Skip to main content
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2023 Oct 25;40(1):35–45. doi: 10.1002/kjm2.12767

ANXA1sp attenuates sepsis‐induced myocardial injury by promoting mitochondrial biosynthesis and inhibiting oxidative stress and autophagy via SIRT3 upregulation

Song Qin 1, Ying‐Cong Ren 1, Jun‐Ya Liu 1, Wen‐Bo Chen 1, Bao Fu 1, Jie Zheng 2, Xiao‐Yun Fu 1,
PMCID: PMC11895643  PMID: 37877496

Abstract

Sepsis‐induced myocardial injury is one of the most difficult complications of sepsis in intensive care units. Annexin A1 (ANXA1) short peptide (ANXA1sp) protects organs during the perioperative period. However, the protective effect of ANXA1sp against sepsis‐induced myocardial injury remains unclear. We aimed to explore the protective effects and mechanisms of ANXA1sp against sepsis‐induced myocardial injury both in vitro and in vivo. Cellular and animal models of myocardial injury in sepsis were established with lipopolysaccharide. The cardiac function of mice was assessed by high‐frequency echocardiography. Elisa assay detected changes in inflammatory mediators and markers of myocardial injury. Western blotting detected autophagy and mitochondrial biosynthesis‐related proteins. Autophagic flux changes were observed by confocal microscopy, and autophagosomes were evaluated by TEM. ATP, SOD, ROS, and MDA levels were also detected.ANXA1sp pretreatment enhanced the 7‐day survival rate, improved cardiac function, and reduced TNF‐α, IL‐6, IL‐1β, CK‐MB, cTnI, and LDH levels. ANXA1sp significantly increased the expression of sirtuin‐3 (SIRT3), mitochondrial biosynthesis‐related proteins peroxisome proliferator‐activated receptor γ co‐activator 1α (PGC‐1α), and mitochondrial transcription factor A (TFAM). ANXA1sp increased mitochondrial membrane potential (△Ψm), ATP, and SOD, and decreased ROS, autophagy flux, the production of autophagosomes per unit area, and MDA levels. The protective effect of ANXA1sp decreased significantly after SIRT3 silencing in vitro and in vivo, indicating that the key factor in ANXA1sp's protective role is the upregulation of SIRT3. In summary, ANXA1sp attenuated sepsis‐induced myocardial injury by upregulating SIRT3 to promote mitochondrial biosynthesis and inhibit oxidative stress and autophagy.

Keywords: annexin‐A1 short peptide, mitochondrial biosynthesis, sepsis‐induced myocardial injury, sirtuin 3

1. INTRODUCTION

Sepsis is a life‐threatening organ dysfunction caused by infection. 1 Each year, there are around 31.5 million sepsis patients worldwide, and of these more than 5 million patients die. 2 Its high morbidity and mortality consume a large amount of medical resources. 3

Mitochondria are the organelles responsible for energy production and cellular homeostasis in most eukaryotic cells. 4 As major mechanisms involved in mitochondrial quality control, mitochondrial biosynthesis and mitochondrial autophagy (mitophagy) play crucial roles in maintaining proper mitochondrial function by generating new mitochondria and selectively removing damaged mitochondria. 5 Hence, the interplay of mitochondrial biosynthesis and mitophagy is essential for the maintenance of mitochondrial homeostasis. Regulation of mitochondrial homeostasis forms a stress network mechanism during stress, and once this regulation mechanism is broken, it leads to mitochondrial dysfunction. 6 The destruction of mitochondrial homeostasis is an important mechanism leading to acute organ function injury and cell senescence. 7 Funk et al., have reported that abnormal expression of mitochondrial biosynthesis‐related proteins (PGC‐1α and TFAM) and mitophagy‐related protein (LC3‐II) may occur during organ function injury, 8 indicating the involvement of mitochondrial biosynthesis disorder and mitophagy dysfunction in organ injury. As demonstrated by former studies, mitochondrial dysfunction injury is not only a key factor of myocardial injury in sepsis but also an important cause of multiple organ injury and even failure. 9 Therefore, it is vital to seek an exogenous method to regulate mitochondrial homeostasis to protect mitochondrial function in sepsis‐induced myocardial injury.

Annexin A1 (ANXA1) is an important endogenous inflammatory terminator in the body. 10 ANXA1, mainly expressed in the myocardium, brain, kidney, and lung tissues, is involved in various regulatory activities in the body. 11 Annexin‐A1 is difficult to develop as a drug because of its insolubility. An ANXA1 short peptide (ANXA1sp) synthesized by Dr. Zhang has been confirmed to have strong protective effects on the heart and brain and anti‐inflammatory effects in animal models of myocardial ischemia/reperfusion and cardiopulmonary bypass. 12 In addition, the protective effect of ANXA1sp may be related to the promotion and activation of sirtuin‐3 (SIRT3) in the myocardial mitochondrial matrix, thus stabilizing mitochondrial function. 13 In studies of renal ischemia–reperfusion, ANXA1sp upregulating SIRT3 improved mitochondrial function and protected against renal injury. 14 By deacetylating complexes I and III, SIRT3 prevents ROS from being produced as by‐products of oxidative phosphorylation, improving the overall efficacy of mitochondrial electron transport chains. 15 An increasing number of scholars believe that SIRT3 functions as a mitochondrial switch, playing an important role in regulating mitochondrial function. 16 In sepsis, cardiomyocyte injury is associated with complex immune responses and inflammatory damage. Further studies are needed to determine whether ANXA1sp can also maintain mitochondrial homeostasis by controlling the activation of SIRT3, a key target, to achieve its antiseptic effect.

