Mechanism of DYRK1a in myocardial ischemia–reperfusion injury by regulating ferroptosis of cardiomyocytes

Abstract

This study aimed to explore the role and mechanism of DYRK1a regulating ferroptosis of cardiomyocytes during myocardial ischemia–reperfusion injury (MIRI). H9c2 cells treated with oxygen–glucose deprivation/reoxygenation (OGD/R) were used as MIRI cell models and transfected with sh‐DYRK1a or/and erastin. Cell viability, apoptosis, and DYRK1a mRNA/protein expression were measured accordingly. The levels of reactive oxygen species (ROS), iron, malondialdehyde (MDA), and glutathione (GSH) were determined. The expression of ferroptosis‐related proteins (GPX4, SLC7A11, ACSL4, and TFR1) was detected using western blotting. The MIRI rat model was established to explore the possible role of DYRK1a suppression in cell injury and ferroptosis. OGD/R cells showed elevated mRNA and protein expression for DYRK1a. OGD/R cells transfected with sh‐DYRK1a showed elevated cell viability, GSH content, increased GPX4 and SLC7A11 expression, suppressed iron content, MDA, ROS, ACSL4, and TFR1 expression, and reduced apoptosis rate, whereas co‐transfection of sh‐DYRK1a with erastin reversed the attenuation of sh‐DYRK1a on MIRI. The suppressive effect of sh‐DYRK1a on MI/R injury was confirmed in an MIRI rat model. DYRK1a mediates ferroptosis of cardiomyocytes to deteriorate MIRI progression.

1. INTRODUCTION

Ischemia–reperfusion (I/R) injury is triggered by the initial disruption of blood supply to an organ, followed by restoration and consequent reoxygenation, ¹ which is a dominant cause of cell death and organ damage in a wide range of pathologies, such as myocardial infarction (MI), stroke, and acute kidney injury (AKI). ² Blockade of the arterial blood supply causes a serious imbalance between metabolic supply and demand, leading to tissue hypoxia, while reperfusion of ischemic tissue induces mitochondrial reactive oxygen species (ROS), resulting in cardiomyocyte death and concomitant irreversible damage to the myocardium, termed myocardial ischemia–reperfusion injury (MIRI). ² , ³ This is mainly attributed to an imbalance between cellular free radical generation and intrinsic protective mechanisms. ⁴ During the development of MIRI, the death of cardiomyocytes (terminally differentiated cells that are difficult to regenerate once they die) is a key pathogenic contributor and the final event. ⁵ Iron homeostasis is critical for cardiac function. Under exposure to excess iron, ROS accumulate to drive ferroptosis in cardiomyocytes through the Fenton and Haber‐Weiss reactions, which correspondingly increases the sensitivity of cardiomyocytes to oxidative stress. ⁶ Ferroptosis is a newly discovered iron‐dependent, regulated cell death program, clearly defined in 2012, characterized by excessive iron and concomitant accumulation of lipid hydroperoxides. ⁷ MDA, GSH, GPX4, SLC7A11, ACSL4, and TFR1 are commonly encoded proteins or genes related to ferroptosis, all of which are involved in the oxidative system and lipid metabolism. ⁸ , ⁹ The mechanism by which ferroptosis regulates cardiomyocyte function remains largely unknown and may involve complex molecular processes.

Dual‐specificity tyrosine phosphorylation‐regulated kinases (DYRK1a, DYRK1b, DYRK2, DYRK3, and DYRK4) belong to the CMGC group, which also includes protein kinases such as Ccd2‐like kinases (CLKs), cyclin‐dependent kinases (CDKs), mitogen‐activated protein (MAP) kinases, and glycogen synthase kinases (GSKs). ¹⁰ , ¹¹ These protein kinases participate in multiple cellular functions and developmental processes, such as intracellular signaling, DNA damage repair, cell survival, cell cycle, and so forth. ¹² , ¹³ Among these kinases, the Ser/Thr protein kinase GSK‐3β has been proposed as a positive regulator of ferroptosis by dominating cellular iron metabolism. ¹⁴ Recently, GSK‐3β has also been reported to be an important signaling pathway in MIRI‐induced ferroptosis. ¹⁵ DYRK1a, a member of the DYRKs family, was recently shown to be involved in the control of cell cycle progression in cardiomyocytes. ¹⁶ More recently, it was demonstrated that either conditional deletion or pharmacological suppression of DYRK1a can trigger cell cycle activation in cardiomyocytes and promote cardiac function in adult MI‐rendered mice, ¹⁷ which was also described in another study. ¹⁸ However, there are no studies on the role of DYRK1a in ferroptosis. In the present study, we established a cell injury model induced by oxygen and glucose deprivation/reperfusion (OGD/R) and a rat model of MIRI to assess the effects of DYRK1a on ferroptosis.

