Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2023 May 3;39(8):811–823. doi: 10.1002/kjm2.12691

Astragaloside IV promotes keratinocyte proliferation and migration through upregulating lncRNA H19 recruited ILF3 to enhance the stability of CDK4 mRNA

Dan‐Dan Wang 1,2, Li‐Ze Zhang 2, Cheng‐Jian Pang 2, Jian‐Zhou Ye 1,✉
PMCID: PMC11895983  PMID: 37132584

Abstract

Skin is the first line of the body to resist pathogen invasion. A potentially fatal infection may result from problems with wound healing. Small molecule drugs like astragaloside IV (AS‐IV) show pro‐healing activities, but the mechanisms are not fully understood. Using real‐time quantitative PCR and a western blot assay, the amount of gene expression was evaluated. The proliferation and migration of keratinocytes were determined by MTS and wound healing assay, respectively. The binding of lncRNA H19 to RBP protein ILF3 and the binding of ILF3 protein to CDK4 mRNA were confirmed by RNA immunoprecipitation. Treatment with AS‐IV enhanced the expression of lncRNA H19, ILF3, and CDK4 and improved the proliferation and migration of keratinocytes HaCaT. Additionally, apoptosis of keratinocytes was attenuated by AS‐IV. Further studies showed that both lncRNA H19 and ILF3 were important for AS‐IV‐mediated keratinocyte growth and migration. In addition, lncRNA H19 recruited ILF3 to increase CDK4 mRNA level and enhanced cell proliferation. We discovered a lncRNA H19/ILF3/CDK4 axis that is activated by AS‐IV to promote keratinocyte migration and proliferation. These results elucidate the mechanism of action of AS‐IV and justify its application in further application in wound healing treatment.

Keywords: astragaloside IV, ILF3, lncRNA H19, wound healing

1. INTRODUCTION

The skin is the body's first line of defense against the outside world and is crucial for maintaining physiological balance and fighting infection. 1 Skin healing is a complicated and strictly regulated process. Wound healing is generally divided into four phases: hemostasis, inflammation, proliferation, and maturation. 2 Sophisticated collaborations between various cells, including red blood cell, immune cell, fibroblast, endothelial, epithelial, and keratinocyte, is essential for the success of the wound repair process. 3 Particularly, keratinocytes play vital roles in epithelialization, an important component of the proliferation phase. 4 Keratinocytes migrate to and proliferate at the wound edge to support the healing process. 4 Drugs that enhance keratinocytes proliferation and migration therefore may facilitate wound healing. Astragaloside IV (AS‐IV) is the main water extract of Astragalus membranaceus, which promoted the proliferation and migration of keratinocytes and improved wound repair. However, the mechanisms through which AS‐IV controls proliferation and migration remain largely unknown.

Long noncoding RNAs (lncRNA) are a type of RNA with lengths exceeding 200 nucleotides and do not translate into proteins. However, lncRNAs possess vital physiological functions in the regulation of gene transcription, splicing, translation, and epigenetic modification. 5 LncRNA H19 was first identified as an oncofetal transcript and plays an essential role in tumorigenesis. 6 Additionally, lncRNA H19 is also involved in a variety of physiological processes and diseases including fibrosis, inflammation, aging, and cardiac diseases. 7 , 8 The roles of lncRNA H19 in controlling wound healing are also reported. 9 , 10 Qian demonstrated that lncRNA H19 in adipose mesenchymal stem cell‐derived exosomes stimulate the miR‐19b/SOX9 axis in skin fibroblast and accelerates skin wound healing, 9 while another study reveal that exosomal lncRNA H19 promotes the miR‐152‐3p/PTEN axis to facilitate wound healing in diabetic foot ulcers. 10 Previous studies discovered that AS‐IV induces the expression of lncRNA H19, 11 but their interaction in keratinocyte and role in wound healing is not known.

Interleukin enhancer‐binding factor (ILF3) is a double‐stranded RNA binding protein that controls many RNA metabolism processes like improving the stability of RNAs. 12 Vrakas et al. reported the role of ILF3 in stabilizing the transcripts of vascular endothelial growth factor, CXC motif chemokine ligand 1, and interleukin‐8 in human coronary artery endothelial cells to promote angiogenesis. 13 The role of ILF3 in wound healing has not been examined, but studies have revealed that ILF3 mediates cytokine‐induced angiogenesis, a key process in wound healing. Although the direct binding between them was predicted by the bioinformatic analysis, it is unknown if ILF3 regulates lncRNA H19.