Whether ANXA1sp can regulate mitochondrial homeostasis by upregulating SIRT3 in sepsis‐induced myocardial injury has not been studied. In this study, we attempted to clarify the protective effect of ANXA1sp on sepsis‐induced myocardial injury by upregulating SIRT3‐mediated oxidative stress and autophagy inhibition and inducing mitochondrial biosynthesis, providing a new strategy for the treatment of sepsis‐induced myocardial injury.

2. MATERIALS AND METHODS

2.1. Animals and animal model

Male C57BL/6 mice (25–30 g, 8–10 weeks old) were purchased from Changsha Tianqin Biotechnology Co., Ltd. (Animal License No. SCXK; Xiang 2019–0004). This study was approved by the Experimental Animal Ethics Committee of Zunyi Medical University (approval number: 2020‐2‐145). SIRT3 siRNA (5‐CCAUCUUUGAACUAGGCUUTT‐3 and 5‐AAGCCUAGUUCAAAGAUGGTT‐3, Hanbio, Shanghai, China) was diluted in normal saline and administered through the tail vein at a dose of 20 mg/kg once every 2 days for 4 consecutive times. When SIRT3 is successfully silenced, it can be used in subsequent experiments.

To simulate sepsis‐induced myocardial injury in vivo, mice received intraperitoneal injections of LPS (10 mg/kg), as previously described. 17 , 18 ANXA1sp (Ac‐QAW, Ac = acetyl, MW = 445.47 Da) was synthesized and purified (>98% purity) using GenScript (Piscataway, NJ, USA). ANXA1sp (1 mg/kg) was administered intraperitoneally once daily for 3 days before LPS injection. A total of 12 h after LPS stimulation, mice were anesthetized by isoflurane inhalation for echocardiography. A total of 24 h after induction, mice were anesthetized to collect blood samples from the eyes. Then, all mice were euthanized to harvest mouse hearts.

2.2. Echocardiography

The cardiac function of mice was assessed by high‐frequency echocardiography (Vevo2100, VisualSonics, Toronto, ON, Canada) with a 30‐MHz linear array ultrasound transducer. Mice were anesthetized using a respiratory anesthesia machine for small animals (Shenzhen Rayward Biotechnology Co., Ltd., China) with 1.5% isoflurane (Shenzhen Rayward Biotechnology Co., Ltd., China). The parameters, including left ventricular ejection fraction (EF)%, left ventricular short axis shortening rate (FS)%, and diastolic left ventricular diameter (LVIDd), were collected from three to five cardiac cycles.

2.3. Hematoxylin and eosin and immunohistochemical staining

The mouse heart was fixed with 4% formaldehyde overnight and embedded in paraffin to prepare 5 μm sections. Myocardial tissue was transected from the middle of the heart for hematoxylin and eosin (H&E) staining to assess myofilament morphology and inflammatory cell infiltration.

Heart tissues preserved in 2.5% glutaraldehyde‐polyoxymethylene solution were dehydrated and embedded in paraffin, following routine methods. Endogenous peroxidase was inactivated by 3% H2O2, and nonspecific protein‐binding sites were blocked with 10% goat serum. The fragments were incubated with an LC3b antibody (cat. no. #83506; dilution, 1:50; Cell Signaling Technology, Danvers, MA, USA) overnight at 4°C. Finally, the slices were incubated with goat anti‐rabbit IgG polymer at 37°C for 50 min at room temperature for 5 min.

2.4. Cell culture and treatment

HL‐1 myofibroblasts were obtained from the Cell Bank of the Chinese Academy of Sciences. SIRT3 siRNA (40 nM) was added to the cell culture medium when the cells grew to 60% of the plate and transfected for 48 h.

To simulate sepsis‐induced myocardial injury in vitro, LPS (1 μg/mL) was added to the HL‐1 culture medium for 12 h after transfection. For ANXA1sp pretreatment, ANXA1sp was added to the cell culture medium 1 h before LPS induction. After HL‐1 cells were treated with LPS for 6 h, the cell culture medium was collected.

2.5. Cell counting Kit‐8 counts cell viability

A standard curve was constructed using the Cell Counting kit‐8 (Cat: 1210; Solarbio, Beijing, China), and cell viability was calculated.

2.6. Detection of the apoptosis rate of HL‐1 cells by flow cytometry

The cell suspension was centrifuged at 300 × g for 5 min for each group. The supernatant was removed and the cell precipitate was resuspended in 1 mL of 1× Annexin V binding buffer (Cat: 1020; Solarbio, Beijing, China) pre‐cooled at 4°C. Five hundred microliters of the cell suspension were placed into a flow cytometry tube, and 5 μL of FITC‐Annexin V (Cat: 1020; Solarbio, Beijing, China) was added and incubated at 4°C in the dark for 10 min. Then, 5 μL propidium iodide (Cat: 1020; Solarbio, Beijing, China; 5 μL) was added and mixed for 5 min. The apoptosis rate of the HL‐1 cells was determined using a flow cytometer (Beckman Coulter, Brea, CA, USA).

2.7. Molecular docking

The ANXA1sp (Ac‐Gln‐Ala‐Tyr) molecular structure was obtained from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/), and the SIRT3 (PDB ID: 4 JSR) target protein structure was obtained from the bank database (https://www.rcsb.org/structure/4JSR). Molecular docking was performed using the Glide module in Schrodinger Maestro software. Protein processing using the protein preparation wizard module.

2.8. Quantitative real‐time PCR

Total RNA was isolated using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA). A TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Waltham, MA, USA) was used to generate SIRT3 cDNA. We performed quantitative real‐time PCR (qRT‐PCR) of SIRT3 using the All‐in‐One TM qPCR Mix (GeneCopoeia, Rockville, MD, USA) on an ABI 7500HT System (Applied Biosystems) to determine the expression levels of mRNA‐SIRT3. Relative quantification of target genes was calculated using the 2−ΔΔCq method. The primer sequences used were as follows: primer sequences for SIRT3 forward 5‐CATATGGGCTGATGTGATGG‐3 and reverse 5‐GCCATATGGAGTAGGAACCTTG‐3′.

