (2.0–3.0) 26.9 (26.0–29.0) 37.1 (36.0–41.0) Kpatcha et al. (1997)
Henneguya cynoscioni Cynoscion nebulosus USA 10.4 (9.8–11.7) 8.8 5.9 = 3.3 2.0 3–4 28.0 (23.5–33.3) 38.6 (34.3–44.1) Dyková et al. (2011)
Henneguya lateolabracis Lateolabrax sp. Japan 10.7 (9.9–11.9) 7.5 (6.4–7.8) 6.2 (5.9–6.4) = 3.4 (3.0–4.0) 1.7 (1.5–2.0) 3 37.7 (30.7–49.5) Yokoyama et al. (2003)
Henneguya mauritaniensis Pagrus caeruleostictus Mauritania 12.3 ± 0.6 8.0 ± 0.4 = 4.1 ± 0.2 3.0 25.3 ± 3.2 17.9 (15.0–20.5) Khlifa et al. (2012)
Henneguya otolithi Otolithes ruber; Pterotolithus maculatus India 10.0–12.0 6.0–8.5 4.0–5.0 3.0–4.0 2.0–2.5 5–6 35.0–40.0 Ganapati (1941)
Henneguya ouakamensis Mugil cephalus Senegal 10.9 ± 0.6 (9.0–13.0) 6.9 ± 0.4 (5.0–9.0) = 3.8 ± 0.5 (3.0–4.0) 2.4 ± 0.4 (2.0–3.0) 9.9 ± 1.4 (6.0–14.0) 20.9 ± 1.5 (16.0–24.0) Kpatcha et al. (1997)
Henneguya pagri P. major Japan 10.5 (9.9–11.9) 7.5 (6.4–8.4) 5.9 (5.4–6.4) = 3.1 (2.5–4.0) 1.6 (1.5–2.0) 3 29.6 (24.8–34.7) Yokoyama et al. (2005)
Henneguya sebasta Sebastes paucispinis USA 15.1 ± 1.3 (13.0–17.5) 9.2 ± 1.0 (5.6–11.0) 7.1 ± 1.0 (5.0–8.7) 4.5 ± 0.7 (3.7–5.6) 2.4 ± 0.4 (1.8–3.1) 4–6 62.0 ± 13.2 (32.5–87.5) 77.1 ± 12.8 (48.1–82.8) Moser and Love (1975)
Henneguya shackletoni Eleginops maclovinus Falkland Islands 11.5 ± 1.5 (9.5–14.5) 8.5 ± 1.0 (7.0–11.0) 7.0 ± 1.0 (5.4–8.6) = 3.5 ± 0.5 (3.0–5.0) 3.1 ± 0.5 (2.5–3.5) 6–7 37.0 ± 8.0 (25.0–51.0) 49.0 ± 9.0 (34.5–65.5) Brickle et al. (2006)
Henneguya visceralis Electrophorus electricus South America 11.0–12.0 5.0–6.5 4.5 = 6.5–8.0 2.0 11.0–12.0 22.0–24.0 Jakowska and Nigrelli (1953)
Henneguya vitiensis Aurigequula fasciata Fiji Islands 13.7 (12.1–15.8) 7.8 (6.7–8.8) 3.2 (2.7–3.7) 1.7 (1.5–2.0) 3–4 29.1 (22.7–35.5) Laird (1950)
Henneguya yoffensis P. caeruleostictus Senegal 13.3 (12.0–15.0) 9.1 (8.0–11.0) = 3.4 (3.0–4.0) 2.3 (2.0–3.0) 32.1 (24.0–36.0) 46.1 (37.0–50.0) Kpatcha et al. (1997)
Henneguya zikawiensis Carassius auratus Japan 9.5 (8.4–10.8) 8.0 (7.2–9.6) 6.0–6.6 4.5 (4.2–4.8) 3.0 (2.4–3.6) 4–5 15.0–38.4 23.4–49.2 Sikama (1938)

Measurements are given in micrometres. Means are provided with the standard deviation and the range in parentheses, when available.

