Abstract
Long noncoding RNAs (LncRNAs) are essential to regulate the pathogenesis of coronary artery disease (CAD). This study was conducted to analyze the functionality of long noncoding RNA cancer susceptibility candidate 11 (lncRNA CASC11) in oxidized low‐density lipoprotein (ox‐LDL)‐induced injury of cardiac microvascular endothelial cells (CMECs). CMECs were treated with ox‐LDL to induce the CAD cell model. The cellular expression levels of CASC11 and histone deacetylase 4 (HDAC4) were determined by real‐time quantitative polymerase chain reaction or Western blot assay. Cell absorbance, apoptosis, angiogenesis, and inflammation were evaluated by cell counting kit‐8, flow cytometry, tube formation, and enzyme‐linked immunosorbent assays. The subcellular localization of CASC11 was examined by the nuclear/cytoplasmic fractionation assay. The binding of human antigen R (HuR) to CASC11 and HDAC4 was analyzed by RNA immunoprecipitation. HDAC4 stability was determined after actinomycin D treatment. CASC11 was found to be decreased in the CAD cell model. CASC11 upregulation increased cell viability and angiogenesis and reduced apoptosis and inflammation. CASC11 bound to HuR and improved HDAC4 expression. HDAC4 downregulation counteracted the protective role of CASC11 overexpression in CMECs. In summary, CASC11 alleviated ox‐LDL‐induced injury of CMECs by binding to HuR and stabilizing HDAC4.
Keywords: cell injury, coronary artery disease, HDAC4, LncRNA CASC11, microvascular endothelial cells
1. INTRODUCTION
Coronary artery disease (CAD) is a chronic immunoinflammatory disease that originates from slow narrowing of blood vessels leading to heart ischemia. 1 CAD is the cause of one‐third of deaths in people over 35 years all over the world, responsible for estimated $177 billion of health care costs by 2040 (in United States). 2 Its etiology is multifaceted, ranging from inflammation, endothelial dysfunction, lipid dysmetabolism to smoking, hypertension, diabetes, overweight, environmental exposures, and pathogens. 3 , 4 Besides, as a result of severe aging problem and sedentary lifestyle, its prevalence is stably increasing. 5 However, its precise pathogenesis remains ambiguous. Oxidized‐low‐density lipoprotein (ox‐LDL) is an independent risk factor for CAD and is commonly used for the induction of in vitro CAD cell model. 6 , 7 , 8 In this study, we strived to use the ox‐LDL treatment to establish the CAD cell model and explore CAD pathogenesis.
Long noncoding RNAs (LncRNAs) are a class of genetic factors longer than 200 nucleotides that exert function in physiological processes and disease development by modulating gene expression. 9 Currently, at least 1210 lncRNAs have been identified to be differentially expressed in the transcriptome profile of CAD patients, 10 suggesting the critical role of lncRNAs in this disease. Moreover, altered lncRNA expression is correlated with endothelial function, inflammation, lipid metabolism, and prognosis in the context of CAD. 11 , 12 , 13 LncRNA cancer susceptibility 11 (CASC11) is a well‐documented oncogene signature in a variety of cancer types. 14 To our knowledge, CASC11 is shown to be downregulated in the plasma of CAD patients. 15 However, there is no functional study on the role of CASC11 in CAD.
On another note, human antigen R (HuR) is a stabilizer of gene expression by binding to AU‐rich elements in the 3′ UTR of target message RNA (mRNA). 16 LncRNAs can recruit HuR to enhance mRNA transcripts. 17 , 18 Histone deacetylase 4 (HDAC4) emerges as a catalyst of deubiquitination and plays a role in cell processes, such as proliferation, differentiation, senescence, and apoptosis. 19 Interestingly, HDAC4 is able to regulate inflammation and apoptosis of ox‐LDL‐treated different types of endothelial cells, 20 , 21 indicating its participation in the pathogenesis of CAD. However, more evidence is required for confirm the expression pattern and functionality of HDAC4 in CAD. Given the currently available evidence, we speculated that CASC11 plays a role in ox‐LDL‐induced injury of cardiac microvascular endothelial cells through HDAC4 signaling. Therefore, this study was conducted to explore the pathogenesis underlying CAD and provide a rationale for the treatment of CAD.