Cyclin‐dependent kinase 4 (CDK4) is a key checkpoint for cell cycle regulation. 14 Dysregulation of CDK4 is prevalent in cancers and often drives the hyperproliferation of cancer cells. 15 Proliferation of keratinocytes is important for wound repair. CDK4 upregulation is related to increased cell proliferation of human keratinocyte HaCaT, which may contribute to the accelerated wound healing process. 16 The regulation of CDK4 by AS‐IV has been reported in the literature. 17 Until now, it is not known how AS‐IV controls the expression of CDK4 in keratinocytes and whether ILF3 is involved in this process.

Since the migration and proliferation of keratinocytes are important for the wound healing process, we aimed to interrogate the effects of AS‐IV in the regulation of keratinocytes growth and migration using the human keratinocytes HaCaT cell line. We postulated that up‐regulation of lncRNA H19 in combination with ILF3 after AS‐IV treatment of keratinocytes may contribute to CDK4 expression and facilitate keratinocyte migration and proliferation.

2. MATERIALS AND METHODS

2.1. Cell culture

Human epidermal keratinocyte HaCaT (Cat. #PCS‐200‐011) was purchased from American Type Culture Collection. Cells were cultured in high‐glucose Dulbecco's modified Eagle's medium (Gibco) containing 10% fetal bovine serum (Gibco), 100 units/mL penicillin, and 100 μg/mL streptomycin (Cat. #10378016, Gibco) at 37°C for 48 h in an atmosphere containing 5% CO2. AS‐IV was purchased from Sigma Aldrich (Y0001171). AS‐IV was dissolved in dimethyl sulfoxide (DMSO), and HaCaT was treated with various concentrations of AS‐IV for 48 h.

2.2. Plasmid construction and cell transfection

shRNA for lncRNA H19 (sh‐H19‐1, CTTCTGAATTTAATTTGCACT); (sh‐H19‐2, GGAGAGTTAGCAAAGGTGACA); (sh‐H19‐3, CCTCTAGCTTGGAAATGAATA);ILF3 (sh‐ILF3‐1, CCTTCCAAGATGCCCAAGAAA); (sh‐ILF3‐2, CCAGAGGACGACAGTAAAGAA); (sh‐ILF3‐3, GCCAGATGGTTCTGGCATTTA); CDK4 (sh‐CDK4‐1,_GAAATTGGTGTCGGTGCCTAT); (sh‐CDK4‐2, AGGACATATCTGGACAAGGCA); (sh‐CDK4‐3, CATGCCAATTGCATCGTTCAC), were synthesized by General Biosystems (Anhui, China). Sequences for lncRNA H19, ILF3, and CDK4 were cloned into shRNA expressing pLKO.1‐puro vector (Addgene). Cells were seeded in a 6‐well plate and cultured overnight before transfection. A total of 2.5 μg plasmid per well was transfected into cells by Lipofectamine 3000 (Cat. #L3000008, Invitrogen). Cells were cultured for another 48 h before further experiments were conducted.

2.3. RNA immunoprecipitation

RNA immunoprecipitation (RIP) was conducted following a widely used RIP protocol. 18 Briefly, cells were lysed in the polysome lysis buffer (20 mM Tris–HCl pH 7.5, 50 mM KCl, 10 mM MgCl2, 100 μg/mL cycloheximide, 1 mM DTT, 0.2 mg/mL Heparin, 1 μL/mL Rnasin, 1 mM phenylmethylsulfonyl fluoride, and complete protease inhibitor) and incubated with α‐IFL3 antibody (Cat. #19887‐1‐AP, Proteintech) conjugated magnetic beads (Cat. #88845, Thermo Scientific). The beads were gathered and washed, followed by RNA purification from the RNA‐protein complex. RNA‐protein complex was treated with proteinase K to digest proteins, and RNA was extracted by phenol: chloroform: isoamyl alcohol solution. RNA was dissolved in RNase‐free H2O and detected by RT‐qPCR. The experiment was repeated at least three times. Data were shown as mean ± SD. For statistical analysis, the one‐way ANOVA test and the subsequent post hoc test were utilized.