CAL, caudal appendages length; PCL, polar capsule length; PCS, polar capsule size (=, polar capsules of equal size); PCW, polar capsule width; PTC, polar tubule coils; SBL, myxospore body length; SBT, myxospore body thickness; SBW, myxospore body width; TSL, total myxospore length; –, absence of data.

Overall, the species morphometrically more similar to H. cardii n. sp. are Henneguya clini Reed, Basson, Van As and Dyková, 2007, Henneguya joalensis Kpatcha, Faye, Diebakate, Fall and Toguebaye, 1997, Henneguya lutjani Kpatcha, Faye, Diebakate, Fall and Toguebaye, 1997 and Henneguya tegidiensis Nicholas and Jones, 1959. Henneguya cardii n. sp. and H. clini share nearly identical myxospore body length (10.2 vs 10.0 μm), body width (8.0 vs 7.9 μm), caudal appendage length (36.6 vs 34.0 μm), polar capsules size (4.0 × 2.2 vs 4.0 × 2.2 μm) and total myxospore length (47.6 vs 44.6 μm). However, these species differ in site of infection (heart vs gills), number of polar tubule coils (3–4 vs 4–5), host taxa (Moronidae vs Clinidae) and geographic distribution (limited to the North Atlantic vs limited to South Africa) (Reed et al., 2007). Henneguya cardii n. sp. differs from H. joalensis by having a slightly larger myxospore body (10.2 × 8.0 vs 8.9 × 6.3 μm) and smaller polar capsules (4.0 × 2.2 vs 4.7 × 2.5 μm) (see Kpatcha et al., 1997); from H. lutjani by having smaller myxospore body length (10.2 vs 11.6 μm), larger myxospore body width (8.0 vs 7.2 μm) and divergent polar capsules (4.0 × 2.2 vs 3.8 × 2.9 μm) (see Kpatcha et al., 1997) and from H. tegidiensis by being less thick (5.6 vs 6.7 μm) and having a distinct host environment (marine vs fresh water) (see Nicholas and Jones, 1959).

Molecular analysis

Isolates R1H (ON119140) and R2H (ON119141) generated SSU rDNA sequences with 2016 and 2025 bp, respectively. These were 100% identical between each other, and BLASTn search did not retrieve highly similar SSU rDNA sequences from the GenBank database. The most similar sequences belonged to an unnamed Henneguya sp. (OR699454, OR699456, OR699457, OR699458, OR699460 and OR699463) from the Peruvian morwong C. variegatus (Valenciennes, 1833) (91.4–91.6%), Henneguya lagunensis de Azevedo, Negrelli, de Oliveira, Abdallah, Camara, Matos and Vieira, 2021 (MT676010) from Brazilian mojarra Eugerres brasilianus (Cuvier, 1830) (90.9%), H. pagri (AB183748) from red seabream Pagrus major (Temminck and Schlegel, 1843) (90.8%), H. mauritaniensis (JQ687060) from bluespotted seabream Pagrus caeruleostictus (Valenciennes, 1830) (90.7%) and H. cynoscioni (JN017203) from spotted weakfish Cynoscion nebulosus (Cuvier, 1830) (90.4%).

ML and BI analyses yielded similar topologies (Fig. 4). The isolates of H. cardii n. sp. clustered within a well-supported clade comprising other Myxobolus and Henneguya spp. that have also been reported from marine environments, and that mostly infect fish belonging to Eupercaria incertae sedis, but also Carangiformes, Blenniiformes, Acropomatiformes and Centrarchiformes. The sequences of other Henneguya spp. that have been reported from the heart were also grouped within this clade, namely H. aegea, H. akule, H. cynoscioni, H. lateolabracis, H. mauritaniensis and H. pagri. Another marine clade of myxobolids was retrieved and included solely the sequences of Myxobolus spp. reported from Mugiliformes. Overall, a host-associated phylogenetic pattern was retrieved in our analyses, with species that infect Siluriformes, Characiformes, Perciformes, Centrarchiformes, Mugiliformes, Carangiformes and Eupercaria incertae sedis mostly forming well-supported clades. Some entropy was retrieved within the clade comprising H. cardii n. sp. and other marine Myxobolus/Henneguya, but this is most likely the result of low inner nodal supports.