2. MATERIALS AND METHODS
2.1. Cell culture and treatment
Human cardiac microvascular endothelial cells (CMECs) were provided by Procell corporation (Wuhan, Hubei, China) and cultured in a Dulbecco's modified Eagle medium (DMEM) (Gibco, BRL, San Francisco, USA) added with 10% fetal bovine serum (HyClone, Carlsbad, CA, USA) at 37°C in a humidified air of 5% CO2. Upon reaching 80% confluence, CMECs of the third to sixth generation were incorporated with different concentrations of ox‐LDL (0, 25, 50, 100 μg/mL, purity: 98%, quantity: 2.0 mg protein, concentration: 2.6 mg/mL, Solarbio, Beijing, China) and cultured for 24 h to establish a CMECs injury model. 6 CASC11‐overexpressing plasmid (CASC11) and empty vector (NC) were provided by RiboBio (Guangzhou, China), and HDAC4 siRNA, HuR siRNA, and their negative controls were procured from GenePharma corporation. According to the manufacturer's protocol, the above plasmids or siRNAs were transfected into CMECs using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The follow‐up experiments were conducted 48 h after transfection.
2.2. Cell counting kit‐8 assay
In cell counting kit‐8 (CCK‐8) assay, CMECs (1 × 103/per well) were loaded into the 96‐well plates. At appointed time points, the CCK‐8 reagent (10 μL, Beyotime, Shanghai, China) was added into each well. After 4 h culture, the absorbance at a wavelength of 450 nm was recorded with a microplate reader (Bio‐Rad, Hercules, CA, USA).
2.3. Flow cytometry
CMECs were centrifuged 24 h after ox‐LDL treatment, harvested, resuspended in binding buffer, and adjusted to the concentration of 1 × 108 cells/mL. Next, cells were stained Annexin V‐FITC and PC5.5 (Sangon Biotech, Shanghai, China). After 0.5 h reaction, apoptotic cells were tested by a flow cytometer (BD Biosciences, San Jose, CA, USA).
2.4. Tube formation assay
Matrigel tube formation assay was conducted to assess the angiogenesis potential. In brief, the 96‐well plate was precoated with Matrigel (BD Biosciences) and seeded with the suspension of CMECs (24 h after ox‐LDL treatment, 500 μL/well, 2 × 105/mL). After 48 h culture, tubular images were captured by a microscope (Leica, Mannheim, Germany). The length of each tube was measured using Image J software with the Angiogenesis Analyzer plugin.
2.5. Enzyme‐linked immunosorbent assay
CMECs were separated with 0.25% trypsin‐0.02% ethylene diamine tetraacetic acid. After centrifugation, cells were resuspended in the complete culture solution, adjusted to the concentration of 6 × 105 cell/mL, and seeded into the 24‐well plates (500 μL/well) and cultured at 37°C with 5% CO2. Cell supernatant was collected 24 h after ox‐LDL treatment and the contents of interleukin (IL)‐1β (ab214025), IL‐6 (ab178013), IL‐10 (ab185986) in the supernatant were determined according to the protocol of the enzyme‐linked immunosorbent assay (ELISA kit; Abcam, Cambridge, MA, USA).
2.6. Nuclear/cytoplasmic fractionation assay
According to the producer's protocol, the nucleus and cytoplasm of CMECs (untreated) were fractioned with a PARIS assay kit (Life Technologies, Carlsbad, CA, USA). Simply put, CMECs were washed with phosphate buffered saline and treated with the cytoplasmic protein extraction reagent. After 10 min centrifugation at 4°C and 12,000g, the supernatant was collected as the cytoplasmic extract. Next, the precipitates were resuspended and centrifuged at 12,000g and 4°C for 10 min. The supernatant was collected as the nuclear extract and used for the subsequent analyses.
2.7. RNA stability assay
CMECs were treated with actinomycin D at a concentration of 5 μg/mL. At 0, 3, 6, and 9 h, cells were harvested and incorporated with the TRIzol reagent to extract RNA. The HDAC4 level was determined by real‐time quantitative polymerase chain reaction (RT‐qPCR).
2.8. RNA immunoprecipitation assay
The RNA immunoprecipitation (RIP) assay was performed according to the protocol of the EZ‐Magna RIP assay kit (Millipore, Billerica, MA, USA). CMECs (untreated) were lysed with the RIP lysis buffer. A portion of extract solution was used as the input. The other portion of extract solution was incubated with RIP buffer containing HuR (ab200342, Abcam) or IgG (ab172730, Abcam) antibody‐coupled magnetic beads at 4°C for 6 h. The beads were washed with the washing buffer and the compound was incubated with 0.1% sodium dodecyl sulfate (SDS) and 0.5 mg/mL proteinase‐K (55°C, 30 min) to remove protein. Afterwards, immunoprecipitated RNA was purified and analyzed by RT‐qPCR.