2.9. Mitochondrial extraction

Complete and purified mitochondria were isolated from HL‐1 cells or mouse heart tissue according to the instructions of the mitochondrial extraction kit (Cat: SM0020; Solarbio, Beijing, China) for the extraction of mitochondrial proteins.

2.10. Western blotting

Western blotting was performed using the standard procedures. The bicinchoninic acid method was used to detect protein concentrations according to the manufacturer's instructions. The proteins were transferred to a PVDF membrane and blocked with 5% skim milk at room temperature for 2 h, followed by incubation with anti‐SIRT3 (cat. no. ab217319; dilution, 1:1000; Abcam, Cambridge, UK), anti‐LC3 (cat. no. #12741, dilution, 1:1000; Cell Signaling Technology), anti‐p62 (cat. no. #16177; dilution, 1:1000; Cell Signaling Technology), and anti‐PGC‐1α (cat. no. #2178; dilution, 1:1000; Cell Signaling Technology), anti‐TFAM (Cat. no. #8076; dilution, 1:1000; Cell Signaling Technology) and anti‐β‐actin (cat. no. #3700; dilution, 1:1000; Cell Signaling Technology), overnight at 4°C. The cells were then incubated with goat anti‐rabbit antibody (cat. no. #98164; dilution, 1:5000; Cell Signaling Technology) at room temperature for 2 h. Enhanced chemiluminescence was used to detect the results. The bands were imaged using a Bio‐Rad Imaging System.

2.11. Detection of ROS

ROS in heart tissues was detected by dihydroethidium (DHE) staining, as previously described. 19

ROS in HL‐1 cells was detected using the fluorescent probe DCFH‐DA (Cat: 1410; Solarbio, Beijing, China). DCFH‐DA was diluted with a serum‐free medium at 1:1000, according to the manufacturer's instructions, and the final concentration was 10 μmol/L. The cell culture medium was removed, and 1 mL of diluted DCFH‐DA was added to one well of a six‐well plate. The mixture was then incubated for 20 min at 37°C. The cells were washed three times with serum‐free cell culture medium to completely remove DCFH‐DA that did not enter the cells. The DCFH‐DA was observed under a fluorescence microscope.

2.12. Determination of malondialdehyde (MDA) and superoxide dismutase (SOD)

MDA and SOD levels in heart tissues or HL‐1 cells were detected using HL‐1 cells as per the manufacturer's instructions. 20

2.13. Detection of myocardial injury markers and inflammatory indicators

According to the manufacturer's instructions, the levels of inflammatory indicators (TNF‐α, IL‐6, IL‐1β) and myocardial injury markers (CK‐MB, cTnI, and LDH) in HL‐1 cell medium and blood samples from mice were detected using mouse ELISA kits ([Cat: SEKM‐0034; Solarbio, Beijing, China]; [Cat: SEKM‐0007; Solarbio, Beijing, China]; [Cat: SEKM‐0002; Solarbio, Beijing, China]; [Cat: SEKM‐0152; Solarbio, Beijing, China]; [Cat: SEKM‐0153; Solarbio, Beijing, China]; [Cat: BC0685; Solarbio, Beijing, China]).

2.14. JC‐1 staining

Mitochondrial membrane potential in HL‐1 cells was measured using a JC‐1 fluorescent probe (Cat: M8650; Solarbio). After HL‐1 cells were treated with LPS for 6 h, they were incubated with JC‐1 working solution at 37°C for 20 min. The JC‐1 buffer solution was used to wash the cells at least twice. The results were expressed as the ratio of red/green fluorescence intensity, which represents the degree of mitochondrial damage.

2.15. Autophagy flux

MRFP‐GFP‐LC3 adenovirus (Hanbio, Shanghai, China) was added to the HL‐1 culture medium to monitor autophagy flux in real‐time. After infection with MRFP‐GFP‐LC3 adenovirus for 48 h, HL‐1 cells were fixed with 4% PFA. Finally, confocal microscopy (Zeiss, LSM 900, Germany) was used to observe the level of autophagy flux.

2.16. Autophagosome

Transmission electron microscopy (TEM; JEM‐1400, Japan) was used to observe the autophagosomes of mouse cardiomyocytes. HL‐1 cells were prefixed with 3% glutaraldehyde and refixed with 1% osmium tetroxide, then dehydrated, infiltrated, and embedded. Ultrathin sections were stained and images were collected by TEM to observe the changes in the number of autophagosomes.

2.17. Statistical analysis

The results of our study are shown as mean ± standard error of mean (SEM) and were analyzed using SPSS19.0 software. Comparisons between multiple groups were performed using a one‐way analysis of variance and Tukey's post‐hoc test. Kaplan–Meier analysis was used to assess survival. Statistical significance was set at p < 0.05.