2.4. RNA pull‐down

For RNA pull‐down assay, cells were lysed in hypotonic buffer and homogenized, followed by incubation with biotinylated lncRNA H19‐sense RNA‐, biotinylated control antisense RNA‐, or biotinylated NC‐conjugated magnetic beads in the presence of RNase inhibitor. The beads were isolated and washed to eliminate the unspecific binding. The RNA‐protein complex was eluted and dissolved in Laemmli buffer. The RNA binding proteins were analyzed by western blotting assay.

2.5. MTS assay

Cell proliferation was assessed using CellTiter 96 AQueous One Solution Cell Proliferation Assay (MTS) Kit (Cat. #G3582, Promega) following the manufacturer's instructions. Briefly, cells were cultured and treated in a 96‐well plate. At the endpoint of treatment, 100 μL fresh medium containing 20 μL MTS reagent was mixed and introduced into each well. Cells were further cultured for 1.5–2 h and the absorbance at 490 nm (OD490) was recorded using a microplate reader. OD490 value from medium‐alone wells was the background and was subtracted. OD490 is directly proportional to the number of living cells in the culture. The experiment was repeated at least three times. Data were depicted as mean ± SD. For statistical analysis, the one‐way ANOVA test and the subsequent post hoc test were utilized.

2.6. Flow cytometry assay

Apoptosis was determined by flow cytometry using Annexin V antibody and propidium iodide (PI). Cells were treated with AS‐IV for 72 h and were trypsinized, followed by washes with ice‐cold PBS, the single cell suspension was flowed through a 70 μm cell strainer and then stained with Annexin V FITC (Cat. #ANNEX300F, Bio‐Rad) and ReadiDrop PI (Cat. #1351101, Bio‐Rad) for 1 h at 4°C protect from light. Apoptotic cells were identified with Beckman Coulter Gallios Flow Cytometer and examined by FlowJo software (FlowJo, Ashland). The experiment was repeated at least three times. Data were represented as Mean ± SD. A one‐way ANOVA test with the following post hoc test was employed for statistical analysis.

2.7. Wound healing assay

Cells were seeded in a 12‐well plate and treated for the desired time to reach 100% confluence. The single layer of the cell was scraped by a 1 mm pipette tip and the detached cells were washed out with PBS, followed by replenishing with 1.5 mL fresh medium. Cells were imaged at 0 h under a microscope and cultured for an additional 48 h to image again. The migration rate was calculated as previously described. 19

2.8. Transwell assay

The transwell assay was conducted as previously described. 20 A total of 50,000 cells were suspended in 0.5 mL serum‐free medium containing 0.1% bovine serum albumin and seed in the top chambers of the transwell plates, and 0.5 mL fresh medium was introduced into the well as an attractant. Cells were incubated for 24 h. The chambers were washed with PBS, cells were fixed in 4% paraformaldehyde for 10 min and stained in 0.2% crystal violet solution for additional 5 min. A cotton swab was used to carefully remove the cells from the chambers' inside, and an inverted microscope was used to count and picture the cells on the exterior.

2.9. Western blot analysis

Cellular protein was extracted using RIPA buffer containing protease inhibitor cocktail (Cat. #11697498001, Roche), and the concentration of total proteins was determined using Bradford assay. Proteins weighing a total of 25 μg were loaded, separated by 10% SDS‐PAGE, and then transferred to polyvinylidene difluoride membrane. The membrane was blocked in TBST (2.4 g/L Tris base, 8.8 g/L NaCl, 1 mL/L Tween 20, pH 7.6) containing 5% BSA (m/v) for 1 h at room temperature and incubated overnight at 4°C with showed primary antibody. After three washes with TBST, horseradish peroxidase (HRP)‐conjugated secondary antibodies were incubated with the blots for 1 h at room temperature. After additional three washes with TBST, enhanced chemiluminescence kits (Cat. #1705060S, BIO‐RAD) were used for blot development. Blots were visualized and captured by a ChemicDoc XRS system (Bio‐Rad), and semi‐quantification was conducted using ImageJ software. Following antibodies were used for the western blotting experiment: ILF3 (Cat. #PA5‐36996, Thermo Fisher Scientific), CDK4 (Cat. #12790, Cell Signaling Technology), GAPDH (Cat. #5174, Cell Signaling Technology).