2.9. RT‐qPCR
The total RNA was extracted from CMECs 24 h after ox‐LDL treatment by using TRIzol reagent (Invitrogen). Then, separated RNA was reverse‐transcribed into the complementary DNA using PrimeScript RT Master Mix (Takara, Dalian, China). RT‐qPCR was performed using SYBR Green Master Mix (Roche, Shanghai, China) on the CFX97 system (Bio‐Rad). With GAPDH serving as the internal reference, the relative gene expression was quantified referring to the 2−ΔΔCt method. 22 Primers are shown in Table 1.
TABLE 1.
PCR primers.
| Gene | Sequence (5′–3′) |
|---|---|
| CASC11 | F: GGCCTGTCAAGAGATGAGGT |
| R: TCCTTTAACGTTCCCTGGCT | |
| HDAC4 | F: AGGCTCAGACTTGCGAGAAC |
| R: ATGGGCTCCTCATCTGGTCT | |
| HuR | F: CAGATGTTTGGGCCGTTTGG |
| R: TGGTCACAAAGCCAAACCCT | |
| GAPDH | F: GTCAAGGCTGAGAACGGGAA |
| R: TCGCCCCACTTGATTTTGGA |
2.10. Western blot assay
The total protein was obtained from CMECs 24 h after ox‐LDL treatment using radioimmunoprecipitation assay buffer. The supernatant of cell extract was added with 10% SDS‐polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. The membranes were blockaded with 5% bovine serum albumin for 1 h and incubated with antibodies against HDAC4 (ab235583, 1:1000), HuR (ab200342, 1:1000), and β‐actin (ab8227, 1:1000) at 4°C overnight. Next, the blots were washed with Tris Buffered Saline Tween (Solarbio, Beijing, China) thrice and cultured with secondary antibody (1:2000, ab205718, Abcam) at room temperature for 2 h. The grayscale value was analyzed with NIH Image J software (National Institutes of Health, Bethesda. ML, USA).
2.11. Bioinformatic analysis
The binding of CASC11 to HuR and HuR to HDAC4 was predicted through the StarBase database (http://starbase.sysu.edu.cn/index.php) 23 and RNA‐Protein Interaction Prediction (RPISeq) database (http://pridb.gdcb.iastate.edu/RPISeq/). 24
2.12. Statistical methods
All data were processed with SPSS21.0 statistical software (IBM SPSS Statistics, Chicago, IL, USA) and GraphPad Prism 8.0 software (GraphPad Software Inc., San Diego, CA, USA). Data were examined to be normally distributed with equal variance. For measurement data, statistical difference between two panels was analyzed by the t‐test and among multiple groups was analyzed by one‐way or two‐way analysis of variance (ANOVA), accompanied by Tukey's multiple comparison test. p was calculated by the two‐sided test. p < 0.05 was suggestive of statistical significance, and p < 0.01 was suggestive of highly statistical significance.
3. RESULTS
3.1. ox‐LDL induction triggers the injury of CMECs
We cultured human CMECs and treated them with different concentrations of ox‐LDL. The CCK‐8 assay revealed that ox‐LDL reduced the optical density (OD) of CMECs in a dose‐dependent manner (p < 0.01, Figure 1A). Under the treatment of different concentrations of ox‐LDL, the apoptosis rate of CMECs was increased (p < 0.01, Figure 1B), the potential for angiogenesis was inhibited (p < 0.01, Figure 1C), and the concentrations of pro‐inflammatory IL‐1β and IL‐6 were enhanced while the concentration of anti‐inflammatory IL‐10 was decreased (p < 0.05, Figure 1D). These increases and decreases were shown to be dose‐dependent. All data elicited that ox‐LDL can induce the injury of CMECs.
FIGURE 1.
Oxidized low‐density lipoprotein (ox‐LDL) induction triggers the injury of cardiac microvascular endothelial cells (CMECs). Human CMECs were treated with different concentrations of ox‐LDL for 24 h. (A) Optical density (OD) value was tested by cell counting kit‐8 (CCK‐8) assay; (B) Apoptosis was assessed by flow cytometry; (C) Angiogenesis was assessed by tube formation assay; (D) Concentrations of IL‐1β, IL‐6, and IL‐10 were determined by enzyme‐linked immunosorbent assay (ELISA). Cell experiments were performed 3 times independently. Data were shown as mean ± standard deviation. Data in panel A were analyzed by two‐way ANOVA and data in panels B–D were analyzed by one‐way ANOVA, followed by Tukey's multiple comparison test. *p < 0.05, **p < 0.01. ox‐LDL, oxidized low‐density lipoprotein; OD, optical density.