Figure 4.

Figure 4.

Tree topology resulting from the ML analysis of 65 SSU rDNA sequences from myxobolids, including H. cardii n. sp. (sequences within grey box), and all other marine heart-infecting Henneguya spp. (sequences in bold). Numbers at the nodes are ML bootstrap values/BI posterior probabilities; dashes represent a different branching of the BI tree or a bootstrap support value under 50. Species reported from brackish/marine environments are indicated by black squares (■). The remaining species were reported from freshwater environments. Information on host taxonomy is given on the right.

Discussion

Currently, the description and taxonomic classification of myxosporeans rely on the combined analysis of several criteria, which include myxospore morphology, host and tissue specificity and molecular data (Atkinson et al., 2015). This holistic approach overcomes the artificiality of traditional morphology-based taxonomy, allowing reliable differentiation among congeners that share high morphological similarity. Nonetheless, the great majority of Henneguya species lack DNA data, making it inevitable to resort to myxospore morphology when identifying species that belong to this genus. The description of H. cardii n. sp. in this study was based on a comprehensive analysis of morphological, biological and molecular data. The species molecularly most similar to H. cardii n. sp. were an unnamed Henneguya sp. from the Peruvian morwong C. variegatus, H. lagunensis, H. pagri, H. mauritaniensis and H. cynoscioni, ranging between 90.4 and 91.5% similarity. Thus, the smallest divergence to H. cardii n. sp. was 8.5%, meaning that H. cardii n. sp. is clearly distinct from GenBank records. All congeners without molecular data could be differentiated from H. cardii n. sp. based on morphological aspects and host species. An unnamed Henneguya sp. previously reported from the heart of D. labrax in Sardinia, Mediterranean Sea (Culurgioni et al., 2010), was observed to share some morphological similarity to H. cardii n. sp. Nonetheless, a formal comparison could not be performed due to the lack of myxospore measurements or molecular information from the Italian species report.

Henneguya spp. are typically parasites of fish gills but have also been described from several other organs, including the heart. The concomitant occurrence of Henneguya in the heart and other organs has been suggested to be the result of myxospore spreading through the bloodstream, as with Henneguya visceralis, which develops in the kidneys, disseminating via blood to the heart, liver, spleen, gallbladder, and other organs and tissues (Jakowska and Nigrelli, 1953). On the contrary, myxospores of H. aegea develop in the heart prior to being disseminated to other organs through the bloodstream (Katharios et al., 2020). The same was observed in H. cardii n. sp., which sporogonic development occurs in the heart, with mature myxospores being seemingly transported to the spleen, where they could be observed isolated.

The phylogenetic analyses performed in this study revealed H. cardii n. sp. positioned within a well-supported lineage of myxobolids that infect marine hosts, and that is predominantly comprised by Henneguya spp., including few Myxobolus representatives. The caudal appendages of Henneguya have been suggested to optimize the dispersion capacity of myxospores in freshwater habitats or over longer distances (Liu et al., 2019). Thus, the predominance of the Henneguya morphotype in the marine lineage of myxobolids strengthens the contention that character evolution is a complex and dynamic process that cannot be fully comprehended based on a single criterion, given that it most likely involves several host- and environment-related factors. For instance, mugiliform-infecting myxobolids mostly belong to the genus Myxobolus, whose morphotype has been hypothesized to optimize transmission to the deposit-feeding oligochaetes that host their actinospore development in marine habitats (Rocha et al., 2020). Discover of additional Myxobolidae life cycles would allow a better understanding of myxospore morphological character evolution.