2.10. RNA isolation, reverse transcription PCR, and real‐time quantitative PCR

Total RNA was extracted by RNeasy Mini Kit (Cat. No. 74104, QIAGEN) following the manufacturer's instructions. Reverse transcription PCR was conducted immediately utilizing High‐Capacity cDNA Reverse Transcription Kit (Cat. #4368814, Applied Biosystems). qPCR was carried out using SsoAdvanced Universal SYBR Green Supermix (Cat. #1725270, BIO‐RAD) as follows: 94°C for 10 min, followed by 40 cycles of 94°C for 15 s, 60°C for 1 min. Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as the reference gene. The experiment was repeated at least three times. Data were shown as mean ± SD. A one‐way ANOVA test with the following post hoc test was used for statistical analysis. The primers for individual genes were listed below:

LncRNA H19‐F: 5′‐ATCGGTGCCTCAGCGTTCGG‐3′.

LncRNA H19‐R: 5′‐CTGTCCTCGCCGTCACACCG‐3′.

ILF3‐F: 5′‐AGCATTCTTCCGTTTATCCAACA‐3′.

ILF3‐R: 5′‐GCTCGTCTATCCAGTCGGAC‐3′.

CDK4‐F: 5′‐GGGGACCTAGAGCAACTTACT‐3′.

CDK4‐R: 5′‐CAGCGCAGTCCTTCCAAAT‐3′.

GAPDH‐F: 5′‐TGTGGGCATCAATGGATTTGG‐3′.

GAPDH‐R: 5′‐ACACCATGTATTCCGGGTCAAT‐3′.

2.11. Statistical analysis

The experiment was repeated at least three times. Data were presented as mean ± SD. A one‐way ANOVA test with the following post hoc test was used for statistical analysis with GraphPad Prism software (GraphPad Software Inc., San Diego, CA). P < 0.05 is considered statistically significant.

3. RESULTS

3.1. AS‐IV promotes the proliferation and migration of keratinocyte, and upregulates the expression of lncRNA H19, ILF3, and CDK4

To evaluate the effect of AS‐IV on the growth of keratinocytes, HaCaT was treated with various concentrations of AS‐IV (0, 2.5, 25, and 50 μM). AS‐IV induced the proliferation of keratinocytes HaCaT, and the cells treated with 25 μM revealed the most growth‐promoting activity (Figure 1A). AS‐IV also significantly suppressed the apoptosis of keratinocytes (Figure 1B). Furthermore, AS‐IV promoted the migration of keratinocytes, as shown by both the wound healing assay and trans‐well assay (Figure 1C,D). We further analyzed the expression of lncRNA H19, ILF3, and CDK4. AS‐IV treatment upregulated the RNA levels of lncRNA H19, ILF3, and CDK4 in HaCaT cells (Figure 1E). Similarly, the protein levels of ILF3 and CDK4 were increased (Figure 1F). These findings demonstrated that AS‐IV promoted the proliferation and migration of keratinocytes, and improved the expression of lncRNA H19, ILF3, and CDK4.

FIGURE 1.

FIGURE 1

Open in a new tab

Astragaloside‐IV (AS‐IV) promotes the proliferation and migration of keratinocytes and upregulates the expression of lncRNA H19, ILF3, and CDK4. HaCaT cells were treated with various concentrations of AS‐IV (0, 2.5, 25, and 50 μM) for 48 h. (A) By using the MTS assay, the proliferation of keratinocyte HaCaT treated with AS‐IV was assessed. (B) Apoptosis of HaCaT stained with PI and Annexin V was determined by flow cytometry. (C,D) Wound healing test and transwell assay was used to measure the migration of AS‐IV treated HaCaT cells. (E) The expression levels of lncRNA H19, ILF3, and CDK4 in AS‐IV treated HaCaT cells were determined by qPCR. (F) The protein levels of ILF3, and CDK4 in AS‐IV treated HaCaT cells were measured by a western blotting assay. Data were shown as mean ± SD. All experiments were repeated three times independently. One‐way ANOVA with the Bonferroni post hoc test was used to analyze statistical significance. *P < 0.05, **P < 0.01, ***P < 0.001.