3.2. CASC11 overexpression inhibits the injury of CMECs
A prior study has discovered the downregulation of lncRNA CASC11 in CAD. 15 Therefore, we detected the expression pattern of CASC11 in CMECs and found that the expression levels of CASC11 were decreased with the increase in ox‐LDL concentration (p < 0.01, Figure 2A). To investigate the role of CASC11 in ox‐LDL‐induced CMECs injury, we upregulated CASC11 expression in CMECs (p < 0.01, Figure 2B) and then treated CMECs with 100 μg/mL ox‐LDL for 24 h. Our experiments showed that CASC11 overexpression can weaken the inhibition of the OD value caused by ox‐LDL (p < 0.01, Figure 2C), decrease the apoptosis rate (p < 0.01, Figure 2D), and enhance the potential for angiogenesis (p < 0.01, Figure 2E). Besides, CASC11 upregulation reduced the concentrations of IL‐1β and IL‐6 and elevated the concentration of IL‐10 (p < 0.01, Figure 2F). The above data elicited that CASC11 overexpression inhibited the injury of CMECs.
FIGURE 2.
CASC11 overexpression inhibits the injury of cardiac microvascular endothelial cells (CMECs). (A) CASC11 expression levels in cells 24 h after ox‐LDL treatment were determined by RT‐qPCR; CMECs were transfected with CASC11‐overexpressing plasmid (CASC11), with empty vector (NC) as the negative control; (B) Transfection efficiency of CASC11 after 48 h was tested by RT‐qPCR; CMECs were treated with 100 μg/mL ox‐LDL for 24 h; (C) Optical density (OD) value was examined by cell counting kit‐8 (CCK‐8) assay; (D) Apoptosis was assessed by flow cytometry; (E) Angiogenesis was assessed by the tube formation assay; (F) Concentrations of IL‐1β, IL‐6, and IL‐10 were measured by enzyme‐linked immunosorbent assay (ELISA). Cell experiments were performed 3 times independently. Data were shown as mean ± standard deviation. Data in panel B were analyzed by the t‐test, data in panel C were analyzed by two‐way ANOVA, and data in panels A and D–F were analyzed by one‐way ANOVA, followed by Tukey's multiple comparison test. **p < 0.01.
3.3. CASC11 binds to HuR and increases HDAC4 expression
Next, we further explored the downstream mechanism of CASC11. First, we detected the localization of CASC11 in CMECs and found that CASC11 was predominantly located in the cytoplasm (Figure 3A). LncRNAs can bind to HuR to stabilize gene expression 17 and HDAC4 overexpression can alleviate apoptosis in CAD. 21 The StarBase database revealed the binding of CASC11 to HuR and HuR to HDAC4 (Figure 3B). The databases denoted the high probability of CASC11 binding to HuR and HuR binding to HDAC4 (Figure 3C). In RIP assay, compared to IgG, HuR can precipitate more CASC11 and HDAC4 (p < 0.01, Figure 3D). The expression levels of HDAC4 were decreased by ox‐LDL treatment in a dose‐dependent manner (p < 0.05, Figure 3E,F). The above data suggested that CASC11 bound to HuR and increased HDAC4 expression.
FIGURE 3.
CASC11 binds to HuR and increases HDAC4 expression. (A) The subcellular localization of CASC11 in cardiac microvascular endothelial cells (CMECs; untreated) was detected by the nuclear/cytoplasmic fractionation assay; (B, C) Binding of CASC11 to HuR and HuR to HDAC4 in CMECs (untreated) was predicted through databases; (D) Binding of CASC11 to HuR and HuR to HDAC4 was analyzed by the RIP assay; (E, F) HDAC4 expression levels in CMECs 24 h after ox‐LDL treatment were determined by RT‐qPCR and Western blot assay. Cell experiments were performed 3 times independently. Data were shown as mean ± standard deviation. Data in panels D–F were analyzed by one‐way ANOVA, followed by Tukey's multiple comparison test. *p < 0.05, **p < 0.01.