3. RESULTS

3.1. ANXA1sp protected against sepsis‐induced myocardial injury in vivo

To investigate the effects of ANXA1sp on sepsis‐induced myocardial injury, an animal model of sepsis‐induced myocardial injury was established. To find the optimal LPS concentration to establish an in vivo model of sepsis‐induced myocardial injury, we performed a dose–response experiment with LPS‐increasing concentrations (5, 10, and 15 mg/kg). As shown in Figure S1A, B, there were no significant differences between mice from Control group and LPS (5 mg/kg) group; however, mice from LPS (10 mg/kg) and LPS (15 mg/kg) groups exhibited a significant decrease in 7‐day survival rate and structural disorder in myocardial tissues. Therefore, 10 mg/kg was selected as the LPS concentration for subsequent in vivo studies. Then, mice were assigned to Control, LPS, LPS + NS, and LPS + ANXA1sp (ANA) groups. As shown in Figure 1A, ANXA1sp pretreatment significantly enhanced the 7‐day survival rate of LPS mice. ANXA1sp significantly reversed LPS‐induced increase in the levels of pro‐inflammatory cytokines (TNF‐α, IL‐6, and IL‐1β), myocardial injury biomarkers (CK‐MB, cTnI, and LDH), and oxidative stress indicators (ROS and MDA; Figure 1B–D). Furthermore, ANXA1sp treatment also improved the cardiac function of LPS‐induced mice, as evidenced by the increased EF, FS, and LVIDd levels (Figure 1E, F). H&E staining showed that there was no obvious infiltration of inflammatory cells into the cardiomyocytes, but there was a structural disorder (Figure 1G). The expression of the autophagy‐related protein LC3 in heart tissues was analyzed by immunohistochemistry. The results showed that ANXA1sp pretreatment significantly reversed LPS‐induced increase of LC3 expression in heart tissues (Figure 1H). Next, the expression levels of mitochondrial biosynthesis‐related proteins (TFAM and PGC‐1α) were detected in heart tissues, and mitochondria extracted from heart tissues by western blotting. As shown in Figure 1I, J, ANXA1sp significantly reversed LPS‐induced decrease in TFAM and PGC‐1α protein levels in heart tissues and mitochondria extracted from heart tissues. In addition, ANXA1sp significantly upregulated SIRT3 protein levels in both heart tissues and mitochondria extracted from heart tissues (Figure 1I, J). To sum up, ANXA1sp might relieve sepsis‐induced myocardial injury in vivo by upregulating SIRT3 expression.

FIGURE 1.

FIGURE 1

ANXA1sp protected against sepsis‐induced myocardial injury in vivo. (A) ANXA1sp enhanced the 7‐day survival rate (n = 10). (B) Changes in inflammation indicators TNF‐α, IL‐6, IL‐1β. (C) Changes in myocardial injury markers CK‐MB, cTnI, and LDH. (D) ROS and MDA levels in heart tissues from each group. (E) and (F) Cardiac function of mice EF, FS, LVIDd. (G) H&E staining of heart tissues from each group. (H) Immunohistochemical staining for LC3. (I) TFAM, PGC‐1α, and SIRT3 protein levels in heart tissues from each group by western blotting. (J) TFAM, PGC‐1α, and SIRT3 protein levels in mitochondria extracted from heart tissues by western blotting. Data were shown as mean ± SEM. n = 6 for each group. *p < 0.05 versus the control group; #p < 0.05 versus the LPS group.

3.2. ANXA1sp had a protective effect on HL‐1 cells by upregulating SIRT3 in vitro

Next, we explored the protective effects of ANXA1sp in a cellular model of sepsis‐induced myocardial injury. To find the appropriate concentration for LPS treatment in vitro, HL‐1 cells were treated with LPS at increasing concentrations (0.1, 0.5, 1, and 10 μg/mL). CCK‐8 results showed that LPS treatment significantly inhibited HL‐1 cell viability at 1 and 10 μg/mL (Figure S2A). In addition, LPS also led to a significant increase in LDH and CK‐MB release at 1 and 10 μg/mL (Figure S2B, C). Therefore, 1 μg/mL was selected as the LPS concentration for in vitro experiments. As shown in Figure 2A, B, ANXA1sp pretreatment at 10 μmol/L produced significant protective effects on HL‐1 cells against LPS challenge without causing cytotoxicity. Therefore, 10 μmol/L was selected as the concentration of ANXA1sp pretreatment for the following cellular experiments. Then, HL‐1 cells were assigned to Control, LPS, LPS + NS, and LPS + ANA groups. It was shown that ANXA1sp reversed LPS‐induced reduction in HL‐1 cell viability (Figure 2C). Additionally, ANXA1sp partially abolished LPS‐induced increase in the levels of myocardial injury markers (CK‐MB, cTnl, LDH; Figure 2D) and inflammatory factors (TNF‐α, IL‐6, and IL‐1β; Figure 2E). HL‐1 cardiomyocyte mitochondria were extracted, and SIRT3 expression in mitochondrial proteins was detected. The results showed that ANXA1sp significantly reversed LPS‐induced reduction in SIRT3 expression (Figure 2F). To further explore the interaction between ANXA1sp and SIRT3, the binding efficiency of ANXA1sp to SIRT3 was evaluated by molecular docking. The molecular structure of ANXA1sp was obtained from PubChem (Figure 2G). The binding energy was −7.54(kcal/mol). ANXA1sp matched well with the SIRT3 target protein and formed a stable complex (Figure 2H). Moreover, GFP immunofluorescence and qRT‐PCR results also confirmed that ANXA1sp treatment upregulated SIRT3 expression in LPS‐induced HL‐1 cells (Figure 2I–K). Therefore, ANXA1sp might exert protective effects on HL‐1 cells by upregulating SIRT3 expression.

FIGURE 2.

FIGURE 2

ANXA1sp had a protective effect on HL‐1 cells by upregulating SIRT3 in vitro. (A) Effects of ANXA1sp pretreatment with different concentrations on cTnl in HL‐1 medium after LPS treatment. (B) Effects of ANXA1sp pretreatment with different concentrations on cell viability after LPS treatment. (C) ANXA1sp increased cell viability. (E) Markers of myocardial injury and inflammatory factors. (F) SIRT3 expression in mitochondrial proteins. (G) The molecular structure of ANXA1sp was obtained from the PubChem database. (H) ANXA1sp was well matched with the SIRT3 target protein and can form a stable complex. (I), (J) Immunofluorescence of SIRT3. (K) SIRT3 mRNA expression was verified by quantitative real‐time PCR. Data were shown as mean ± SEM. n = 6 for each group. *p < 0.05 versus the control group; #p < 0.05 versus the LPS group.