In agreement with previously published cladograms of myxobolids (Carriero et al., 2013; Liu et al., 2019), our phylogenetic analyses retrieved host-associated clustering. A tendency of gill and muscle-infecting myxobolids to cluster according to the site of infection has also been shown in the literature (Eszterbauer, 2004; Molnár and Eszterbauer, 2015) and suggests tissue tropism as a potential minor evolutionary driver for this myxosporean group. Accordingly, the tree topology obtained in this study supports a close relationship between marine heart-infecting Henneguya species. The overall low support of the marine lineage inner nodes suggests that a hidden diversity of marine myxobolids is yet to be explored that could ultimately provide better resolution of large- and fine-scale factors influencing evolutionary patterns.

Although clinical signs of infection by H. cardii n. sp. were not observed in this study, a histopathological assessment is required to evaluate the potential pathological impact that this myxosporean might have in the production of European seabass.

Acknowledgements

We thank Dr David Gibson for his support with the choice of the specific name of the new species.

Data availability statement

All data supporting the findings of this study are available within the paper. Sequence data are available on the NCBI GenBank database.

Author contributions

All authors contributed to the study conception and design, and for the financial funding. Fish samples were provided by R. S. Material preparation, data collection and analysis were performed by L. F. R. and S. R. The first draft of the manuscript was written by L. F. R. and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Financial support

This research was supported by national funds through FCT – Foundation for Science and Technology (L. F. R. and M. J. S., grant numbers UIDB/04423/2020 and UIDP/04423/2020), [L. F. R., employment contract CEECIND/03501/2017/CP1420/CT0010 (https://doi.org/10.54499/CEECIND/03501/2017/CP1420/CT0010)], [S. R., project PTDC/BIA-BMA/6363/2020 (http://doi.org/10.54499/PTDC/BIA-BMA/6363/2020) and employment contract 2022.06670.CEECIND/CP1735/CT0007 (https://doi.org/10.54499/2022.06670.CEECIND/CP1735/CT0007)].

Competing interests

None.

Ethical standards

All applicable international, national and/or institutional guidelines for the care and use of animals were followed.