3.2. LncRNA H19 is essential for AS‐IV‐induced keratinocytes proliferation and migration

To interrogate the role of lncRNA H19 in keratinocytes growth and migration induced by AS‐IV, the expression of lncRNA H19 was inhibited by three various shRNA targeting lncRNA H19 in HaCaT cells (Figure 2A). Among them, sh‐lncRNA H19‐2 showed the most potent knockdown efficiency (Figure 2A). In the presence of sh‐lncRNA H19, AS‐IV could not induce lncRNA H19 (Figure 2A). Sh‐lncRNA H19 inhibited the proliferation of cells stimulated by AS‐IV (Figure 2B). sh‐lncRNA H19 also inhibited the inhibitory effect of AS‐IV on keratinocyte apoptosis (Figure 2C). Moreover, after being exposed to AS‐IV, sh‐lncRNA H19 dramatically reduced the migratory activity of keratinocytes (Figure 2D,E). All of these findings showed that lncRNA H19 was necessary for AS‐IV's pro‐migration and pro‐proliferation functions in keratinocytes.

FIGURE 2.

FIGURE 2

Open in a new tab

LncRNA H19 is essential for astragaloside IV (AS‐IV)‐induced keratinocyte proliferation and migration. Sh‐NC or sh‐lncRNA H19 was expressed in keratinocytes HaCaT cells. (A) The expression level of lncRNA H19 in cells treated with or without AS‐IV was determined by qPCR. (B) MTS assay was used to measure the proliferation of keratinocyte HaCaT cells that had been treated with AS‐IV. (C) Apoptosis of HaCaT cells treated with AS‐IV was determined by flow cytometry. (D,E) Transwell and wound healing assays were used to measure the migration of AS‐IV‐treated HaCaT cells. Data were shown as mean ± SD. All experiments were repeated three times independently. One‐way ANOVA with the Bonferroni post hoc test was used to analyze statistical significance. *P < 0.05, **P < 0.01, ***P < 0.001.

3.3. sh‐ILF3 attenuates AS‐IV‐induced proliferation and migration of keratinocytes

To examine the function of AS‐IV‐induced ILF3 on keratinocytes growth and migration, we suppressed the expression of ILF3 with ILF3‐targeting shRNAs, of which sh‐ILF3‐1 revealed the highest knockdown efficacy (Figure 3A). In the absence of sh‐ILF3, AS‐IV‐induced ILF3‐expression in was inhibited (Figure 3B). The proliferative effect of AS‐IV was reversed by sh‐ILF3 in HaCaT (Figure 3C). The inhibitory ability of apoptosis and pro‐migration activity of AS‐IV diminished in cells transfected with a sh‐ILF3 plasmid (Figure 3D‐F). Further examination of the expression of CDK4 revealed that compared with sh‐NC cells, sh‐ILF3 inhibited the induction of ILF3 and CDK4 by AS‐IV (Figure 3G). Our findings demonstrated that ILF3 was required for AS‐IV‐mediated keratinocyte proliferation and migration.

FIGURE 3.

FIGURE 3

Open in a new tab

Loss of ILF3 attenuates astragaloside‐IV (AS‐IV)‐induced proliferation and migration of keratinocytes. Sh‐NC or sh‐ILF3 was expressed in keratinocytes HaCaT cells. (A‐B) The expression level of lncRNA H19 in cells treated with or without AS‐IV was measured by qPCR. (C) The proliferation of keratinocyte HaCaT cells treated with AS‐IV was determined by MTS assay. (D) Apoptosis of HaCaT cells treated with AS‐IV was determined by flow cytometry. (E,F) Transwell assay and wound healing assay were used to measure the migration of AS‐IV treated HaCaT cells. (G) The expression level of CDK4 in keratinocytes treated with AS‐IV was determined by qPCR. Data were presented as mean ± SD. All experiments were repeated three times independently. One‐way ANOVA with the Bonferroni post hoc test was used to examine statistical significance. *P < 0.05, **P < 0.01, ***P < 0.001.

3.4. LncRNA H19 interacts with ILF3 to suppress CDK4 expression

Both lncRNA H19 and ILF3 were induced by AS‐IV to improve keratinocytes growth and migration, we next investigate the relationship between lncRNA H19 and ILF3. The mRNA and protein levels of ILF3, as well as CDK4, were reduced in HaCaT cells transfected sh‐lncRNA H19 (Figure 4A). Potential interactions between ILF3 and lncRNA H19 and between ILF3 and CDK4 were predicted by the biology website Starbase (https://starbase.sysu.edu.cn/) (Figure 4B), which was further verified by RIP assay and RNA pull‐down (Figure 4C). In addition, ILF3 interacted with CDK4 mRNA (Figure 4D).

FIGURE 4.

FIGURE 4

Open in a new tab

LncRNA H19 interacts with ILF3 to suppress CDK4 expression. (A) The expression level of ILF3 and CDK4 in keratinocytes expressing sh‐NC or sh‐lncRNA H19 was determined by qPCR. (B) Potential interactions between ILF3 and lncRNA H19 and between ILF3 and CDK4 were predicted by the biology website Starbase. The interaction between lncRNA H19 and ILF3 (C) or ILF3 and CDK4 mRNA (D) were determined by RIP assay and RNA pull down. Data were presented as mean ± SD. All experiments were repeated three times independently. One‐way ANOVA with the Bonferroni post hoc test was used to analyze statistical significance. **P < 0.01, ***P < 0.001.

3.5. AS‐IV recruited ILF3 to stabilize CDK4 mRNA by up‐regulating lncRNA H19 and promote wound healing

The most ILF3 protein was found in cells transfected with oe‐ILF3‐2, which was used in the further investigations (Figure 5A). In the presence of sh‐lncRNA H19, overexpression of ILF3 could up‐regulate ILF3 and CDK4 expression but did not affect lncRNA H19 expression (Figure 5B). Sh‐lncRNA H19 could decrease the proliferation rate of AS‐IV‐induced HaCaT (Figure 5C). However overexpression of ILF3 was able to counteract that impact and allow HaCaT to proliferate (Figure 5C). The AS‐IV inhibited apoptosis of HaCaT was reversed by sh‐lncRNA H19, and overexpression of ILF3 neutralized the promotion of apoptosis by knockdown of lncRNA H19 alone (Figure 5D). However, sh‐lncRNA H19 reduced the effect of AS‐IV on the enhancement of keratinoytes migration, and overexpression of ILF3 reversed the inhibition of keratinocytes migration by knockdown  (Figure 5E,F).

FIGURE 5.

FIGURE 5

Open in a new tab

Overexpression of ILF3 enhances the pro‐growth and ‐migration effect of astragaloside‐IV (AS‐IV) in a lncRNA H19‐dependent manner. Sh‐NC or sh‐lncRNA H19 was expressed in keratinocytes HaCaT cells. Additionally, ILF3 was overexpressed. Keratinocytes were treated with AS‐IV. (A,B) The expression level of lncRNA H19, and ILF3 was measured by qPCR, and CDK4 measured by qPCR and western blot. (C) The proliferation of keratinocytes was examined by MTS assay. (D) Apoptosis of HaCaT cells was determined by flow cytometry. (E,F) The transwell assay and wound healing test were used to analyze the migration of HaCaT cells. Data were presented as mean ± SD. All experiments were repeated three times independently. One‐way ANOVA with the Bonferroni post hoc test was used to examine statistical significance. *P < 0.05, **P < 0.01, ***P < 0.001.

3.6. Loss of CDK4 attenuates the effects of AS‐IV in promoting cell proliferation and migration

AS‐IV improved the expression of CDK4, which was repressed in the presence of CDK4‐targeting shRNAs, of which sh‐CDK4‐1 revealed the best knockdown efficiency, at both mRNA and protein levels (Figure 6A). Cell proliferation and apoptosis assay showed the pro‐growth and anti‐apoptosis activities of AS‐IV, while sh‐CDK4 attenuated the effects of AS‐IV (Figure 6B,C). AS‐IV enhanced migration of keratinocytes was also inhibited by sh‐CDK4 (Figure 6D,E). These data revealed that CDK4 is important for AS‐IV‐mediated keratinocyte proliferation and migration.

FIGURE 6.

FIGURE 6

Open in a new tab

Loss of CDK4 attenuates the effects of astragaloside‐IV (AS‐IV) in promoting cell proliferation and migration. sh‐NC or CDK4 was expressed in keratinocytes HaCaT cells, keratinocytes were treated with AS‐IV. (A,B) The expression level of CDK4 was determined by qPCR and western blot. (C) The proliferation of keratinocytes was determined by MTS assay. (D, E) The migration of HaCaT cells was determined by wound healing assay and transwell assay. One‐way ANOVA with Bonferroni post hoc test was used to analyze statistical significance. *P < 0.05, **P < 0.01, ***P < 0.001.

4. DISCUSSION

The proliferation and migration of keratinocytes are important for the effective wound‐healing process. By examining the effects of AS‐IV on keratinocytes, we discovered that AS‐IV promotes keratinocyte proliferation and migration through lncRNA H19/ILF3/CDK4 axis and may accelerate wound repair. In terms of the mechanism, we discovered that ILF3 directly coupled to lncRNA H19 and CDK4 mRNA, stabilizing CDK4 mRNA and raising CDK4 protein levels. This work offered fresh insight into the management of wound healing while elaborating the mechanism of action of AS‐IV in boosting keratinocyte proliferation and migration.

The previous study demonstrated that AS‐IV accelerates wound repair 21 and probably through its growth stimulatory activity. 22 AS‐IV also promotes the proliferation and migration and suppresses apoptosis of keratinocytes, an essential component for the wound healing process, under stress conditions. 23 , 24 However, it is unclear if AS‐IV can cause normal keratinocytes to proliferate and migrate, as well as the underlying mechanisms. Here we found that AS‐IV could improve the proliferation and migration of human keratinocytes HaCaT, although it showed a low extent of cytotoxicity at high concentrations, which is also observed by other researchers. 25 , 26 To interrogate the mechanism of action of AS‐IV in keratinocytes, we revealed that lncRNA H19 is induced by AS‐IV in keratinocytes. LncRNA H19, particularly from stem cell‐derived exosomes, facilitates the wound healing process. 9 , 10 , 27 , 28 Previously Li et al. reported that lncRNA H19 regulates the differentiation of keratinocytes. 29 Furthermore, our findings showed that lncRNA H19 is necessary for AS‐IV‐induced keratinocyte proliferation and migration. Collectively, our study demonstrated that AS‐IV‐dependent growth and migration stimulatory activity is mediated by lncRNA H19.

LncRNA H19 participates in a variety of biological processes, and its target in AS‐IV treated keratinocytes remains unknown. Using bioinformatic analysis, we discovered that ILF3 is a potential binding partner of lncRNA H19. ILF3 is a double‐stranded RNA‐binding protein that has versatile roles in controlling gene transcription, mRNA stabilization, and translation. 12 For example, Ilf3 −/− mice died within 12 h of birth, partially due to loss of mRNA stabilization of important genes. 30 To accelerate the development of colorectal cancer, ILF3 also controlled the stability of genes in the serine‐glycine‐one‐carbon pathway. 31 Our further RIP experiments verified the direct interaction between ILF3 and lncRNA H19 in keratinocytes. In addition, AS‐IV treatment induces the expression of ILF3 as well, and loss of lncRNA H19 results in the downregulation of ILF3. In the current study, lncRNA H19 is directly bound to ILF3, which should not affect the expression of ILF3. On the other hand, lncRNA H19 may regulate ILF3 expression through various mechanism(s). LncRNA H19 can serve as competing endogenous RNA to regulate gene expression. 32 , 33 LncRNA H19 also participated in gene regulation through different microRNAs. 34 Furthermore, lncRNA H19 is a functional partner of methyl‐CpG‐binding domain protein 1 MBD1 that controls gene transcription. 35 The proliferation and migration of keratinocytes are attenuated in the absence of ILF3. More importantly, overexpression of ILF3 could partially rescue sh‐lncRNA H19 inhibited cell growth and migration ability. Although ILF3 has not yet been linked to wound healing, a study found that it supports cytokine‐induced angiogenesis. 13 Our research found the role of ILF3 in mediating keratinocyte migration and proliferation and may contribute to wound healing. Finally, we demonstrated that ILF3 binds to CDK4 mRNA and upregulates the level of CDK4, therefore directly linking to the cell cycle regulation. Taken together, our data found a lncRNA H19/ILF3/CDK4 axis that regulates AS‐IV‐induced keratinocyte proliferation and migration (Figure 7).