3.3. ANXA1sp mitigated LPS‐induced oxidative stress in HL‐1 cells by promoting mitochondrial biosynthesis and inhibiting mitophagy

Then, we verified whether ANXA1sp protects against LPS‐induced SIRT3 inhibition and autophagy in vitro, the expression levels of mitochondrial biosynthesis‐related proteins (TFAM and PGC‐1α) and autophagy‐related proteins (LC3I, LC3II, and p62) were detected in mitochondria extracted from HL‐1 cells. Western blot results revealed that ANXA1sp significantly reversed LPS‐induced changes in LC3II/LC3I ratio, as well as SIRT3, TFAM, PGC‐1α, and p62 protein levels (Figure 3A). Then, SIRT3 expression was silenced in HL‐1 cells. HL‐1 cells were assigned to Control, LPS, LPS + siSIRT3, LPS + ANA, and LPS + ANA+siSIRT3 groups. It was shown that SIRT3 silencing further aggravated LPS‐induced decline in SIRT3 mRNA expression, while ANXA1sp pretreatment increased SIRT3 mRNA expression in LPS‐induced HL‐1 cells; however, ANXA1sp pretreatment failed to increase SIRT3 mRNA expression after SIRT3 silencing (Figure 3B). As shown in Figure 3C–E, SIRT3 silencing further enhanced LPS‐induced increase in ROS and MDA levels and decrease in SOD level in HL‐1 cells, while ANXA1sp pretreatment partially reversed LPS‐induced changes in ROS, MDA, and SOD levels; however, ANXA1sp preatment almost had no effects when SIRT3 was silenced. In addition, SIRT3 deletion further exacerbated LPS‐induced decrease in △Ψm and ATP content, while ANXA1sp upregulated △Ψm level and ATP production; in contrast, such effects vanished when SIRT3 was silenced (Figure 3F, G). To sum up, ANXA1sp might promote mitochondrial biosynthesis and inhibit autophagy to protect against LPS‐induced oxidative stress.

FIGURE 3.

FIGURE 3

ANXA1sp mitigated LPS‐induced oxidative stress in HL‐1 cells by promoting mitochondrial biosynthesis and inhibiting mitophagy. (A) The expression of mitochondrial biosynthesis‐related proteins (TFAM and PGC‐1α) and autophagy‐related proteins (LC3 and P62) in mitochondria extracted from HL‐1 cells. (B) SIRT3 mRNA expression in each group by RT‐PCR. (C) SOD activity of each group. (D) MDA Lipid oxidation levels of each group. (E) ROS production of each group. (F) JC‐1 was used as a fluorescent probe to detect △Ψm. (G) Changes in the ATP content of each group. Data were shown as mean ± SEM. n = 6 for each group. *p < 0.05 versus the control group; #p < 0.05 versus the LPS group; ▲p < 0.05 versus the LPS + siSIRT3 group.

3.4. ANXA1sp inhibited LPS‐induced autophagy flux in HL‐1 cells via upregulating SIRT3 expression

We found that LPS treatment was accompanied by changes in autophagy; therefore, we observed changes in autophagy‐related proteins and autophagy flux in HL‐1 cells after SIRT3 silencing. When autophagosomes and lysosomes fused to form autophagolysosomes, the acidic lysosomal environment quenched the acid‐sensitive GFP fluorescence, but mCherry was not affected, thus causing autophagolysosomes to emit red fluorescence. Therefore, red fluorescence indicates autophagic lysosome formation. The redder and less green the fluorescence, the smoother the flow from the autophagosome to the autophagolysosome, and the stronger the autophagy. The results showed that ANXA1sp reduced the production of autophagolysosomes compared with the LPS group. After SIRT3 silencing, ANXA1sp had no significant effect on autophagy. The LPS + siSIRT3 group was compared with the LPS + ANA +siSIRT3 group (p > 0.05; Figure 4A). TEM was used to observe the autophagosomes in HL‐1 cells. ANXA1sp pretreatment can reduce the production of autophagosomes per unit area, as shown by the red arrow, but this effect was not obvious when SIRT3 was silenced. The LPS + siSIRT3 group was compared with the LPS + ANA + siSIRT3 group (p > 0.05; Figure 4B). ANXA1sp had no significant effect on either the autophagy‐related proteins (LC3 and P62) or the mitochondrial biosynthesis‐related proteins (TFAM and PGC‐1α) when SIRT3 was silenced. The LPS+ siSIRT3 group was compared with the LPS + ANA +siSIRT3 group (p > 0.05; Figure 4C). In general, ANXA1sp reduces autophagy and promotes mitochondrial biosynthesis, resulting in protective effects. SIRT3 is a key target, and the protective effect of ANXA1sp is substantially weakened by SIRT3 silencing. Combined with the results of this study, it can be concluded that ANXA1sp can exert protective effects against sepsis‐induced myocardial injury through SIRT3.

FIGURE 4.

FIGURE 4

ANXA1sp inhibited LPS‐induced autophagy flux in HL‐1 cells via upregulating SIRT3 expression. (A) The changes in autolysosomes and autophagosomes were observed by confocal microscopy. (B) TEM was used to observe the autophagosomes of HL‐1 cells. (C) The expression of autophagy‐related proteins (LC3 and P62) and mitochondrial biosynthesis‐related proteins (TFAM and PGC‐1α). Data were shown as mean ± SEM. n = 6 for each group. *p < 0.05 versus the control group; #p < 0.05 versus the LPS group; ▲p < 0.05 versus the LPS + siSIRT3 group.