3.4. CASC11 binds to HuR to improve the mRNA stability and expression of HDAC4
To confirm that CASC11 upregulates HDAC4 by binding to HuR, we downregulated the expression of HuR in cells (p < 0.01, Figure 4A,B), followed by combined treatment with CASC11 overexpression. Our results revealed that CASC11 overexpression increased the expression levels of HDAC4 while HuR knockdown decreased it (p < 0.05, Figure 4C,D). After actinomycin D treatment, it was found that CASC11 can increase the half‐period of HDAC4 while HuR knockdown reduced it (p < 0.05, Figure 4E). Above all, CASC11 bound to HuR to improve the mRNA stability and expression of HDAC4.
FIGURE 4.
CASC11 binds to HuR to improve the mRNA stability and expression of HDAC4. Cardiac microvascular endothelial cells (CMECs) were transfected with two strands of HuR siRNAs (si‐HuR), with si‐NC as the negative control. (A, B) HuR expression levels 48 h after transfection were determined by RT‐qPCR and Western blot assay; CMECs were treated with 100 μg/mL ox‐LDL for 24 h; (C, D) HDAC4 expression levels were determined by RT‐qPCR and Western blot assay; (E) mRNA stability of HDAC4 was examined by RT‐qPCR. Cell experiments were performed 3 times independently. Data were shown as mean ± standard deviation. Data in panel E were analyzed by two‐way ANOVA and data in panels A–D were analyzed by one‐way ANOVA, followed by Tukey's multiple comparison test. *p < 0.05, **p < 0.01.
3.5. HDAC4 downregulation neutralizes the protective role of CASC11 overexpression in the injury of CMECs
At last, we downregulated the HDAC4 expression in CMECs (p < 0.01, Figure 5A,B) and si‐HDAC4#2 with better interference effectiveness was selected for the combined treatment. The OD value was reduced in response to HDAC4 silencing (p < 0.05, Figure 5C), and HDAC4 silencing weakened the inhibition of CMECs apoptosis (p < 0.05, Figure 5D) and the promotion of angiogenesis (p < 0.05, Figure 5E) caused by CASC11 upregulation. In addition, relative to CASC11 overexpression alone, inflammatory injury was enhanced by the combined treatment (p < 0.05, Figure 5F). The above data indicated that HDAC4 downregulation neutralized the protective role of CASC11 overexpression in the injury of CMECs.
FIGURE 5.
HDAC4 downregulation neutralizes the protective role of CASC11 overexpression in the injury of cardiac microvascular endothelial cells (CMECs). CMECs were transfected with two strands of HDAC4 siRNAs (si‐HDAC4), with si‐NC as the negative control. (A, B) HDAC4 expression levels 48 h after transfection were determined by RT‐qPCR and Western blot assay; CMECs were treated with 100 μg/mL ox‐LDL for 24 h; (C) Optical density (OD) value was tested by the cell counting kit‐8 (CCK‐8) assay; (D) Apoptosis was assessed by flow cytometry; (E) Angiogenesis was assessed by the tube formation assay; (F) Concentrations of IL‐1β, IL‐6, and IL‐10 were measured by ELISA. Cell experiments were performed 3 times independently. Data were shown as mean ± standard deviation. Data in panel C were analyzed by two‐way ANOVA and data in panels A, B and D–F were analyzed by one‐way ANOVA, followed by Tukey's multiple comparison test. *p < 0.05, **p < 0.01.
4. DISCUSSION
Coronary artery disease (CAD) is a severe cardiovascular disease, mostly disturbing the life quality of people over 60 years. 25 CAD is associated with a spectrum of risk factors and these risk factors are prevalent among heathy population, nominating it as one of the most major threats of global health. 3 A lot of genetic factors have been identified to be correlated with the development of CAD. However, the functional studies on their roles in CAD remain limited. In this study, our results proved that CASC11 can bind to HuR and improve HDAC4 expression, thus alleviating ox‐LDL‐induced injury of CMECs (Figure 6).
FIGURE 6.
Mechanism of lncRNA CASC11 in ox‐LDL‐induced injury of CMECs. CASC11 was poorly expressed in ox‐LDL‐induced CMECs. CASC11 upregulation increased the binding of CASC11 to HuR to elevated HDAC4 mRNA stability and expression and further promoted proliferation and angiogenesis and reduced apoptosis and inflammatory injury, which alleviated LDL‐induced injury of CMECs and may retard the progression of CAD.