References

  1. Atkinson SD, Bartošová-Sojková P, Whipps CM and Bartholomew JL (2015) Approaches for characterising myxozoan species. In Okamura B, Gruhl A and Bartholomew JL (eds), Myxozoan Evolution, Ecology and Development. Cham, Switzerland: Springer International Publishing, pp. 111–123. [Google Scholar]
  2. Barta JR, Martin DS, Liberator PA, Dashkevicz M, Anderson JW, Feighner SD, Elbrecht A, Perkins-Barrow A, Jenkins MC, Danforth HD, Ruff MD and Profous-Juchelka H (1997) Phylogenetic relationships among eight Eimeria species infecting domestic fowl inferred using complete small subunit ribosomal DNA sequences. Journal of Parasitology 83, 262–271. [PubMed] [Google Scholar]
  3. Brickle P, Kalavati C and MacKenzie K (2006) Henneguya shackletoni sp. nov. (Myxosporea, Bivalvulida, Myxobolidae) from the Falklands mullet, Eleginops maclovinus (Cuvier) (Teleostei, Eleginopidae) in the Falkland Islands. Acta Parasitologica 51, 36–39. [Google Scholar]
  4. Carriero MM, Adriano EA, Silva MRM, Ceccarelli PS and Maia AAM (2013) Molecular phylogeny of the Myxobolus and Henneguya genera with several new South American species. PLoS ONE 8, e73713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Casal G, Soares EC, Rocha S, Silva TJ, Santos EL, Nascimento R, Oliveira E and Azevedo C (2019) Description of a new myxozoan Kudoa eugerres n. sp. and reclassification of two Sphaerospora sensu lato species. Parasitology Research 118, 1719–1730. [DOI] [PubMed] [Google Scholar]
  6. Castro R, Cavaleiro FI, Rangel L, Rocha S, Severino R, Casal G and Santos MJ (2018) Myxozoan parasites of the European sea bass, Dicentrarchus labrax (Teleostei: Moronidae): correlates of infections at the micro- and macroenvironment scales. Aquaculture 485, 17–24. [Google Scholar]
  7. Cruz C, Ferreira S and Saraiva AM (1998) Ocorrência de Myxobolus cyprini em Chondrostoma polylepis em Portugal. Acta Parasitológica Portuguesa 5, 63–66. [Google Scholar]
  8. Cruz C, Saraiva A and Ferreira S (2000) Preliminary observations on Myxobolus sp. from cyprinid fishes in Portugal. Bulletin of the European Association of Fish Pathologists 20, 65–69. [Google Scholar]
  9. Culurgioni J, Murtas R, Cannella S and Figus V (2010) Parasites of wild European sea bass Dicentrarchus labrax (Linnaeus, 1758) from St. Gilla lagoon (Sardinia, South western Mediterranean). Ittiopatologia 7, 123–133. [Google Scholar]
  10. Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, Dufayard JF, Guindon S, Lefort V, Lescot M, Claverie JM and Gascuel O (2008) Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Research 36(Suppl. 2), W465–W469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Diamant A, Ucko M, Paperna I, Colorni A and Lipshitz A (2005) Kudoa iwatai (Myxosporea: Multivalvulida) in wild and cultured fish in the Red Sea: redescription and molecular phylogeny. Journal of Parasitology 91, 1175–1189. [DOI] [PubMed] [Google Scholar]
  12. Dyková I, Buron I, Roumillat WA and Fiala I (2011) Henneguya cynoscioni sp. n. (Myxosporea: Bivalvulidae), an agent of severe cardiac lesions in spotted seatrout, Cynoscion nebulosus (Teleostei: Sciaenidae). Folia Parasitologica 58, 169–177. [DOI] [PubMed] [Google Scholar]
  13. Eiras JC (2002) Synopsis of the species of the genus Henneguya Thélohan, 1892 (Myxozoa: Myxosporea: Myxobolidae. Systematic Parasitology 52, 43–54. [DOI] [PubMed] [Google Scholar]
  14. Eiras J and Adriano E (2012) A checklist of new species of Henneguya Thélohan, 1892 (Myxozoa: Myxosporea, Myxobolidae) described between 2002 and 2012. Systematic Parasitology 83, 95–104. [DOI] [PubMed] [Google Scholar]
  15. Eszterbauer E (2004) Genetic relationship among gill-infecting Myxobolus species (Myxosporea) of cyprinids: molecular evidence of importance of tissues specificity. Diseases of Aquatic Organisms 58, 35–40. [DOI] [PubMed] [Google Scholar]