2. MATERIALS AND METHODS

2.1. Cell culture

Rat H9c2 cells (category: CL‐0089) purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China) were cultured in high‐glucose Dulbecco's modified Eagle's medium (DMEM, Gibco, Grand Island, NY, USA), containing 1% penicillin/streptomycin and 10% fetal bovine serum (FBS). Once cell confluency reached 80%, cells were extracted with 0.25% trypsin–EDTA (Gibco) and cultured in fresh culture medium. Then cells were suspended and centrifuged at 1200× for 5 min before cells were seeded in a 15 cm culture disk with cell density of 2 × 10⁴ cells per cm² for cell culture under the condition of 37°C and 5% CO₂. The culture medium was refreshed every 2 days.

2.2. OGD/R cell models

The OGD/R models were established according to the instructions of a previous study. ¹⁹ Cells were cultured in serum and glucose free DMEM (Sigma‐Aldrich, St. Louis, MO, USA) with 95% N₂ and 5% CO₂ at 37°C. After cell culture for 6 h, the culture medium was removed and replaced with DMEM, in which 10 mM glucose, 10% horse serum, 10% FBS, and 1% penicillin/streptomycin were supplemented, for cell culture at 37°C for 24 h with 5% CO₂. The cells used in control group were cultured in DMEM with 5% CO₂ at 37°C for 24 h.

2.3. Cell transfection and grouping

sh‐DYRK1a (vector with low DYRK1a expression) and its negative control (sh‐NC) were purchased from GenePharma (Shanghai, China). Cell transfection was performed according to the manufacturer's instructions. Cells were grouped into Control group (normal oxygen condition), OGD/R + Ferrostatin‐1 group (Sigma, USA, 0.1 μM ²⁰ , ²¹ ), OGD/R group, sh‐NC group, sh‐DYRK1a group, sh‐DYRK1a + Erastin group (Sigma, USA, 5 μM ²² , ²³ ). The biological activity of the cells was assessed 48 h after transfection.

2.4. MTT assay on cell viability

According to a previous study, ²⁴ cells in the 96‐well plates were added with 10 μL MTT (M6494, Thermo Fisher Scientific) per well for incubation of 2 h, with three triplicated wells for each group. Methyl sulfoxide (DMSO; Sigma, USA) was added to terminate the interaction. The optical density (OD) was measured using a microplate reader (680; Bio‐Rad, Hercules, CA, USA) at 490 nm.

2.5. Apoptosis rate by flow cytometry

Cell apoptosis rate was determined using Annexin V‐FITC flow cytometry (Beyotime, Shanghai). The digested cells were centrifuged and collected before resuspension in binding buffer, after which annexin V‐FITC and propidium iodide (PI) were added and incubated at room temperature for 15 min. Each experiment was repeated three times.

2.6. Detection on iron content

Iron content in tissues and cells was detected based on the instructions of the Iron Assay Kit (ab83366, Abcam, Cambridge, MA, USA) and as described in a previous study. ²⁴ Specifically, 50 μL cells were added with buffer solution to a volume of 100 μL per well in the 96‐well plates. Then 5 μL analytic buffer was added into each well for incubation at 25°C for 30 min with iron standards and samples, respectively. The iron probe (100 μL) was added and mixed in each well for incubation at 25°C for 60 min, and the OD was measured at 593 nm using a microplate reader (680; Bio‐Rad, Hercules, CA, USA).