Cardiac microvascular endothelial cells (CMECs), a vital component of coronary microcirculation, play an important role in sustaining the homeostasis of coronary microvessels and adjacent cardiomyocytes. CMECs are sensitive to the risk factors in the microenvironment, such as inflammatory cytokines, oxidative stress, and advanced glycation end‐products. 26 The damage of CMECs contributes to the pathogenesis of multiple cardiovascular diseases, including CAD, heart ischemia–reperfusion injury, and myocardial infarction. 27 , 28 , 29 Oxidized low‐density lipoprotein (ox‐LDL) accumulation promotes the formation of atherosclerotic plaque and accelerates the progression of CAD. 30 In addition, ox‐LDL is likely to trigger the injury of CMECs, thus leading to CAD. 31 In this study, we established the CAD cell model by ox‐LDL treatment and discovered that ox‐LDL can induce the inhibition of CMECs viability, angiogenesis, and promotion of apoptosis and inflammation in a dose‐dependent manner.
On the other hand, lncRNAs are promising biomarkers for CAD diagnosis due to their distinct expression in the disease. 10 Interestingly, CASC11 overexpression is likely to improve the survival of vascular smooth muscle cells, thus alleviating atherosclerosis. 32 Besides, a pioneering study has suggested that low level of CASC11 is predictive of poor prognosis of CAD patients, indicating its clinical significance in CAD, but there is no functional characterization of CASC11 in CAD at the cell or animal level. 15 Herein, despite the discovery of dose‐dependent downregulation of CASC11 in ox‐LDL‐treated CMECs, we also upregulated CASC11 expression in cells and noticed that CASC11 overexpression inhibited the injury of CMECs caused by 100 μg/mL ox‐LDL.
Thereafter, to unravel the downstream mechanism of CASC11, we identified the cytoplasmic location of CASC11, suggesting its ability to communicate with cytoplasmic genes. As mentioned before, lncRNAs are potent to bind to HuR and therefore stabilize gene expression. Through the databases and assays, we confirmed the binding of CASC11 to HuR and HuR to HDAC4. HDAC4 is likely to mediate vascular inflammation to regulate the development of cardiovascular diseases. 33 , 34 Notably, HDAC4 activation can inhibit apoptosis of human umbilical vein endothelial cells induced by miR‐200b‐3p overexpression to alleviate CAD. 21 It is contradictory that another study reporting that HDAC4 with interaction of the lncRNA H19/miR‐20a‐5p axis exerts pro‐inflammatory and proapoptotic functions in human CMECs. 20 We supposed that the difference may be caused by different upstream regulation of HDAC4, the use of different cell types, or cell culture milieu. Besides, the study by Yang et al. emphasized on the role of HDAC4 in the formation of coronary atherosclerotic plaques in vivo. 20 Herein, our experiments revealed that HDAC4 was downregulated in ox‐LDL‐treated CMECs and CASC11 overexpression promoted HDAC4 expression by taking advantage of the role of HuR in stabilizing gene expression. Eventually, we silenced HDAC4 in CMECs and observed that HDAC4 silencing counteracted the protective role of CASC11 overexpression in the injury of CMECs. However, we only testified our mechanism at the cell level. It is required to conduct animal experiments to further validate our findings and apply our theoretical knowledge to the clinical study. There are many downstream factors of CASC11 and we only researched HDAC4. Whether CASC11 can play a role in CAD through the ceRNA mechanism remains unknown. The expression pattern of HDAC4 in CAD is required to be further validated. Lastly, the downstream mechanism for HDAC4 as a histone deacetylase remains unknown. With future endeavors, more experiments are essential to solve the above limitations.
To conclude, our study for the first time demonstrated that CASC11 inhibited ox‐LDL‐induced injury of CMECs by promoting HDAC4 expression, which may retard the progression of CAD. Our findings suggested that CASC11 and HDAC4 can serve as targets for CAD treatment and provide theoretical evidence for their clinical study.
CONFLICT OF INTEREST STATEMENT
The authors have no conflicts of interest to declare.
Hu K, Huang M‐J, Ling S, Li Y‐X, Cao X‐Y, Chen Y‐F, et al. LncRNA CASC11 upregulation promotes HDAC4 to alleviate oxidized low‐density lipoprotein‐induced injury of cardiac microvascular endothelial cells. Kaohsiung J Med Sci. 2023;39(8):758–768. 10.1002/kjm2.12687
Ke Hu and Min‐Jiang Huang are the co‐first authors.