  16. Feist SW and Longshaw M (2006) Phylum Myxozoa. In Woo PTK (ed.), Fish Diseases and Disorders. Volume 1: Protozoan and Metazoan Infections. Oxfordshire, UK: CAB International, pp. 230–296. [Google Scholar]
  17. Fioravanti ML, Caffara M, Florio D, Gustinelli A and Marcer F (2006) A parasitological survey of European sea bass (Dicentrarchus labrax) and gilthead sea bream (Sparus aurata) cultured in Italy. Veterinary Research Communications 30, 249–252.16437300 [Google Scholar]
  18. Ganapati PN (1941) On a new myxosporidian Henneguya otolithi n. sp. a tissue parasite from the bulbus arteriosus of two species of fish of the genus Otolithus. Proceedings of the Indian Academy of Sciences Part B 13, 135–150. [Google Scholar]
  19. Guimarães J, Casal G, Alves Â, Araújo C and Rocha S (2023) Myxozoan survey of thicklip grey mullet Chelon labrosus reinforces successful radiation of Myxobolus in mugiliform hosts. Parasite 30, 26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W and Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology 59, 307–321. [DOI] [PubMed] [Google Scholar]
  21. Hallett SL and Diamant A (2001) Ultrastructure and small-subunit ribosomal DNA sequence of Henneguya lesteri n. sp. (Myxosporea), a parasite of sand whiting Sillago analis (Sillaginidae) from the coast of Queensland, Australia. Diseases of Aquatic Organisms 46, 197–212. [DOI] [PubMed] [Google Scholar]
  22. Hillis DM and Dixon MT (1991) Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66, 411–453. [DOI] [PubMed] [Google Scholar]
  23. Jakowska S and Nigrelli RF (1953) The pathology of myxosporidiosis in the electric eel, Electrophorus electricus (Linnaeus), caused by Henneguya visceralis and H. electrica spp. nov. Zoologica 38, 183–191. [Google Scholar]
  24. Katharios P, Varvarigos P, Keklikoglou K, Ruetten M, Sojan J, Akter M, Cascarano MC, Tsertou MI and Kokkari C (2020) Native parasite affecting an introduced host in aquaculture: cardiac henneguyosis in the red seabream Pagrus major Temminck & Schlegel (Perciformes: Sparidae) caused by Henneguya aegea n. sp. (Myxosporea: Myxobolidae). Parasites & Vectors 13, 27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kent ML, Andree KB, Bartholomew JL, El-Matbouli M, Desser SS, Devlin RH, Feist SW, Hedrick RP, Hoffmann RW, Khattra J, Hallett SL, Lester RJG, Longshaw M, Palenzuela O, Siddall ME and Xiao C (2001) Recent advances in our knowledge of the Myxozoa. Journal of Eukaryotic Microbiology 48, 395–413. [DOI] [PubMed] [Google Scholar]
  26. Khlifa S, Miller TL, Adlard RD, Faye N and Sasal P (2012) Henneguya mauritaniensis n. sp. (Myxozoa) from the arterial bulb of Pagrus caeruleostictus (Valenciennes, 1830) off Mauritania. Parasitology Research 111, 1287–1294. [DOI] [PubMed] [Google Scholar]
  27. Kpatcha TK, Faye N, Diebakate C, Fall M and Toguebaye BS (1997) Nouvelles espèces d’Henneguya Thélohan, 1895 (Myxozoa, Myxosporea) parasites des poissons marins du Sénégal: Étude en microscopie photonique et électronique. Annales des Sciences Naturelles, Zoologie, Paris 13e Série 18, 81–91. [Google Scholar]
  28. Kumar S, Stecher G, Li M, Knyaz C and Tamura K (2018) MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35, 1547–1549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Laird M (1950) Henneguya vitiensis n. sp. a myxosporidian from a Fijian marine fish, Leiognathus fasciatus (Lacépède, 1803). Journal of Parasitology 36, 285–298. [PubMed] [Google Scholar]
  30. Liu Y, Lövy A, Gu Z and Fiala I (2019) Phylogeny of Myxobolidae (Myxozoa) and the evolution of myxospore appendages in the Myxobolus clade. International Journal for Parasitology 49, 523–530. [DOI] [PubMed] [Google Scholar]
  31. Lom J and Arthur JR (1989) A guideline for the preparation of species descriptions in Myxosporea. Journal of Fish Diseases 12, 151–156. [Google Scholar]