4. DISCUSSION

In this study, we provide evidence of a novel mechanism of sepsis‐induced myocardial injury. Our research showed that (1) impaired SIRT3 activity is strongly associated with myocardial injury due to sepsis, (2) ANXA1sp can reduce inflammation by mediating the expression of SIRT3, (3) ANXA1sp can promote the expression of SIRT3, regulate mitochondrial biosynthesis, inhibit autophagy and oxidative stress, and reduce sepsis‐mediated myocardial damage, and (4) suppression of SIRT3‐associated pathways may be associated with sepsis‐related cardiomyopathy in humans. In addition, we showed that ANXA1sp treatment alleviated LPS‐induced cardiac dysfunction in mice. In summary, these observations indicate that SIRT3 may be useful as a new target for the treatment of sepsis‐induced myocardial injury and that ANXA1sp may be a suitable small‐molecule drug for the treatment of sepsis‐induced myocardial injury.

There are seven members (sirtuin1‐7) of the sirtuin protein family, which regulate multiple biological processes from multiple potential targets, such as transcription factors, enzymes, and structural proteins. Studies on SIRT3 have shown that it can prevent the occurrence and development of ischemic heart disease, myocardial hypertrophy, diabetic cardiomyopathy, and other diseases. This protective effect works by regulating the deacetylation of SIRT3. 21 SIRT3 deacetylation is closely related to myocardial ischemia–reperfusion therapy and overexpression of SIRT3 can prevent hyperacetylation of CypD induced by hypoxia and reoxygenation, thus reducing the size of myocardial infarction in mice. 22 Similarly, in the study of cardiac hypertrophy, the absence of SIRT3 is more likely to lead to mitochondrial swelling, which is also related to the promotion of CypD deacetylation by mPTP. 23 In cardiac hypertrophy studies, SIRT3 has been shown to interact with FOXO3 to exert deacetylation. 24 Heiko Bugger et al. It was recently reported that the absence of polyadenosine diphosphate ribose polymerase 1 (PARP1) can clear myocardial NAD+, thereby retaining the activity of SIRT3 and improving cardiac dysfunction during endotoxemia. 25 Although our current study demonstrates that the absence of SIRT3 exacerbates sepsis‐mediated myocardial damage, there are several key points that need to be emphasized. First, Heiko Bugger's team used an in vitro isolated heart to evaluate heart function. However, we used a living mouse model, which allows a more accurate and convincing evaluation of heart function. Second, Heiko Bugger's team proved that pus toxicosis can damage the activity of heart SIRT3, and preserving the activity of myocardial SIRT3 can protect heart function after sepsis. In contrast, the current study found that the absolute protein abundance of SIRT3 in the hearts of mice treated with LPS was also reduced, and the lack of SIRT3 further damaged heart function. Both studies have shown that the expression or activity of SIRT3 is a key regulator of sepsis and myocardial injury. This study shows that SIRT3 can reduce myocardial damage in sepsis‐induced myocardial injury by regulating mitochondrial biogenesis.

In this study, LPS was used to simulate sepsis‐induced myocardial injury in vivo and in vitro. The animal study revealed that ANXA1sp pretreatment alleviated LPS‐induced cardiac dysfunction, myocardial injury, inflammation, and oxidative stress. Consistent with the results of animal experiments, ANXA1sp pretreatment inhibited the levels of inflammatory factors and myocardial injury markers, reduced ROS and MDA levels, and increased SOD activity at the cellular level. Although mitophagy is generally believed to exert protective effects in cardiac diseases, 26 excessive activation of mitophagy can lead to apoptosis of cardiomyocytes. 27 Emerging evidence suggests that mitophagy shows bidirectional regulatory effects in sepsis‐induced myocardial injury. 28 Herein, ANXA1sp reduced the expression of autophagy‐related protein (LC3) but increased the expression of mitochondrial biosynthesis‐related proteins (TFAM and PGC‐1α) in heart tissues. Similarly, ANXA1sp promoted TFAM, PGC‐1α, and P62 expression and suppressed LC3II/LC3I ratio in LPS‐induced HL‐1 cells. Furthermore, ANXA1sp also reversed LPS‐induced decrease in △Ψm level and ATP content and increased in the number of autolysosomes and autophagosomes in HL‐1 cells. These data indicate that ANXA1sp might reduce sepsis‐induced myocardial injury by promoting mitochondrial biosynthesis and inhibiting mitophagy.

Recent studies have shown that the main pathways of SIRT3 regulation include the control of substrate mitochondrial catabolism and oxidative stress. 29 Our data revealed that SIRT3 expression was significantly reduced in the heart tissue during sepsis‐induced myocardial injury and LPS‐induced HL‐1 cells, and ANXA1sp reversed LPS‐induced reduction in SIRT3 expression. SIRT3 siRNA not only inhibited the promotion of SIRT3 by ANXA1sp but also increased the level of mitochondrial oxidative stress. Moreover, SIRT3 silencing also promotes mitophagy and inhibits mitochondrial biogenesis. Increasing evidence indicates that SIRT3 is a potential target for the treatment of sepsis‐induced myocardial injury. 30 , 31 Here, ANXA1sp may be a candidate SIRT3 activator, which may be useful for the treatment of sepsis‐induced myocardial injury.

Annexin‐A1 was first identified as a protein in the early 1980s and its biological functions have subsequently been extensively studied. Annexin‐A1 acts as an anti‐inflammatory mechanism by inhibiting the release of pro‐inflammatory mediators and blocking the migration of inflammatory cells. 32 , 33 Annexin‐A1 also plays a significant role in cardiovascular diseases, including its protective role in atherosclerosis and myocardial infarction. 11 , 34 , 35 , 36 Subsequently, ANXA1sp was synthesized and had strong protective effects on the heart and brain. We will further expand its application research on animal models of sepsis and provide some ideas for the next step of sepsis treatment. Both our study and Zhang's showed that SIRT3 plays a key role in the therapeutic effect of ANXA1sp.