2.7. Detection of malondialdehyde (MDA) content

MDA content was detected in tissues and cells according to the instructions of the MDA Kit (CS0260, Sigma‐Aldrich). Samples of 100 μL and diluted MDA standards were mixed with 100 μL cell‐free lysis buffer in a 1.5 mL EP tube. Then 200 μL pre‐warmed MDA solution was added into each well and gently shaken before cells were heated with metal bath at 100°C for 15 min, followed by water bath to room temperature and centrifugation at 1000 g for 10 min. The supernatant (200 μL) was collected and seeded in the 96‐well plate, and the OD was measured at 593 nm using a microplate reader (680; Bio‐Rad, Hercules, CA, USA).

2.8. Detection of glutathione (GSH) content

A GSH kit (CS0260, Sigma‐Aldrich) was used to detect the GSH content. Cells (1 × 10⁸) in the plates were washed with PBS before three volumes of 5% SSA were added for centrifugation at 10000 g for 10 min. The supernatant was collected and mixed with 150 μL GSH mixture for incubation at room temperature for 5 min, followed by 20 min of further incubation with 50 μL diluted NADPH solution. The OD was measured with a microplate reader (680; Bio‐Rad, Hercules, CA, USA) at 412 nm.

2.9. Detection of ROS content

According to a previous report, ²⁵ ROS fluorescence DCFH‐DA probe (Sigma, Shanghai, China) was used for the detection. Cell supernatant was added with 2 mL 10 μmol/L DHE probe for incubation at 37°C for half an hour in the dark. After the DCFH‐DA probe was oxidized and converted into intensely fluorescent DCFH, it exhibited green fluorescence in the cytoplasm. Fluorescent images were obtained using a fluorescence microscope (Olympus IX51, Tokyo, Japan).

2.10. Western blot

Cells or tissues were treated with RIPA lysis buffer (Beyotime) on ice for 15 min before centrifugation at 13000 g for 5 min. A BCA kit (Beyotime) was used to measure the protein concentration. Qualified proteins were mixed with loading buffer and kept in a boiling water bath for 10 min for denaturation. The loaded sample was subjected to electrophoresis at 80 V for 30 min and then at 120 V for 90 min before membrane transfer at 250 mA in an ice bath for 10 min. The polyvinylidene fluoride (PVDF) membrane was washed thrice in washing buffer, each for 1–2 min, and then incubated with blocking buffer for 2 h. Primary antibodies of GPX4 (ab125066, 1:1000, abacm, UK), SLC7A11 (ab175186, 1:1000, abacm), ACSL4 (ab155282, 1:1000, abacm), TFR1 (ab269513, 1:1000, abacm), DYRK1a (ab259869, 1:1000, abacm), and GAPDH (ab8245, 1:1000, abacm) were added for incubation at 4°C for overnight, followed by TBST washing for three times, for 10 min each. Next, the secondary antibody, horseradish peroxidase (HRP) labeled goat anti rabbit IgG (Beyotime; A0208, 1:1000, Shanghai), was added to interact with the primary antibody at room temperature for 2 h. The membranes were then washed with TBST for three times, for 10 min each. ECL color‐developing solution (P0018FS, Beyotime, Shanghai, China) was added to observe the bands using a chemiluminescence imaging system (Bio‐Rad). Each experiment was repeated three times.

2.11. Reverse transcription quantitative polymerase chain reaction

Total RNA was extracted from tissues and cells using TRIZOL reagent and reverse‐transcribed using a reverse transcription kit (TaKaRa, Tokyo, Japan) according to the manufacturer's instructions. Quantitative PCR was performed using the SYBR Green Mix (Takara) on a Biosystems 7300 Real‐Time PCR System (ABI, Foster City, CA, USA). Three repetitions were set for each reaction process. Data were analyzed using 2^‐ΔΔCt method. ²⁶ ΔΔCt = experimental group (Ct target gene−Ct control)−control group (Ct target gene−Ct control). GAPDH was used as the control. Primer sequences are listed in Table 1.

TABLE 1.

Primer sequences.

Primer	Sequences (5′ end—3′ end)
DYRK1a‐F	GTGGCTTTGCTCTTACTGTGC
DYRK1a‐R	GAGCCGGACAGATGAAGGTT
GAPDH‐F	GCATCTTCTTGTGCAGTGCC
GAPDH‐R	GATGGTGATGGGTTTCCCGT

Abbreviations: F, forward, R, reverse.

2.11.1. Immunofluorescence

The digested cells were counted, seeded in a chamber, and incubated with 2 × 10⁵ cells per well. Once the cells grew to 60% to 80% confluency, they were rinsed in PBS, 3 × 5 min, and fixed in 4% paraformaldehyde for 15 min. After PBS washing for 3 × 5 min, cells were permeabilized and treated with 1% Triton X‐100 (diluted in PBS) on ice for 2 min, after which the cells were rinsed 3 × 5 times in PBS and blocked for non‐specific responses using 5% serum. The cells were then incubated with primary antibodies against DYRK1a (ab16140, 1:500, Abcam) and N‐cadherin (ab98952, 1:500), followed by further incubation with a green fluorescence‐labeled FITC‐goat anti‐rabbit secondary antibody (ab6717, 1:2000) for 1 h at room temperature in the dark. DAPI was used to stain the nucleus under light protection for 15 min. A fluorescence microscope (Olympus IX51, Tokyo, Japan) was used for imaging. Each experiment was repeated thrice.

2.12. Establishment of MIRI rat treatment and grouping

The procedures and design of animal experiments were conducted in accordance with the regulations and standards of the Ethical Committee of Beijing Tongren Hospital. The study design was approved by the ethics committee of Beijing Tongren Hospital (ethical approval number: TRECKY2021‐072), and all efforts were made to minimize the suffering of rats. Healthy male SD rats (n = 24, 8 weeks) purchased from Hunan SJA Laboratory Animal Co., Ltd (Changsha, China) were fed in specified pathogen free (SPF) cages with the temperature of 21–25°C, and relative humidity of 50%–65%. The illumination system was 12 h in day and 12 h in dark. All the rats had free access to food and water. All rats were classified into sham group, MIRI group, sh‐DYRK1a group (7 days before modeling, 20 μL sh‐DYRK1a was injected via the right common carotid artery), ²⁷ sh‐NC group (7 days before modeling, equal volume of sh‐NC was injected via the right common carotid artery), with six rats in each group.

2.13. MIRI rat modeling

The MIRI rats were modeled based on information from a previous report. ²⁷ SD rats were fed for 1 week to adapt to the new housing environment. Before modeling, rats were forbidden to feed for 12 h but were free to drink water. Pentobarbital sodium was intraperitoneally injected to anesthetize the rats. The pectoralis major and minor muscles were isolated, and the heart was exposed via the fourth rib on the left border of the sternum. The left anterior descending coronary artery was ligated using thread 6‐0. Successful ligation was shown by ST‐segment elevation (>0.2 mV), T‐wave elevation, and a pale appearance in the heart area on electrocardiography (ECG). After ligation for 30 min, the knot was released to restore blood perfusion in the left anterior descending artery. Successful perfusion was shown by decreases in ST‐segment elevation and the myocardium turning red under ligature. For rats in the sham group, the thread was only passed through the coronary artery without ligation, and other procedures were conducted as in the MIRI group.

2.14. H&E staining

The myocardium was sliced (4 μm), hydrated with gradient alcohol and transparentized by xylene. After being washed in deionized water, the slices were stained with hematoxylin for 3–5 min, differentiated by 1% hydrochloric alcohol for 20 s, and treated by 1% ammonia water for 30 s. Slices were washed with deionized water at the interval of each process. Then 1% eosin solution was used for re‐staining, after which the slices were washed with running water for 5 min and deionized water for 1 min. After a serial of normal hydration, slices were made transparent (75% alcohol for 5 min, 90% alcohol for 5 min, 95% alcohol for 5 min, absolute alcohol for 5 min, and xylene for 10 min × twice), followed by drying, and sealing. The slices were then observed under a microscope (Olympus IX51, Tokyo, Japan).

2.15. TUNEL staining

Apoptosis was measured using a TUNEL kit (ab66110; Abcam). The rat myocardium was fixed with 4% paraformaldehyde overnight and embedded in paraffin for slicing. A total of five slices were collected and dewaxed before 50 μL of 1% diluted Proteinase K solution was added followed by incubation for 30 min at 37°C. Then endogenous POD activity of tissues was terminated by 0.3% H₂O₂ containing methanol solution after incubation for 30 min at 37°C. Subsequently, the slices were further incubated with TUNEL reaction buffer, TdT enzyme and HRP labeled streptomyces ovalbumin before 2% DAB solution was added for interaction of 15 min. Hematoxylin was used to re‐stain cell nuclei. The slices were hydrated, made transparent, and sealed. Images were captured under a light microscope and five random fields were selected from each slice. The number of positive cells in each field was calculated using Image‐Pro Plus 6.0 software. The nucleus in brown‐yellow refers to apoptosis‐positive cells and blue refers to normal cells. The average cell number was calculated, and the TUNEL positive rate = total number of cells in brown–yellow/total cell number.

2.16. TTC staining to calculate MI area

After reperfusion, the rats were euthanized. The myocardium tissue slices (1 mm) stored at −20°C for 20 min were thawed at 37°C in dark and then rinsed in TTC solution for 20 min before fixation in 10% formaldehyde solution for 4 h. Myocardial tissues were isolated to observe MI. Tissues in light red refer to the ischemic myocardium without MI, and tissues in gray and white refer to the MI situation. Areas with organized enzymes and MI were unstained and pale in color. The MI area was calculated using the BI‐2000 image analysis system. MI area = (total MI area in each slice/whole area of the left ventricle) × 100%.

2.17. Measurement on creatine kinase‐MB (CK‐MB)

CK‐MB levels were determined using a CK‐MB kit (H197‐1‐1, Nanjing Jiancheng Biotech, China) in a 96‐well plate, according to the manufacturer's instructions. The OD was measured at 450 nm.

2.18. Statistical analysis

Data analysis was performed using GraphPad prism7 and all data were expressed as mean ± standard deviation ($\overline{x}$ ± s). The t‐test was used for comparisons between two groups, whereas comparisons among multiple groups were analyzed using one‐way analysis of variance (ANOVA), with Tukey's multiple comparison test for post hoc analysis. Statistical significance was set at p‐value of less than 0.05.

3. RESULTS

3.1. Ferroptosis in MIRI cell models

The measurement of cell viability and apoptosis in the OGD/R cell models showed that H9c2 cells in the OGD/R group had suppressed cell viability and an increased apoptosis rate compared to cells in the control group (Figure 1A,B, *p < 0.05). Meanwhile, the OGD/R group had higher iron and MDA content and lower GSH levels than those in the control group (Figure 1C–E, *p < 0.05). Detection of ROS levels using the DCFH‐DA probe demonstrated that ROS levels in the OGD/R group were elevated compared to those in the control group (Figure 1F, *p < 0.05). Western blot analysis of the expression levels of ferroptosis‐related proteins showed that cells in the OGD/R group had decreased expression levels of GPX4 and SLC7A11 and elevated expression of ACSL4 and TFR1 when compared with those in the control group (Figure 1G,H, *p < 0.05), while different expression patterns were found in OGD/R cells treated with the ferroptosis inhibitor Ferrostatin‐1 (0.1 μM ²⁰ , ²¹ ; Figure 1A–H, ^# p < 0.05). Taken together, ferroptosis was observed in MIRI cell models.

FIGURE 1.

Ferroptosis was found in MIRI cell models. MIRI cell models were established in OGD/R treated H9c2 cells. (A) MTT assay was used to detect cell viability. (B) Annexin V‐FITC/PI” flow cytometry was used to detect cell apoptosis rate. (C–E) The contents of iron, MDA and GSH were measured by kits. (F) ROS levels were determined using DCFH‐DA probe. (G, H) Western blot was used to detect the protein expressions of GPX4, SLC7A11, ACSL4, and TFR1. All data were expressed as mean ± standard deviation. Cell experiments were repeated for three times. *p < 0.05, when compared with Control group; ^# p < 0.05, when compared with OGD/R group. GSH, Glutathione; MDA, Malondialdehyde; MIRI, myocardial ischemic reperfusion injury; OGD/R, oxygen–glucose deprivation/reoxygenation; ROS, reactive oxygen species.

3.2. Elevated expression of DYRK1a in MIRI

Although these data confirm the implications of ferroptosis in MIRI cell models, the mechanism by which ferroptosis regulates MIRI progression remains unclear. The potential of DYRK1a as a target in MI has been reported in a previous study, ¹⁷ but insufficient evidence is available regarding its role in MIRI. In this study, RT‐qPCR and western blotting showed that the mRNA and protein expression of DYRK1a in the OGD/R group were higher than those in the control group (Figure 2A,B, *p < 0.05), which was consistent with the immunofluorescence results (Figure S1). These results suggest a possible role for DYRK1a in MIRI.

FIGURE 2.

Elevated expression of DYRK1a in OGD/R treated cells. (A, B) RT‐qPCR and western blot were applied to detect the mRNA and protein expressions of DYRK1a. All data were expressed as mean ± standard deviation. Cell experiments were repeated for three times. *p < 0.05, when compared with Control group. OGD/R, oxygen–glucose deprivation/reoxygenation.

3.3. Decreased DYRK1a expression can suppress ferroptosis to attenuate MIRI in OGD/R cells

To further identify the role of DYRK1a in regulating ferroptosis in MIRI, sh‐DYRK1a and its negative control, sh‐NC, were transfected into OGD/R cells, and transfection efficiency was detected using RT‐qPCR and western blotting. Compared with the sh‐NC group, the mRNA and protein expression of DYRK1a in the sh‐DYRK1a group was significantly decreased (Figure 3A,B, *p < 0.05), indicating that transfection was effective.

FIGURE 3.

Suppression on DYRK1a expression can inhibit ferroptosis to attenuate MIRI in OGD/R cells. (A, B) DYRK1a mRNA and protein expressions were detected by RT‐qPCR and western blot. (C) Cell viability was assessed by MTT assay. (D) Apoptosis rate was measured using flow cytometry. (E–G) The iron content, MDA, and GSH levels were detected by detection kits. (H) ROS levels was determined using DCFH‐DA probe. (I, J) Expressions of ferroptosis related proteins, including GPX4, SLC7A11, ACSL4, and TFR1 were detected by western blot. All data were expressed as mean ± standard deviation. Cell experiments were repeated for three times. *p < 0.05, when compared with sh‐NC group. ^# p < 0.05, when compared with sh‐DYRK1a group. GSH, Glutathione; MDA, Malondialdehyde; MIRI, myocardial ischemic reperfusion injury; OGD/R, oxygen–glucose deprivation/reoxygenation; ROS, reactive oxygen species.

After the cells were transfected with sh‐DYRK1a and/or erastin, cell viability and the expression of ferroptosis‐related factors were measured. The results showed that cells in the sh‐DYRK1a group had elevated cell viability, GSH content, and increased expression of GPX4 and SLC7A11, along with suppressed iron content, MDA content, ROS levels, and apoptosis rate, and reduced expression of ACSL4 and TFR1 (Figure 3C–J, *p < 0.05). Co‐transfection of sh‐DYRK1a and erastin in OGD/R cells abolished the protective effect of sh‐DYRK1a against ferroptosis, thereby inhibiting MIRI progression (Figure 3C–J, ^# p < 0.05). Taken together, suppression of DYRK1a expression can inhibit ferroptosis and attenuate MIRI in OGD/R cells.

3.4. Decreased DYRK1a expression can suppress ferroptosis to attenuate MIRI in rats

To validate these findings in vitro, we established MIRI rat models in which sh‐DYRK1a was injected to suppress DYRK1a. Then RT‐qPCR and western blot were used to detect the DYRK1a expression in the myocardium. The results showed that DYRK1a mRNA and protein expression levels in the MIRI group were significantly increased compared to those in the sham group (*p < 0.05), while in MIRI rats injected with sh‐DYRK1a, the expression levels of DYRK1a mRNA and protein were significantly decreased compared to those in the sh‐NC group (Figure 4A,B, ^# p < 0.05).

FIGURE 4.

Suppression on DYRK1a expression can inhibit ferroptosis to attenuate MIRI in rats. (A, B) DYRK1a mRNA and protein expressions were detected by RT‐qPCR and western blot. (C) Myocardium morphology was observed after H&E staining. (D) Positive cell numbers was counted after TUNEL staining. (E) MI area was calculated after TTC staining. (F–I) The contents of CK‐MB, iron, MDA, and GSH were detected using kits. (J, K) Expressions of ferroptosis related proteins, including GPX4, SLC7A11, ACSL4, and TFR1 were detected by western blot. All data were expressed as mean ± standard deviation. N = 6. *p < 0.05, when compared with Sham group. ^# p < 0.05, when compared with sh‐NC group. GSH, Glutathione; MDA, Malondialdehyde; MI, myocardial infarction; MIRI, myocardial ischemic reperfusion injury.

H&E staining of the myocardium showed that MIRI rats had unclear cell boundaries and a disordered cell arrangement with cell breakage and inflammatory infiltration (*p < 0.05); however, these observations were substantially improved in MIRI rats transfected with sh‐DYRK1a (Figure 4C). TUNEL staining to measure the positive cell numbers showed that compared to the sham group, MIRI rats had significantly more positive cells in the myocardium (*p < 0.05), but the number of positive cells in the sh‐DYRK1a group was significantly decreased when compared the sh‐NC group (Figure 4D, ^# p < 0.05). TTC staining demonstrated that the MI area in MIRI rats was increased compared to that in the sham group, but the MI area in the sh‐DYRK1a group was decreased compared to that in the sh‐NC group (Figure 4E, ^# p < 0.05).

The levels of CK‐MB, iron, MDA, and GSH showed that MIRI rats had elevated levels of CK‐MB, iron, and MDA, and decreased GSH levels in contrast to those in the sham group (*p < 0.05). Transfection of sh‐DYRK1a in MIRI rats led to suppressed levels of K‐MB, iron, ROS, and MDA, and increased GSH levels compared with MIRI rats transfected with sh‐NC (Figure 4F–I, ^# p < 0.05).

Western blotting showed that, compared with the sham group, MIRI rats had suppressed expression of GPX4 and SLC7A11 and elevated expression of ACSL4 and TFR1 (*p < 0.05), whereas a reversed expression pattern was found in the sh‐DYRK1a group when compared with the sh‐NC group (Figure 4J,K, ^# p < 0.05). The above results show that suppression of DYRK1a expression can inhibit ferroptosis and attenuate MIRI in rats.

4. DISCUSSION

Regulated cell death can be classified into nine types: death receptor‐regulated apoptosis, necroptosis, ferroptosis, pyroptosis, mitochondria‐regulated apoptosis, mitochondria‐regulated necrosis, autophagic cell death, parthanatosis, and immunogenic cell death. These cell death programs, particularly the regulated forms of cardiomyocyte death, play significant roles in major cardiac syndromes such as MI with reperfusion and heart failure. ²⁸ The aforementioned nine programs participate in complex mechanisms underlying the death of cardiomyocytes. ²⁹ , ³⁰ Among these, ferroptosis is considered a contributor to I/R injury; hence, targeting ferroptosis may be a promising protective therapy against I/R injury. ³¹ First, this study demonstrates the important role of ferroptosis in OGD/R‐induced damage to cardiomyocytes. Furthermore, we analyzed the molecular regulators of ferroptosis in MIRI and found that DYRK1a was upregulated and participated in the regulation of ferroptosis in MIRI.

Ferroptosis was induced by OGD/R exposure, characterized by excess iron, significant elevations in MDA and ROS levels, and significant reductions in GSH levels, corresponding to growth inhibition and apoptosis induction in cardiomyocytes. Several metabolic processes, such as iron, lipid, amino acid, and GSH metabolism have been implicated in this event. ³² Iron overload is a potential cause of MIRI‐related cardiac ferroptosis. The lipid peroxidation reaction of ROS with PUFA and PE impairs fluidity and stability while increasing the permeability of the cell membrane, ultimately resulting in cell death. ³³ Additionally, ROS interacts with endoplasmic reticulum stress (ERS) during ferroptosis to participate in cardiomyocyte injury. ³⁴ In addition to ERS and ROS accumulation, ferroptosis modulates MIRI by regulating the glutathione peroxidase 4 (GPX4) and autophagy‐mediated ferroptosis pathways. ³⁵ These findings suggest the crucial importance of ferroptosis in MIRI and that targeting ferroptosis may be a feasible method to protect against MIRI.

In this study, we experimentally determined that DYRK1a expression was abnormally increased at both mRNA and protein levels in OGD/R‐damaged cardiomyocytes and in the myocardium of rats with MIRI. Functional experiments were performed by shRNA‐mediated DYRK1a knockdown. DYRK1a knockdown restored the viability of OGD/R‐damaged cardiomyocytes and suppressed ferroptosis. Correspondingly, iron content and MDA and ROS levels were markedly reduced, whereas GSH levels were notably increased. At the molecular level, the levels of GPX4 and SLC7A11 (two negative regulators of ferroptosis) were upregulated, while those of ACSL4 and TFR1 (contributors to ferroptosis) were downregulated. DYRK1a inhibition may block DYRK1a‐ASF‐CaMKIIδ pathway, thus retarding the development of MI‐induced heart failure. ³⁶ Cardiomyocyte‐specific DYRK1a overexpression promotes Rb1 phosphorylation, blocks the Rb/E2f‐signaling pathway, and down‐regulates E2f‐target genes, consequently delaying cell cycle progression. ¹⁶ Although the levels of cell cycle‐related genes are increased in DYRK1a‐deficient cardiomyocytes after MI, both pharmacological inhibition and cardiomyocyte‐specific ablation of DYRK1a can cause baseline hyperplasia and improve cardiac function after MIRI. ¹⁸ Although a direct relationship between DYRK1a and ferroptosis has not yet been reported, DYRK1a has been linked to ROS generation during neuroinflammation. ³⁷ Animal experiments in the current study offered additional evidence demonstrating that DYRK1a knockdown not only reduced MI size and pathological damage but also blocked ferroptosis. The primary results of this study showed that the increase in the apoptosis rate and the levels of ferroptosis‐related proteins in OGD/R cells indicate the occurrence of both apoptosis and ferroptosis in MIRI cell models, whereas the suppression of DYRK1a expression can suppress ferroptosis and apoptosis in MIRI cell models, suggesting that DYRK1a suppression can attenuate MIRI progression by inhibiting cell ferroptosis and/or apoptosis. Erastin, which suppresses antioxidant GSH synthesis and promotes iron‐dependent cell death, ³¹ was used as an inducer of ferroptosis in this study. As a Class 1 ferroptosis inducer, erastin blocks the XC system, which is the cystine/glutamate exchanger of the membrane, thus preventing the entry of cystine (essential for GSH synthesis) into the cell. ³⁸ In this study, the treatment of OGD/R cells with erastin increased ferroptosis and abolished the suppressive effect of sh‐DYRK1a on ferroptosis, suggesting that DYRK1a silencing ameliorates MIRI by suppressing ferroptosis.

In summary, this study proposes a novel target DYRK1a against ferroptosis in MIRI, which may contribute to the development of potential cardioprotective therapies. A previous study showed that DYRK1a mediates cell death via promoting ASK1 phosphorylation or activating ASK1‐mediated JNK1‐signaling. ³⁹ In addition, integrated genome‐wide transcriptomic and epigenomic analyses suggested that DYRK1a knockdown robustly induces cardiomyocyte cell cycle activation via histone modifications. ¹⁷ This aroused further interest in identifying whether DYRK1a regulates ferroptosis in MIRI through histone modifications or other pathways, which may be a promising direction for future studies. Nevertheless, this study provides a basis for a better understanding of the mechanisms involved in MIRI‐related ferroptosis.

CONFLICT OF INTEREST STATEMENT

All authors declare no conflict of interest.

Supporting information

FIGURE S1. Immunofluorescence detected the expression of DYRK1a in both OGD/R group and Control group. OGD/R, oxygen–glucose deprivation/reoxygenation.

Wang J, Xu R‐M, Cao Q‐M, Ma B‐C, Zhang H, Hao H‐P. Mechanism of DYRK1a in myocardial ischemia–reperfusion injury by regulating ferroptosis of cardiomyocytes. Kaohsiung J Med Sci. 2023;39(12):1190–1199. 10.1002/kjm2.12753