REFERENCES
- 1. Wirtz PH, von Kanel R. Psychological stress, inflammation, and coronary heart disease. Curr Cardiol Rep. 2017;19(11):111. [DOI] [PubMed] [Google Scholar]
- 2. Duggan JP, Peters AS, Trachiotis GD, Antevil JL. Epidemiology of coronary artery disease. Surg Clin North Am. 2022;102(3):499–516. [DOI] [PubMed] [Google Scholar]
- 3. Malakar AK, Choudhury D, Halder B, Paul P, Uddin A, Chakraborty S. A review on coronary artery disease, its risk factors, and therapeutics. J Cell Physiol. 2019;234(10):16812–23. [DOI] [PubMed] [Google Scholar]
- 4. Medina‐Leyte DJ, Zepeda‐Garcia O, Dominguez‐Perez M, Gonzalez‐Garrido A, Villarreal‐Molina T, Jacobo‐Albavera L. Endothelial dysfunction, inflammation and coronary artery disease: potential biomarkers and promising Therapeutical approaches. Int J Mol Sci. 2021;22(8):3850. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Winzer EB, Woitek F, Linke A. Physical activity in the prevention and treatment of coronary artery disease. J Am Heart Assoc. 2018;7(4):e007725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Ji P, Song X, Lv Z. Knockdown of circ_0004104 alleviates oxidized low‐density lipoprotein‐induced vascular endothelial cell injury by regulating miR‐100/TNFAIP8 Axis. J Cardiovasc Pharmacol. 2021;78(2):269–79. [DOI] [PubMed] [Google Scholar]
- 7. Wang X, Li X, Wu Y, Song Y. Upregulation of miR‐223 abrogates NLRP3 inflammasome‐mediated pyroptosis to attenuate oxidized low‐density lipoprotein (ox‐LDL)‐induced cell death in human vascular endothelial cells (ECs). In Vitro Cell Dev Biol Anim. 2020;56(8):670–9. [DOI] [PubMed] [Google Scholar]
- 8. Zhao X, Zhang HW, Xu RX, Guo YL, Zhu CG, Wu NQ, et al. Oxidized‐LDL is a useful marker for predicting the very early coronary artery disease and cardiovascular outcomes. Per Med. 2018;15(6):521–9. [DOI] [PubMed] [Google Scholar]
- 9. Finotti A, Fabbri E, Lampronti I, Gasparello J, Borgatti M, Gambari R. MicroRNAs and long non‐coding RNAs in genetic diseases. Mol Diagn Ther. 2019;23(2):155–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Li L, Wang L, Li H, Han X, Chen S, Yang B, et al. Characterization of LncRNA expression profile and identification of novel LncRNA biomarkers to diagnose coronary artery disease. Atherosclerosis. 2018;275:359–67. [DOI] [PubMed] [Google Scholar]
- 11. Zhang Z, Nan S, Duan X, Wang L, Sun X, Zheng H. Relationship between expression of plasma lncRNA‐HEIH and prognosis in patients with coronary artery disease. Dis Markers. 2021;2021:5662080–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Li P, Yan X, Xu G, Pang Z, Weng J, Yin J, et al. A novel plasma lncRNA ENST00000416361 is upregulated in coronary artery disease and is related to inflammation and lipid metabolism. Mol Med Rep. 2020;21(6):2375–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Cho H, Li Y, Archacki S, Wang F, Yu G, Chakrabarti S, et al. Splice variants of lncRNA RNA ANRIL exert opposing effects on endothelial cell activities associated with coronary artery disease. RNA Biol. 2020;17(10):1391–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Zheng L, Guan Z, Xue M. A crucial role for the long non‐coding RNA CASC11 in the pathogenesis of human cancers. Am J Transl Res. 2021;13(9):10922–32. [PMC free article] [PubMed] [Google Scholar]
- 15. Chen J, Dang J. LncRNA CASC11 was downregulated in coronary artery disease and inhibits transforming growth factor‐beta1. J Int Med Res. 2020;48(3):300060519889187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Liu Y, Li X, Zhang H, Zhang M, Wei Y. HuR up‐regulates cell surface PD‐L1 via stabilizing CMTM6 transcript in cancer. Oncogene. 2021;40(12):2230–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Zou Z, Ma T, He X, Zhou J, Ma H, Xie M, et al. Long intergenic non‐coding RNA 00324 promotes gastric cancer cell proliferation via binding with HuR and stabilizing FAM83B expression. Cell Death Dis. 2018;9(7):717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Priyanka P, Sharma M, Das S, Saxena S. The lncRNA HMS recruits RNA‐binding protein HuR to stabilize the 3'‐UTR of HOXC10 mRNA. J Biol Chem. 2021;297(2):100997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Hou F, Wei W, Qin X, Liang J, Han S, Han A, et al. The posttranslational modification of HDAC4 in cell biology: mechanisms and potential targets. J Cell Biochem. 2020;121(2):930–7. [DOI] [PubMed] [Google Scholar]