According to previous studies, the effects of peptides derived from the N‐terminal region of ANXA1 are believed to be mediated via binding to formyl peptide receptors on the cell surface. 37 Therefore, ANXA1sp might also regulate SIRT3 expression in HL‐1 cells via binding to formyl peptide receptors on the cell surface. However, the specific mechanisms remain to be further investigated in future studies. Another limitation of this study is that we only assessed SIRT3 knockdown at the cellular level, and an SIRT3 knockout mouse model should be established for future research. In summary, our results indicate that the reduction of SIRT3 expression can aggravate sepsis‐induced myocardial injury by inhibiting cardiomyocyte biosynthesis and promoting ROS production and mitophagy. In addition, ANXA1sp may serve as a potential SIRT3 modulator to protect mice from sepsis‐induced myocardial injury. These results may provide new potential targets for maintaining normal heart function after sepsis.

CONFLICT OF INTEREST STATEMENT

All authors declare no conflict of interest.

Supporting information

Supplementary Figure 1. LPS led to myocardial injury in mice. Mice received LPS injection at increasing concentrations (5, 10, and 15 mg/kg). (A) The 7‐day survival rate for mice in each group. (B) H&E staining of heart tissues from each group. Data were shown as mean ± SEM.

Supplementary Figure 2. LPS caused cell damage to HL‐1 cells. HL‐1 cells were subject to LPS treatment at increasing concentrations (0.1, 0.5, 1, and 10 μg/mL). (A) CCK‐8 for HL‐1 cell viability. (B) LDH release. (C) CK‐MB release. Data were shown as mean ± SEM. n = 6 for each group. *p < 0.05 versus the control group; **p < 0.01 versus the control group.

KJM2-40-35-s001.docx (461.6KB, docx)

Qin S, Ren Y‐C, Liu J‐Y, Chen W‐B, Fu B, Zheng J, et al. ANXA1sp attenuates sepsis‐induced myocardial injury by promoting mitochondrial biosynthesis and inhibiting oxidative stress and autophagy via SIRT3 upregulation. Kaohsiung J Med Sci. 2024;40(1):35–45. 10.1002/kjm2.12767