  32. Lom J and Dyková I (2006) Myxozoan genera: definition and notes on taxonomy, life-cycle terminology and pathogenic species. Folia Parasitologica 53, 1–36. [PubMed] [Google Scholar]
  33. Lubat V, Radujković BM, Marques A and Bouix G (1989) Parasites des poissons marins du Montenegro: Myxosporidies. Acta Adriatica 30, 31–50. [Google Scholar]
  34. MacKenzie K, Kalavati C, Gaard M and Hemmingsen W (2005) Myxosporean gall bladder parasites of gadid fishes in the North Atlantic: their geographical distributions and an assessment of their economic importance in fisheries and mariculture. Fisheries Research 76, 454–465. [Google Scholar]
  35. Molnár K and Eszterbauer E (2015) Specificity of infection sites in vertebrate hosts. In Okamura B, Gruhl A and Bartholomew JL (eds), Myxozoan Evolution, Ecology and Development. Cham, Switzerland: Springer International Publishing, pp. 295–313. [Google Scholar]
  36. Molnár K, Eszterbauer E, Marton S, Székely C and Eiras JC (2012) Comparison of the Myxobolus fauna of common barbel from Hungary and Iberian barbel from Portugal. Diseases of Aquatic Organisms 100, 231–248. [DOI] [PubMed] [Google Scholar]
  37. Moser M and Love MS (1975) Henneguya sebasta sp. n. (Protozoa, Myxosporida) from California rockfish, Sebastes spp. Journal of Parasitology 61, 481–483. [PubMed] [Google Scholar]
  38. Nei M and Kumar S (2000) Molecular Evolution and Phylogenetics. New York, USA: Oxford University Press. [Google Scholar]
  39. Nicholas WL and Jones JW (1959) Henneguya tegidiensis sp. nov. (Myxosporidia), from the freshwater fish Coregonus clupeoides pennantii (the gwiniad). Parasitology 49, 1–5. [DOI] [PubMed] [Google Scholar]
  40. Palenzuela O, Redondo MJ and Álvarez-Pellitero P (2002) Description of Enteromyxum scophthalmi gen. nov., sp. nov. (Myxozoa), an intestinal parasite of turbot (Scophthalmus maximus L.) using morphological and ribosomal RNA sequence data. Parasitology 124, 369–379. [DOI] [PubMed] [Google Scholar]
  41. Pote PM, Hanson LA and Shivaji R (2000) Small subunit ribosomal RNA sequences link the cause of proliferative gill disease in channel catfish to Henneguya n. sp. (Myxozoa: Myxosporea). Journal of Aquatic Animal Health 12, 230–240. [Google Scholar]
  42. Rangel LF, Castro R, Rocha S, Severino R, Casal G, Azevedo C, Cavaleiro F and Santos MJ (2016) Tetractinomyxon stages genetically consistent with Sphaerospora dicentrarchi (Myxozoa: Sphaerosporidae) found in Capitella sp. (Polychaeta: Capitellidae) suggest potential role of marine polychaetes in parasite's life cycle. Parasitology 143, 1067–1073. [DOI] [PubMed] [Google Scholar]
  43. Rangel LF, Rocha S, Casal G, Castro R, Severino R, Azevedo C, Cavaleiro F and Santos MJ (2017) Life cycle inference and phylogeny of Ortholinea labracis n. sp. (Myxosporea: Ortholineidae), a parasite of the European seabass Dicentrarchus labrax (Teleostei: Moronidae), in a Portuguese fish farm. Journal of Fish Diseases 40, 243–262. [DOI] [PubMed] [Google Scholar]
  44. Rangel LF, Santos MJ and Rocha S (2023) Synopsis of the species of Henneguya Thélohan, 1892 (Cnidaria: Myxosporea: Myxobolidae) described since 2012. Systematic Parasitology 100, 291–305. [DOI] [PubMed] [Google Scholar]
  45. Reed CC, Basson L, Van As LL and Dyková I (2007) Four new myxozoans (Myxosporea: Bivalvulida) from intertidal fishes along the south coast of Africa. Folia Parasitologica 54, 283–292. [DOI] [PubMed] [Google Scholar]
  46. Rocha S, Rangel LF, Castro R, Severino R, Azevedo C, Santos MJ and Casal G (2016) Ultrastructure and phylogeny of Ceratomyxa diplodae (Myxosporea: Ceratomyxidae), from gall bladder of European seabass Dicentrarchus labrax. Diseases of Aquatic Organisms 121, 117–128. [DOI] [PubMed] [Google Scholar]
  47. Rocha S, Azevedo C, Alves Â, Antunes C and Casal G (2019a) Morphological and molecular characterization of myxobolids (Cnidaria, Myxozoa) infecting cypriniforms (Actinopterygii, Teleostei) endemic to the Iberian Peninsula. Parasite 26, 48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Rocha S, Casal G, Alves Â, Antunes C, Rodrigues P and Azevedo C (2019b) Myxozoan biodiversity in mullets (Teleostei, Mugilidae) unravels hyperdiversification of Myxobolus (Cnidaria, Myxosporea). Parasitology Research 118, 3279–3305. [DOI] [PubMed] [Google Scholar]
  49. Rocha S, Rangel LF, Casal G, Azevedo C, Rodrigues P and Santos MJ (2020) Involvement of sphaeractinomyxon in the life cycle of mugiliform-infecting Myxobolus (Cnidaria, Myxosporea) reveals high functionality of actinospore morphotype in promoting transmission. Parasitology 147, 1320–1329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rocha CP, Cabral HN, Marques JC and Gonçalves AMM (2022) A global overview of aquaculture food production with a focus on the activity's development in transitional systems – the case study of a south European country (Portugal). Journal of Marine Science and Engineering 10, 417. [Google Scholar]
  51. Ronquist F and Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. [DOI] [PubMed] [Google Scholar]
  52. Santos MJ (1996) Observations on the parasitofauna of wild sea bass (Dicentrarchus labrax L.) from Portugal. Bulletin of the European Association of Fish Pathologists 16, 77–79. [Google Scholar]
  53. Saraiva A and Chubb JC (1989) Preliminary observations on the parasites of Anguilla anguilla (L.) from Portugal. Bulletin of the European Association of Fish Pathologists 9, 88–89. [Google Scholar]
  54. Sikama Y (1938) On a new species of Henneguya found in a freshwater fish in China. Journal of the Shanghai Science Institute 4, 135–138. [Google Scholar]
  55. Sitjà-Bobadilla A and Álvarez-Pellitero P (1990) Sphaerospora testicularis sp. nov. (Myxosporea: Sphaerosporidae) in wild and cultured sea bass, Dicentrarchus labrax (L.), from the Spanish Mediterranean area. Journal of Fish Diseases 13, 193–203. [Google Scholar]
  56. Sitjà-Bobadilla A and Álvarez-Pellitero P (1992) Light and electron microscopic description of Sphaerospora dicentrarchi n. sp. (Myxosporea: Sphaerosporidae) from wild and cultured sea bass, Dicentrarchus labrax L. Journal of Eukaryotic Microbiology 39, 273–281. [Google Scholar]
  57. Sitjà-Bobadilla A and Álvarez-Pellitero P (1993) Light and electron microscopical description of Ceratomyxa labracis n. sp. and a redescription of C. diplodae (Myxosporea: Bivalvulida) from wild and cultured Mediterranean sea bass Dicentrarchus labrax (L.) (Teleostei: Serranidae). Systematic Parasitology 26, 215–223. [Google Scholar]
  58. Whipps CM, Adlard RD, Bryant MS, Lester RJG, Findlav V and Kent ML (2003) First report of three Kudoa species from Eastern Australia: Kudoa thyrsites from Mahi mahi (Coryphaena hippurus), Kudoa amamiensis and Kudoa minithyrsites n. sp. from sweeper (Pempheris ypsilychnus). Journal of Eukaryotic Microbiology 50, 215–219. [DOI] [PubMed] [Google Scholar]
  59. Work TM, Takata G, Whipps CM and Kent ML (2008) A new species of Henneguya in the big-eyed scad (Selar crumenophthalmus) from Hawaii. Journal of Parasitology 94, 524–529. [DOI] [PubMed] [Google Scholar]
  60. Yokoyama H, Kawakami H, Yasuda H and Tanaka S (2003) Henneguya lateolabracis sp. n. (Myxozoa: Myxosporea), the causative agent of cardiac henneguyosis in Chinese sea bass Lateolabrax sp. Fisheries Science 69, 1116–1120. [Google Scholar]
  61. Yokoyama H, Itoh N and Tanaka S (2005) Henneguya pagri n. sp. (Myxozoa: Myxosporea) causing cardiac henneguyosis in red sea bream, Pagrus major (Temminck & Schlegel). Journal of Fish Diseases 28, 479–487. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data supporting the findings of this study are available within the paper. Sequence data are available on the NCBI GenBank database.


Articles from Parasitology are provided here courtesy of Cambridge University Press

RESOURCES