- 20. Yang Y, Wang Z, Xu Y, Liu X, Sun Y, Li W. Knockdown of lncRNA H19 alleviates ox‐LDL‐induced HCAECs inflammation and injury by mediating miR‐20a‐5p/HDAC4 axis. Inflamm Res. 2022;71(9):1109–21. [DOI] [PubMed] [Google Scholar]
- 21. Zhang F, Cheng N, Du J, Zhang H, Zhang C. MicroRNA‐200b‐3p promotes endothelial cell apoptosis by targeting HDAC4 in atherosclerosis. BMC Cardiovasc Disord. 2021;21(1):172. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐Delta Delta C(T)) method. Methods. 2001;25(4):402–8. [DOI] [PubMed] [Google Scholar]
- 23. Li JH, Liu S, Zhou H, Qu LH, Yang JH. starBase v2.0: decoding miRNA‐ceRNA, miRNA‐ncRNA and protein‐RNA interaction networks from large‐scale CLIP‐Seq data. Nucleic Acids Res. 2014;42(Database issue):D92–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Muppirala UK, Honavar VG, Dobbs D. Predicting RNA‐protein interactions using only sequence information. BMC Bioinform. 2011;12:489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Jia S, Liu Y, Yuan J. Evidence in guidelines for treatment of coronary artery disease. Adv Exp Med Biol. 2020;1177:37–73. [DOI] [PubMed] [Google Scholar]
- 26. Woloszyn‐Durkiewicz A, Mysliwiec M. The prognostic value of inflammatory and vascular endothelial dysfunction biomarkers in microvascular and macrovascular complications in type 1 diabetes. Pediatr Endocrinol Diabetes Metab. 2019;25(1):28–35. [DOI] [PubMed] [Google Scholar]
- 27. Liao Z, Chen Y, Duan C, Zhu K, Huang R, Zhao H, et al. Cardiac telocytes inhibit cardiac microvascular endothelial cell apoptosis through exosomal miRNA‐21‐5p‐targeted cdip1 silencing to improve angiogenesis following myocardial infarction. Theranostics. 2021;11(1):268–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Gao W, Cui H, Li Q, Zhong H, Yu J, Li P, et al. Upregulation of microRNA‐218 reduces cardiac microvascular endothelial cells injury induced by coronary artery disease through the inhibition of HMGB1. J Cell Physiol. 2020;235(3):3079–95. [DOI] [PubMed] [Google Scholar]
- 29. Chen G, Xu C, Gillette TG, Huang T, Huang P, Li Q, et al. Cardiomyocyte‐derived small extracellular vesicles can signal eNOS activation in cardiac microvascular endothelial cells to protect against ischemia/reperfusion injury. Theranostics. 2020;10(25):11754–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Yu F, Zhang Y, Wang Z, Gong W, Zhang C. Hsa_circ_0030042 regulates abnormal autophagy and protects atherosclerotic plaque stability by targeting eIF4A3. Theranostics. 2021;11(11):5404–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Ye Q, Ju C, Ye Z, Tong J. Circ_ROBO2/miR‐186‐5p/TRIM14 axis regulates oxidized low‐density lipoprotein‐induced cardiac microvascular endothelial cell injury. Regen Ther. 2022;20:138–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Tao K, Hu Z, Zhang Y, Jiang D, Cheng H. LncRNA CASC11 improves atherosclerosis by downregulating IL‐9 and regulating vascular smooth muscle cell apoptosis and proliferation. Biosci Biotechnol Biochem. 2019;83(7):1284–8. [DOI] [PubMed] [Google Scholar]
- 33. Yang D, Xiao C, Long F, Su Z, Jia W, Qin M, et al. HDAC4 regulates vascular inflammation via activation of autophagy. Cardiovasc Res. 2018;114(7):1016–28. [DOI] [PubMed] [Google Scholar]
- 34. Usui T, Okada M, Mizuno W, Oda M, Ide N, Morita T, et al. HDAC4 mediates development of hypertension via vascular inflammation in spontaneous hypertensive rats. Am J Physiol Heart Circ Physiol. 2012;302(9):H1894–904. [DOI] [PubMed] [Google Scholar]