REFERENCES

  • 1. Seymour C, Liu V, Iwashyna T, Brunkhorst F, Rea T, Scherag A, et al. Assessment of clinical criteria for sepsis: for the third international consensus definitions for sepsis and septic shock (Sepsis‐3). JAMA. 2016;315(8):762–774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Rudd K, Kissoon N, Limmathurotsakul D, Bory S, Mutahunga B, Seymour C, et al. The global burden of sepsis: barriers and potential solutions. Crit Care. 2018;22(1):232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Schultz M, Dunser M, Dondorp A, Adhikari N, Iyer S, Kwizera A, et al. Current challenges in the management of sepsis in ICUs in resource‐poor settings and suggestions for the future. Intensive Care Med. 2017;43(5):612–624. [DOI] [PubMed] [Google Scholar]
  • 4. Palikaras K, Tavernarakis N. Mitophagy in neurodegeneration and aging. Front Genet. 2012;3:297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Ng MYW, Wai T, Simonsen A. Quality control of the mitochondrion. Dev Cell. 2021;56(7):881–905. [DOI] [PubMed] [Google Scholar]
  • 6. Palikaras K, Tavernarakis N. Mitochondrial homeostasis: the interplay between mitophagy and mitochondrial biogenesis. Exp Gerontol. 2014;56:182–188. [DOI] [PubMed] [Google Scholar]
  • 7. Tang C, Cai J, Yin XM, Weinberg JM, Venkatachalam MA, Dong Z. Mitochondrial quality control in kidney injury and repair. Nat Rev Nephrol. 2021;17(5):299–318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Funk J, Schnellmann R. Persistent disruption of mitochondrial homeostasis after acute kidney injury. Am J Physiol Renal Physiol. 2012;302(7):F853–F864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Wu Y, Yao Y, Lu Z. Mitochondrial quality control mechanisms as potential therapeutic targets in sepsis‐induced multiple organ failure. J Mol Med. 2019;97(4):451–462. [DOI] [PubMed] [Google Scholar]
  • 10. Leslie M. Inflammation's stop signals. Science. 2015;347:18–21. [DOI] [PubMed] [Google Scholar]
  • 11. Ansari J, Kaur G, Gavins F. Therapeutic potential of annexin A1 in ischemia reperfusion injury. Int J Mol Sci. 2018;19(4):1211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Zhang Z, Ma Q, Shah B, Mackensen G, Lo D, Mathew J, et al. Neuroprotective effects of annexin A1 tripeptide after deep hypothermic circulatory arrest in rats. Front Immunol. 2017;8:1050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Ma Q, Zhang Z, Shim J, Venkatraman T, Lascola C, Quinones Q, et al. Annexin A1 bioactive peptide promotes resolution of neuroinflammation in a rat model of exsanguinating cardiac arrest treated by emergency preservation and resuscitation. Front Neurosci. 2019;13:608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Suliman H, Ma Q, Zhang Z, Ren J, Morris B, Crowley S, et al. Annexin A1 tripeptide mimetic increases Sirtuin‐3 and augments mitochondrial function to limit ischemic kidney injury. Front Physiol. 2021;12:683098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Marcus J, Andrabi S. SIRT3 regulation under cellular stress: making sense of the ups and downs. Front Neurosci. 2018;12:799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Kanwal A. Functional and therapeutic potential of mitochondrial SIRT3 deacetylase in disease conditions. Expert Rev Clin Pharmacol. 2018;11(12):1151–1155. [DOI] [PubMed] [Google Scholar]
  • 17. Wang M, Liu M, Zhang J, Liu J, Ye J, Xu Y, et al. Resolvin D1 protects against sepsis‐induced cardiac injury in mice. Biofactors. 2020;46(5):766–776. [DOI] [PubMed] [Google Scholar]
  • 18. Dai S, Ye B, Chen L, Hong G, Zhao G, Lu Z. Emodin alleviates LPS‐induced myocardial injury through inhibition of NLRP3 inflammasome activation. Phytother Res. 2021;35(9):5203–5213. [DOI] [PubMed] [Google Scholar]
  • 19. Zhai M, Liu Z, Zhang B, Jing L, Li B, Li K, et al. Melatonin protects against the pathological cardiac hypertrophy induced by transverse aortic constriction through activating PGC‐1beta: In vivo and in vitro studies. J Pineal Res. 2017;63(3):12433. [DOI] [PubMed] [Google Scholar]
  • 20. Ding L, Wang J. MiR‐106a facilitates the sensorineural hearing loss induced by oxidative stress by targeting connexin‐43. Bioengineered. 2022;13(6):14080–14093. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 21. Barcena M, Pozdniakova S, Haritonow N, Breiter P, Kühl A, Milting H, et al. Dilated cardiomyopathy impairs mitochondrial biogenesis and promotes inflammation in an age‐ and sex‐dependent manner. Aging. 2020;12(23):24117–24133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Bochaton T, Crola‐Da‐Silva C, Pillot B, Villedieu C, Ferreras L, Alam M, et al. Inhibition of myocardial reperfusion injury by ischemic postconditioning requires sirtuin 3‐mediated deacetylation of cyclophilin D. J Mol Cell Cardiol. 2015;84:61–69. [DOI] [PubMed] [Google Scholar]
  • 23. Hafner A, Dai J, Gomes A, Xiao C, Palmeira C, Rosenzweig A, et al. Regulation of the mPTP by SIRT3‐mediated deacetylation of CypD at lysine 166 suppresses age‐related cardiac hypertrophy. Aging. 2010;2(12):914–923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Sundaresan N, Gupta M, Kim G, Rajamohan S, Isbatan A, Gupta M. Sirt3 blocks the cardiac hypertrophic response by augmenting Foxo3a‐dependent antioxidant defense mechanisms in mice. J Clin Invest. 2009;119(9):2758–2771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Koentges C, Cimolai M, Pfeil K, Wolf D, Marchini T, Tarkhnishvili A, et al. Impaired SIRT3 activity mediates cardiac dysfunction in endotoxemia by calpain‐dependent disruption of ATP synthesis. J Mol Cell Cardiol. 2019;133:138–147. [DOI] [PubMed] [Google Scholar]
  • 26. Shires SE, Gustafsson AB. Mitophagy and heart failure. J Mol Med. 2015;93(3):253–262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Jiang T, Peng D, Shi W, Guo J, Huo S, Men L, et al. IL‐6/STAT3 signaling promotes cardiac dysfunction by upregulating FUNDC1‐dependent mitochondria‐associated endoplasmic reticulum membranes formation in sepsis mice. Front Cardiovasc Med. 2022;8:790612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Ji W, Wan T, Zhang F, Zhu X, Guo S, Mei X. Aldehyde dehydrogenase 2 protects against lipopolysaccharide‐induced myocardial injury by suppressing mitophagy. Front Pharmacol. 2021;12:641058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Lu J, Zhang H, Chen X, Zou Y, Li J, Wang L, et al. A small molecule activator of SIRT3 promotes deacetylation and activation of manganese superoxide dismutase. Free Radic Biol Med. 2017;112:287–297. [DOI] [PubMed] [Google Scholar]
  • 30. Xu Y, Zhang S, Rong J, Lin Y, Du L, Wang Y, et al. Sirt3 is a novel target to treat sepsis induced myocardial dysfunction by acetylated modulation of critical enzymes within cardiac tricarboxylic acid cycle. Pharmacol Res. 2020;159:104887. [DOI] [PubMed] [Google Scholar]
  • 31. Zheng Z, Ma H, Zhang X, Tu F, Wang X, Ha T, et al. Enhanced glycolytic metabolism contributes to cardiac dysfunction in polymicrobial sepsis. J Infect Dis. 2017;215(9):1396–1406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Sudlow AW, Carey F, Forder R, Rothwell NJ. The role of lipocortin‐1 in dexamethasone‐induced suppression of PGE2 and TNF alpha release from human peripheral blood mononuclear cells. Br J Pharmacol. 1996;117(7):1449–1456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Getting SJ, Flower RJ, Perretti M. Inhibition of neutrophil and monocyte recruitment by endogenous and exogenous lipocortin 1. Br J Pharmacol. 1997;120(6):1075–1082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. de Jong R, Leoni G, Drechsler M, Soehnlein O. The advantageous role of annexin A1 in cardiovascular disease. Cell Adh Migr. 2017;11(3):261–274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Fredman G, Tabas I. Boosting inflammation resolution in atherosclerosis: the next frontier for therapy. Am J Pathol. 2017;187(6):1211–1221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Recio C, Maione F, Iqbal A, Mascolo N, de Feo V. The potential therapeutic application of peptides and peptidomimetics in cardiovascular disease. Front Pharmacol. 2017;7:526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Mozaffari MS, Mozaffari MS. Therapeutic potential of annexin A1 modulation in kidney and cardiovascular disorders. Cell. 2021;10(12):3420. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figure 1. LPS led to myocardial injury in mice. Mice received LPS injection at increasing concentrations (5, 10, and 15 mg/kg). (A) The 7‐day survival rate for mice in each group. (B) H&E staining of heart tissues from each group. Data were shown as mean ± SEM.

Supplementary Figure 2. LPS caused cell damage to HL‐1 cells. HL‐1 cells were subject to LPS treatment at increasing concentrations (0.1, 0.5, 1, and 10 μg/mL). (A) CCK‐8 for HL‐1 cell viability. (B) LDH release. (C) CK‐MB release. Data were shown as mean ± SEM. n = 6 for each group. *p < 0.05 versus the control group; **p < 0.01 versus the control group.

KJM2-40-35-s001.docx (461.6KB, docx)

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES