Silenced LASP1 interacts with DNMT1 to promote TJP2 expression and attenuate articular cartilage injury in mice by suppressing TJP2 methylation

Abstract

To investigate the regulatory mechanisms and effects of LIM and SH3 protein 1 (LASP1) on osteoarthritis (OA). IL‐1β was used to induce OA in cell models. Viability and apoptosis of chondrocytes were assessed. The expressions of tumor necrsis factor‐α (TNF‐α) and IL‐6 were measured by ELISA kit, and Quantitative reverse transcription polymerase chain reaction (qRT‐PCR) and Western blot were performed to test the expression of related proteins. The STRING database was used to predict the relationship between LASP1 and DNA methyltransferase 1 (DNMT1). The tight junction protein 2 (TJP2) and Gene Expression Omnibus data were analyzed for differential OA genes. Methylation‐specific PCR detected methylation of the TJP2 promoter region, and chromatin immunoprecipitation detected the enrichment of DNMT1 in the TJP2 promoter region. Safranin O‐Fast Green staining and hematoxylin and eosin staining were used to determine the OARSI score and evaluate the pathological conditions of the joint tissues. LASP1 was highly expressed in IL‐1β‐induced cell models. Silencing of LASP1 promoted chondrocyte proliferation and expression of Collagen II and Aggrecan and inhibited chondrocyte apoptosis, inflammatory factors, and matrix metalloprotein expression. TJP2 is weakly expressed in OA models, and LASP1 promotes methylation of the TJP2 promoter region by interacting with DNMT1. Silencing of LASP1 attenuated IL‐1β‐induced chondrocyte degeneration by promoting TJP2 expression. Similarly, silencing LASP1 promotes TJP2 expression to alleviate articular cartilage injury in mice with OA. Silencing of LASP1 inhibited the methylation of the TJP2 promoter region by interacting with DNMT1, thereby alleviating articular cartilage damage in OA mice.

1. INTRODUCTION

Osteoarthritis (OA) is a chronic joint disorder linked to articular cartilage degeneration that affects numerous populations worldwide, especially the middle‐aged and elderly people. ¹ , ² , ³ As a highly prevalent type of arthritis, ~303 million people worldwide and 61.2 million patients in China had OA in 2017. ⁴ , ⁵ The risk factors of OA involve genetic susceptibility, obesity, severe joint damage, advanced age, and congenital deformities. ³ , ⁶ Degeneration of the articular cartilage tissue is the main feature of OA. ⁷ However, the treatment efficiency of OA is far from satisfactory as few therapeutic approaches are available. Therefore, unraveling the molecular mechanism underlying articular cartilage degeneration may be the key to find a novel therapeutic approach for OA.

LIM and SH3 protein 1 (LASP1) was reported to be the first protein that contains both LIM and SH3 domains. It is expressed in a wide range of cells, including neurones and fibroblasts. ⁸ , ⁹ LASP1 was reported as a complex nuclear transcriptional regulator in several diseases. ¹⁰ , ¹¹ A recent study reported that LASP1 is induced in rheumatoid arthritis‐fibroblast‐like synoviocytes and becomes a functional component of cadherin‐11 adhesion structures during the progressive course of arthritis. ¹² However, whether LASP1 is implicated in OA and how it affects OA progression remain unclear.

Previous evidence revealed that altered DNA methylation is associated with autoimmune diseases, particularly rheumatoid arthritis. ¹³ , ¹⁴ It was reported that DNA methyltransferase 1 (DNMT1) protein was found in fibroblast‐like synoviocytes of rheumatoid arthritis and OA. ¹⁵ Recently, studies reported the importance of DNMT1 in regulating cartilage tissues and highlighted its potential as a therapeutic target for OA. ¹⁶ , ¹⁷ Additionally, LASP‐1 and DNMT1 are implicated in the epigenetic mechanisms of breast cancer. ¹⁸ Nevertheless, how LASP‐1 interacts with DNMT1 in OA remains unclear. Thus, it would be intriguing to further explore its downstream targets or signaling pathways in OA.

Tight junction protein 2 (encoded by TJP2) is a cytoplasmic component of the cell–cell junction complex, which is found to be expressed in most epithelial cells. ¹⁹ Increasing evidence supports the regulation of TJP2 in cell viability. Additionally, TJP2 may act as a tumor suppressor in multiple cancers. ²⁰ , ²¹ , ²² The Gene Expression Omnibus (GEO) database showed that TJP2 is lowly expressed in OA models. Moreover, the interaction among LASP1, DNMT1, and TJP2 was found in the STRING database. Therefore, we explored the possible effect of LASP1 in OA to investigate its mechanism with DNMT1 and TJP2 in IL‐1β‐induced cell models and OA mouse models.

2. MATERIALS AND METHODS

2.1. STRING database

STRING database (https://cn.string-db.org/cgi/input.pl?sessionId=4Bvlcg3I4RKk&input_page_show_search=on) was used to predict the interactions between LASP1 and DNMT1/TJP2. GEO data were used to analyze differentially expressed gene clustering and draw differentially expressed genes using volcano and scatter plots. CpG islands were predicted using the promoter CpG prediction website MethPrimer (http://www.urogene.org/methprimer/).

2.2. Establishment of OA cell model in vitro

Human chondrocytes (C28/I2) were derived from the Cell Bank of the Chinese Academy of Science. C28/I2 was cultured in Dulbecco's Modified Eagle's Medium (DMEM)/F‐12 (Gibco, Carlsbad, CA) medium, in which 1% penicillin and streptomycin (Sigma Aldrich, St. Louis, MO) and 10% FBS (Gibco) at 37°C and 5% CO₂ were supplemented and the medium was replaced every 3 days. C28/I2 cell lines were treated with 10 ng/mL of IL‐1β (CYT‐208, ProSpec‐Tany TechnoGene Ltd., Israel) for 24 h to establish OA cell model. ²³ Following groups were assigned: control, IL‐1β, IL‐1βsh‐NC (IL‐1β treatment and silencing negative control), IL‐1βsh‐LASP1 (IL‐1β treatment and silencing LASP1), IL‐1βsh‐NC (IL‐1β treatment and silencing negative control), IL‐1βsh‐LASP1sh‐NC (IL‐1β treatment, silencing LASP1, and silencing negative control), and IL‐1βsh‐LASP1sh‐TJP2 (IL‐1β treatment, silencing LASP1, and silencing TJP2). Lentiviral plasmids and viral packaging kits for constitutive expression of sh‐NC, sh‐LASP1, and sh‐TJP2 were purchased from GeneCopoeia (Rockville, MD). After cotransfection with lentiviral transfection reagents for 48 h in HEK293T cells, viral titres were tested using a p24 ELISA kit (Cell Biolabs, Inc., San Diego, USA) with a viral titre of 5 × 10⁸ TU/mL (8 × 10⁸ TU/mL for the control group). Subsequently, C28/I2 human chondrocytes were infected with lentiviral vectors for 24 h, and stably transfected chondrocytes were screened using puromycin (P8230, Solarbio) after 48 h.

2.3. Cell counting kit‐8 assay

The category number of cell counting kit‐8 (CCK‐8) cell counting kit is C0038 from Beyotime. Following incubation, mixture of serum‐free DMEM/F‐12 (100 μL) and CCK‐8 reagent (10 μL) were supplemented into each well for incubation for 1 h at 37°C and 5% CO₂. A microplate reader (Infinite F200, Tecan, Männedorf, Switzerland) was applied to detect the absorbance at 450 nm.

2.4. Flow cytometry

Cells were sampled by centrifugation (2000 rpm ×5 min). After the culture medium was removed, cells were washed twice with ice‐cold PBS before being suspended with 400 μL of 1× binding buffer. Annexin V‐FITC (5 μL) was supplemented to the cell suspension, and cells were subsequently incubated away from light at 4°C for 15 min. Then, 10 μL of PI was supplemented for further incubation at 4°C for 5 min. The cells were analyzed using flow cytometry (FCM; BD FACSCalibur, BD Company, USA) within 1 h. This experiment was performed in triplicate.

2.5. ELISA

Tumor necrsis factor‐α (TNF‐α, PT512), IL‐6 (PI326), and IL‐1β (PI301) levels in the supernatants and synovial fluid were measured using ELISA kits (Beyotime).

2.6. Quantitative reverse transcription polymerase chain reaction (qRT‐PCR)

TRIzol reagent (Invitrogen, Carlsbad, CA) was used, and cDNA was reverse transcribed using a PrimeScript RT kit (RR014, TaKaRa, Liaoning, Dalian, China). Synthesized cDNA was determined by qRT‐PCR using Fast SYBR Green PCR kit and ABI 7500 RT‐PCR system (Applied biosystems; internal reference: GAPDH). The relative expression of involved genes was analyzed using the 2−ΔΔCt method. Primers are listed in Table 1.

TABLE 1.

Primer sequence.

Gene	Primer sequence (5′‐3′)	Sequence
MMP9	Forward	GCAGAGGCATACTTGTACCG
	Reverse	TGATGTTATGATGGTCCCACTTG
MMP13	Forward	GCTGGACTCCCTGTTG
	Reverse	TCG GAG CCT GTC AAC T
Aggrecan	Forward	GATGTTCCCTGCAATTACCACCTC
	Reverse	TGATCTCATACCGGTCCTTCTTCT G
Collagen II	Forward	GGGAATGTCCTCTGCGATGAC
	Reverse	GAAGGGGATCTCGGGGTT G
LASP1	Forward	CAGCCCCAG TCTCCATACAG
	Reverse	ATACTGATGTCG CGGCGG
GAPDH	Forward	GACCCCTTCATTGACCTCAAC
	Reverse	GTCCACCACCCTGTTGCTGTA

Abbreviations: GAPDH, glyceradehyde‐3‐phosphate dehydrogenase; LASP1, LIM and SH3 protein 1; MMP, matrix metalloproteinase.

2.7. Western blot

Cultured cells were digested with trypsin and lysed with enhanced RIPA lysis buffer containing protease inhibitors (Boster). The protein concentration was determined using a bicinchoninic acid (BCA) protein quantification kit (Boster). Sodium dodeyl sulphate‐polyacrylamide gel delectrophoresis (SDS‐PAGE, 10%) was used for protein separation, and the separated proteins were electrotransferred to Polyvinylidene Fluoride (PVDF) membranes and blocked with 5% bovince serum albumin (BSA) at room temperature for 2 h. After dilution, rabbit anti‐matrix metalloproteinase 9 (MMP9, ab76003, 1:1000, Abcam, UK), matrix metalloproteinase 13 (MMP13, ab39012, 1:3000), Aggrecan (ab194594, 1:500), Collagen II (ab34712, 1:1000), LASP1 (ab156872, 1:500), TJP2 (ab224314, 1:500), and GAPDH (ab181602, 1:5000) primary antibodies were supplemented and incubated overnight at 4°C. Subsequently, the membrane was rinsed with phosphate‐buffered saline (PBST) thrice, followed by supplementation of horse radish peroxidase (HRP) labeled secondary anti‐immunoglobulin G (IgG, ab6721, ab150117; 1:2000) and incubation for 1 h, followed by washing thrice with PBST. An ECL luminescent solution (EMD Millipore, USA) was used for development and Image J software (internal reference: GAPDH) for grayscale quantification. The experiment was performed in triplicate.

2.8. Methylation‐specific PCR

The DNA methylation‐GoldTM kit (D5005, Zymo Research) was utilized for detecting the TJP2 promoter region methylation. The primer sequences were displayed as follows: TJP2‐MD (5′‐ GGATTATTTGAGTTGCGATAGTC‐3′) and TJP2‐MR (5′‐TAAATTTCCTTATACTCTCCTCGTA‐3′), and for nonmethylation reactions: TJP2‐UD (5′‐GGATTATTTGAGTTGTGATAGTTGT‐3′) and TJP2‐UR (5′‐CTAAATTTCCTTATACTCTCCTCATA‐3′). Purified DNA was supplemented with CT conversion reagent for denaturation and bisulfate conversion, a reaction column for desulfurization and purification, and purified DNA was obtained for PCR: predenaturation, 10 min at 95°C; denaturation, 45 s at 95°C, 56°C (methylation), or 45°C (unmethylation) for 45 s; annealing, 45 s at 72°C for a total of 35 cycles; final extension, 72°C for 10 min. The products were subjected to agarose gel electrophoresis, followed by image analysis. The experiment was performed in triplicate.

2.9. Chromatin immunoprecipitation

A Chromatin immunoprecipitation (ChIP) kit (Millipore, USA) was used to collect cells from each group. When the cells reached confluence (70%–80%), 1% formaldehyde was added to fix for 10 min and crosslink the intracellular DNA with the protein. The cells were treated by random fragmentation by sonication (120 W, 2 s on, 5 s off) for 15 cycles. Centrifugation was performed at 4°C (13,000 rpm) with the supernatant been collected and transferred into three tubes, in which positive control antibody RNA polymerase II, negative control antibody IgG, and anti‐DNMT1 (1:100, ab13537) were contained separately. The supernatant was incubated at 4°C overnight. Protein agarose/sepharose was utilized for precipitation of endogenous DNA–protein complexes, and the supernatant was removed after centrifugation, after which nonspecific complexes were washed and cross‐linked overnight at 65°C. DNA fragments were recovered using phenol/chloroform extraction and purification, and enrichment of the TJP2 promoter region was assessed by qRT‐PCR. The experiment was performed in triplicate.

2.10. Establishment of OA models

C57BL/6 mice (male, 8‐week‐old, 2025 g) purchased from SJA Laboratory were housed in pathogen‐free microisolator cages in a room at 22 to 24°C at a 12 h daylight cycle. All mice were free to drink and fodder. All animal experimental procedures were reviewed and approved by the Animal Experimentation Ethics Committee of Loudi Central Hospital (ethical approval number: 202310087). An OA model was established by destabilizing the medial meniscus in mice. Following intraperitoneal injection of sodium pentobarbital (40 mg/kg) to anesthetize the mice, the medial knee joint was exposed by dislocation of the medial and lateral bones. The medial meniscal ligament was then cut carefully. Sham mice were used as controls (n = 10 per group). The mice were successfully modeled and divided into (n = 10 per group): OA (OA modeling treatment only), OA + sh‐NC (OA modeling treatment + silencing negative control), OA + sh‐LASP1 + sh‐NC (OA modeling treatment + silencing LASP1 + silencing negative control), and OA + sh‐LASP1 + sh‐TJP2 (OA modeling treatment + silencing TJP2 + silencing LASP1). The silencing lentivirus and control were purchased from GeneChem. Mice were infected with lentivirus via intra‐articular injection for 2 weeks. The mice were euthanized 8 weeks after modeling, and the articular cartilage and synovial fluid from the medial tibial plateau were collected.

2.11. Histopathologic analysis

After fixation, the samples were cut into 5 mm sections using a microtome, and the sections were stained with hematoxylin and eosin (H&E) and safranin O‐fast green staining according to the operating instructions for assessing the histomorphology of knee joint sections. OA severity was graded by two independent observers using a double‐blind method according to the modified OARSI score (cartilage), with an average score of the two independent observers. Both H&E and Safranin O‐Fast Green images were taken using a Nikon Eclipse 80i microscope.

2.12. Statistical analysis

Statistical analyses were conducted using SPSS software (version 21.0; IBM SPSS Statistics, Chicago, IL). Measurement data are expressed as mean ± standard deviation. One‐way Anlysis of Variance (ANOVA) was used for comparisons among multiple groups, independent sample t‐test for comparisons between groups, and Tukey's for a post hoc test. Repeated measures analysis of variance was used for tumor volume data at different time points, and the Bonferroni post hoc test was used. A p < 0.05 was considered statistically significant.

3. RESULTS

3.1. LASP1 was highly expressed in IL‐1β‐induced OA model of C28/I2 cells, and silencing of LASP1 alleviates IL‐1β‐induced chondrocyte degeneration

CCK‐8 assay and FCM showed that IL‐1β treatment can reduce cell viability and increase cell apoptosis rate versus control group (Figure 1A,B). ELISA measurement showed the expressions of TNF‐α and IL‐6 were markedly enhanced after IL‐1β treatment relative to the control group (Figure 1C). Western blot and qRT‐PCR revealed that the expression levels of MMP9 and MMP13 were markedly increased, but the expression levels of Aggrecan and Collagen II were markedly reduced in cells treated with IL‐1β relative to the control group (Figure 1D,E). These observations suggest that IL‐1β induction successfully constructed an in vitro OA model.

FIGURE 1.

Silencing of LASP1 attenuated IL‐1β‐induced chondrocyte degeneration. (A) Chondrocyte viability measured by cell counting kit‐8 assay; (B) Chondrocyte apoptosis detected by flow cytometry; (C) TNF‐α and IL‐6 expressions detected by ELISA; (D) MMP9, MMP13, Aggrecan, and Collagen II mRNA expressions measured by qRT‐PCR; (E) MMP9, MMP13, Aggrecan and Collagen II protein expressions measured by Western blot; (F) LASP1 mRNA expression measure by qRT‐PCR; (G) LASP1 protein expression measured by Western blot; Data in the figure were measurement data, expressed as mean ± SD; independent sample t‐test was used to compare data between the two groups, one‐way ANOVA was used to compare data among multiple groups, and Tukey's test was performed for post hoc test; * indicates p < 0.05 for comparison of two groups, ** indicates p < 0.01 for comparison of two groups, and *** indicates p < 0.001 for comparison of two groups. LASP1, The LIM and SH3 protein 1.

qRT‐PCR and western blot exhibited that LASP1 expression was higher in cells treated with IL‐1β than cells in the control group (Figure 1F,G). LASP1 expression was tested by western blot after silencing LASP1 expression to determine the role of LASP1 in OA, which showed that LASP1 expression was reduced in the IL‐1β + sh‐LASP1 group compared to the IL‐1β + sh‐NC group (Figure 1F,G). The results of the chondrocyte function tests revealed that compared with the IL‐1β + sh‐NC group, the IL‐1β + sh‐LASP1 group had increased cell viability, decreased apoptosis, decreased expressions of TNF‐α, IL‐6, MMP9, and MMP13, and increased expressions of Aggrecan and Collagen II (Figure 1A–E). The above findings indicated that silencing of LASP1 alleviated IL‐1β‐induced chondrocyte degeneration.

3.2. LASP1 promotes TJP2 promoter methylation by interacting with DNMT1 and downregulating TJP2 in OA models

The STRING database (https://cn.string-db.org/cgi/input.pl?sessionId=4Bvlcg3I4RKk&input_page_show_search=on) showed that LASP1 interacted with DNMT1 and TJP2 (Figure 2A). DNMT1 is a methyltransferase, and TJP2 is decreasingly expressed in OA models, as analyzed with GEO data (Figure 2B–D). Western blot showed that IL‐1β treatment can reduce TJP2 expression compared with that in the control group (Figure 2E). CpG islands were predicted in the promoter region of TJP2 using a bioinformatics tool (http://www.urogene.org/methprimer/; Figure 2F). To examine whether LASP1 affects the expression of TJP2 by regulating the methylation level of TJP2, LASP1 was overexpressed in OA cell models. Detection on LASP1 and TJP2 expressions demonstrated that LASP1 was highly expressed while TJP2 was lowly expressed in the IL‐1β + oe‐LASP1 group compared with the IL‐1β + oe‐NC group (Figure 2G). Methylation‐specific PCR (MSP) demonstrated that the methylation level of the TJP2 promoter region was increased in the IL‐1β group and IL‐1β + oe‐LASP1 group, respectively versus the control group and IL‐1β + oe‐NC group (Figure 2H). ChIP showed that DNMT1 enrichment in the TJP2 promoter region was clearly enhanced in the IL‐1β group and IL‐1β + oe‐LASP1 group, respectively relative to the control group and the IL‐1β + oe‐NC group (Figure 2I). These observations indicate that LASP1 promotes methylation of the TJP2 promoter by interacting with DNMT1, thereby downregulating TJP2 in OA models.

FIGURE 2.

LASP1‐promoted TJP2 promoter methylation by interacting with DNMT1 and down‐regulating TJP2 in osteoarthritis (OA) models. (A) STRING database predicts the relationship between LASP1 and DNMT1, TJP2; (B) OA differential gene clustering plot through Gene Expression Omnibus (GEO) data analysis; (C) OA differential gene volcano map through GEO database analysis; (D) OA differential gene scatter plot; (E) The expression of TJP2 in OA cell models measured by western blot; (F) Bioinformatics website predicts the CpG island of TJP2 promoter region; (G) Methylation level of TJP2 promoter region detected by methylation‐specific PCR; (H) The enrichment of DNMT1 in TJP2 promoter region measured by ChIP; (I) The expressions of LASP1 and TJP2 measured by western blot; Data in the figure were measurement data, expressed as mean ± SD; independent sample t‐test was used to compare data between the two groups, one‐way ANOVA was used to compare data among multiple groups, and Tukey's test was performed for post hoc test; * indicates p < 0.05 for comparison of two groups, ** indicates p < 0.01 for comparison of two groups, and *** indicates p < 0.001 for comparison of two groups. DNMT1, DNA methyltransferase 1; TJP2, tight junction protein; LASP1, The LIM and SH3 protein 1.

3.3. Silencing of LASP1 attenuates IL‐1β‐induced chondrocyte degeneration by promoting TJP2 expression

To explore whether LASP1 affects chondrocyte function by regulating TJP2 expression, TJP2 was overexpressed after silencing LASP1 and chondrocyte function was examined. Western blot detected decreased LASP1 expression and upregulated TJP2 expression in the IL‐1β + sh‐LASP1 + sh‐NC group versus the IL‐1β + sh‐NC + sh‐NC group, while different expression pattern of TJP2 was found in IL‐1β + sh‐LASP1 + sh‐TJP2 group compared to the IL‐1β + sh‐LASP1 + sh‐NC group (Figure 3A). No significance of LASP1 expression was found between IL‐1β + sh‐LASP1 + sh‐TJP2 group and IL‐1β + sh‐LASP1 + sh‐NC group (Figure 3A). CCK‐8 assay and FCM observed that relative to the IL‐1β + sh‐NC + sh‐NC group, cell viability was increased and apoptosis was decreased in the IL‐1β + sh‐LASP1 + sh‐NC group, while different expression pattern was found in IL‐1β + sh‐LASP1 + sh‐TJP2 group compared with the IL‐1β + sh‐LASP1 + sh‐NC group (Figure 3B,C). Further observations exhibited that compared with the IL‐1β + sh‐NC + sh‐NC group, the expressions of TNF‐α, IL‐6, MMP9, and MMP13 were decreased, and the expressions of Aggrecan and Collagen II were enhanced in the IL‐1β + sh‐LASP1 + sh‐NC group, which was different to the observations in IL‐1β + sh‐LASP1 + sh‐TJP2 group when compared with the IL‐1β + sh‐LASP1 + sh‐NC group (Figure 3D–F). The above observations suggested that silencing of LASP1 alleviated IL‐1β‐induced chondrocyte degeneration by promoting TJP2 expression.

FIGURE 3.

Silencing of LASP1 attenuated IL‐1β‐induced chondrocyte degeneration by promoting TJP2 expression. (A) The expressions of LASP1 and TJP2 in chondrocytes measured by western blot; (B) chondrocyte viability detected by cell counting kit‐8 assay; (C) chondrocyte apoptosis detected by flow cytometry; (D) The expressions of TNF‐α and IL‐6 detected by ELISA; (E) The mRNA expressions of MMP9, MMP13, Aggrecan, and Collagen II measured by qRT‐PCR; (F) The protein expressions of MMP9, MMP13, Aggrecan, and Collagen II measured by Western blot; Data in the figure were measurement data, expressed as mean ± SD; independent sample t‐test was used to compare data between the two groups, one‐way ANOVA was used to compare data among multiple groups, and Tukey's test was performed for post hoc test; * indicates p < 0.05 for comparison of two groups, ** indicates p < 0.01 for comparison of two groups, and *** indicates p < 0.001 for comparison of two groups. LASP1, The LIM and SH3 protein 1; TJP2, tight junction protein.

3.4. Upregulation of LASP1 and downregulation of TJP2 in OA mouse models

To confirm the effects of LASP1 and TJP2 on OA at the organismal level, a mouse model of OA was constructed. ²⁴ Safranin O‐Fast Green staining was performed to obtain the OARSI score, and H&E staining was used to detect joint histopathology. The OA group had an increased OARSI score, calcified cartilage thickening, proteoglycan loss, destruction of articular cartilage surface integrity, loss of a large number of chondrocytes, and disarrangement compared with sham group (Figure 4A,B). ELISA showed that TNF‐α, IL‐6, and IL‐1β expressions were higher in the OA group than that in the sham group (Figure 4C), suggesting OA mouse models were successfully established. Western blot detected increased LASP1 expression and reduced TJP2 expression in the OA group versus the sham group (Figure 4D). These observations showed that LASP1 was upregulated, whereas TJP2 was downregulated, in OA mouse models.

FIGURE 4.

LASP1 was highly expressed and TJP2 was lowly expressed in OA mouse models. (A) OARSI score of joint tissues of mice measured by Safranin O‐Fast Green staining; (B) The pathological conditions of joint tissues evaluated by hematoxylin and eosin staining; C: The expressions of TNF‐α, IL‐6 and IL‐1β in joint tissues of mice detected by ELISA; D: The expressions of LASP1 and TJP2 in joint tissues of mice measured by western blot; Data in the figure were measurement data, expressed as mean ± SD; independent sample t‐test was used to compare data between the two groups, one‐way ANOVA was used to compare data among multiple groups, and Tukey's test was performed for post hoc test; * indicates p < 0.05 for comparison of two groups, ** indicates p < 0.01 for comparison of two groups, and *** indicates p < 0.001 for comparison of two groups. LASP1, The LIM and SH3 protein 1; OA, osteoarthritis; TJP2, tight junction protein.

3.5. Silencing of LASP1 promotes TJP2 expression to alleviate articular cartilage injury in OA mice

To observe the effects of LASP1 and TJP2 on articular cartilage injury in OA mice, TJP2 and LASP1 were silenced and the joint conditions of the mice in each group were determined. Western blot showed that relative to the OA + sh‐NC + sh‐NC group, LASP1 expression was decreased and TJP2 expression was enhanced in the OA + sh‐LASP1 + sh‐NC group. Compared with the OA + sh‐LASP1 + sh‐NC group, LASP1 expression was not significantly different but TJP2 expression was reduced in the OA + sh‐LASP1 + sh‐TJP2 group (Figure 5A). Safranin O‐Fast Green staining and H&E staining exhibited that the OA + sh‐LASP1 + sh‐NC group had decreased OARSI score, decreased calcified cartilage, and increased proteoglycan (vs. the OA + sh‐NC + sh‐NC group) and the OA + sh‐LASP1 + sh‐TJP2 group had increased OARSI score, increased calcified cartilage, and decreased proteoglycan (vs. the OA + sh‐LASP1 + sh‐NC group; Figure 5B,C). ELISA showed that TNF‐α, IL‐1β, and IL‐6 expression levels were decreased in the OA + sh‐LASP1 + sh‐NC group and increased in the OA + sh‐LASP1 + sh‐TJP2 group versus the OA + sh‐NC + sh‐NC group and the OA + sh‐LASP1 + sh‐NC group, respectively (Figure 5D). These observations showed that LASP1 silencing promotes TJP2 expression and alleviates articular cartilage injury in OA mice.

FIGURE 5.

Silencing of LASP1 promoted TJP2 expression to alleviate articular cartilage injury in osteoarthritis (OA) mice. (A) The expressions of LASP1 and TJP2 measured by western blot; (B) OARSI score of joint tissues of mice measured by Safranin O‐Fast Green staining; (C) The pathological conditions of joint tissues evaluated by hematoxylin and eosin staining; (D) The expressions of TNF‐α, IL‐6, and IL‐1β in synovial tissue fluid detected by ELISA; Data in the figure were measurement data, expressed as mean ± SD; independent sample t‐test was used to compare data between the two groups, one‐way ANOVA was used to compare data among multiple groups, and Tukey's test was performed for post hoc test (n = 10); * indicates p < 0.05 compared with the OA + sh‐NC + sh‐NC group; # indicates p < 0.05 compared with the OA + sh‐LASP1 + sh‐NC. LASP1, The LIM and SH3 protein 1; TJP2, tight junction protein.

4. DISCUSSION

OA, characterized by cartilage degeneration, is a multifactorial and complex disorder in which genetic susceptibility is closely related to its occurrence. ²⁵ Genetic, proteomic, epigenetic, and transcriptomic analyses have exerted crucial effects on the identification of related pathways that are dysregulated during the progressive course of OA. Thus, the modification of DNA methylation is a potential treatment strategy for OA. In this study, we investigated whether LASP1 participates in OA by regulating TJP2 methylation via DNMT1.

A previous study found that LASP1‐regulated fibroblast transformation and adherens junction dynamics in destructive arthritis. ¹² The observations in this study indicated that LASP1 was upregulated in IL‐1β‐induced OA model of C28/I2 cells, and silencing of LASP1 alleviated IL‐1β‐induced chondrocyte degeneration. Similarly, Jin et al. ²⁶ observed that the expression of LASP1 was higher in osteosarcoma tissues than in normal tissues. As previously reported, Joos et al. ²⁷ also found that LASP1 is involved in cartilage destruction in OA. The STRING database showed that LASP1 interacts with DNMT1 and TJP2. DNMT1 is a methyltransferase, and TJP2 is expressed at low levels in OA models, as analyzed using GEO data. In this study, we found that LASP1 promoted the methylation of the TJP2 promoter by interacting with DNMT1, thereby downregulating TJP2 in OA models. To explore whether LASP1 affects chondrocyte function by regulating TJP2 expression, TJP2 was overexpressed after silencing LASP1 and chondrocyte function was assessed. Further experiments demonstrated that silencing of LASP1 alleviated IL‐1β‐induced chondrocyte degeneration by promoting TJP2 expression. Mammalian DNA methylation patterns are regulated by at least three DNMTs: DNMT1 maintains the methylation status, while DNMT3A and DNMT3B regulate de novo DNA methylation. ²⁸ Consistent with our findings, abundant DNMT1 has been found in fibroblast‐like synoviocytes in rheumatoid arthritis and OA. ¹⁵ TJP2 is a protein coding gene and identified diseases related with TJP2 include cholestasis, congenital heart defect, and allergic rhinitis. ²⁹ , ³⁰ , ³¹ The tight junction protein ZO‐2 is encoded by TJP2 and is associated with inflammation and systemic autoimmune responses. ³² These findings provide supporting evidence for the conclusions of this study. To confirm the effects of LASP1 and TJP2 on OA at the animal level, a mouse model of OA was established. We found that LASP1 was upregulated, whereas TJP2 was downregulated in OA mouse models. Similarly, silencing LASP1 promotes TJP2 expression to alleviate articular cartilage injury in mice with OA.

Although our findings provide evidence and treatment target for OA, some limitations still need to be addressed in subsequent studies to support our conclusion. First, it is necessary to explore potential genes other than TJP2, which may provide a more complete understanding of the mechanism of DNA methylation in OA. Additionally, as LASP1 has not been well investigated in OA, future studies should focus on the mechanisms underlying its crosstalk with other OA‐related signaling pathways.

In summary, we found that silencing LASP1 inhibited the methylation of the TJP2 promoter region by interacting with DNMT1, which promoted the expression of TJP2 and alleviated articular cartilage damage in OA mice.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflict of interest.

Ren L, Cheng S‐G, Kang P‐C, Li T‐F, Li X, Xiao J‐Z, et al. Silenced LASP1 interacts with DNMT1 to promote TJP2 expression and attenuate articular cartilage injury in mice by suppressing TJP2 methylation. Kaohsiung J Med Sci. 2023;39(11):1096–1105. 10.1002/kjm2.12738