FIGURE 7.

FIGURE 7

Open in a new tab

The mechanism diagram of astragaloside IV promotes keratinocyte proliferation and migration through upregulating lncRNA H19 recruited ILF3 to improve the stability of CDK4 mRNA

As AS‐IV demonstrate pro‐growth and ‐migration activity in keratinocytes, it may cause concern that whether AS‐IV also has carcinogenic potential. Most of the existing studies concentrated on the role of AS‐IV in controlling the migration of keratinocytes. 36 , 37 We extensively checked studies on AS‐IV and did not find any indication of carcinogenic activity of AS‐IV. Interestingly, numerous researchers reported the tumor suppressor function of AS‐IV in various types of cancer. 38 , 39

Our present study mainly focused on the pro‐growth and pro‐migration function of AS‐IV in keratinocytes but did not analyze its activity in an animal model. A previous study has demonstrated in vivo activity of AS‐IV in promoting wound healing in a diabetic model. 40 This study and our promising in vitro results warranted further exploration of the AS‐IV in vivo wound healing model in the following study. Overall, our recent research identified a novel lncRNA H19/ILF3/CDK4 axis that AS‐IV activates to encourage keratinocyte growth and migration. This research justified the theoretical basis for further application of AS‐IV in wound treatment.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflict of interest.

ACKNOWLEDGMENTS

We would like to give our sincere gratitude to the reviewers for their constructive comments.

Wang D‐D, Zhang L‐Z, Pang C‐J, Ye J‐Z. Astragaloside IV promotes keratinocyte proliferation and migration through upregulating lncRNA H19 recruited ILF3 to enhance the stability of CDK4 mRNA. Kaohsiung J Med Sci. 2023;39(8):811–823. 10.1002/kjm2.12691

REFERENCES

  • 1. Sorg H, Tilkorn DJ, Hager S, Hauser J, Mirastschijski U. Skin wound healing: an update on the current knowledge and concepts. Eur Surg Res. 2017;58(1–2):81–94. [DOI] [PubMed] [Google Scholar]
  • 2. Epstein FH. Cutaneous wound healing. N Engl J Med. 1999;341:738–46. [DOI] [PubMed] [Google Scholar]
  • 3. Canedo‐Dorantes L, Canedo‐Ayala M. Skin acute wound healing: a comprehensive review. Int J Inflam. 2019;2019:3706315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Pastar I, Stojadinovic O, Yin NC, Ramirez H, Nusbaum AG, Sawaya A, et al. Epithelialization in wound healing: a comprehensive review. Adv Wound Care. 2014;3(7):445–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Lu W, Cao F, Wang S, Sheng X, Ma J. LncRNAs: the regulator of glucose and lipid metabolism in tumor cells. Front Oncol. 2019;9:1099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Ghafouri‐Fard S, Esmaeili M, Taheri M. H19 lncRNA: roles in tumorigenesis. Biomed Pharmacother. 2020;123:109774. [DOI] [PubMed] [Google Scholar]
  • 7. Jiang X, Ning Q. The mechanism of lncRNA H19 in fibrosis and its potential as novel therapeutic target. Mech Ageing Dev. 2020;188:111243. [DOI] [PubMed] [Google Scholar]
  • 8. Wang B, Suen CW, Ma H, Wang Y, Kong L, Qin D, et al. The roles of H19 in regulating inflammation and aging. Front Immunol. 2020;11:579687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Qian L, Pi L, Fang BR, Meng XX. Adipose mesenchymal stem cell‐derived exosomes accelerate skin wound healing via the lncRNA H19/miR‐19b/SOX9 axis. Lab Invest. 2021;101(9):1254–66. [DOI] [PubMed] [Google Scholar]
  • 10. Li B, Luan S, Chen J, Zhou Y, Wang T, Li Z, et al. The MSC‐derived Exosomal lncRNA H19 promotes wound healing in diabetic foot ulcers by upregulating PTEN via MicroRNA‐152‐3p. Mol Ther Nucleic Acids. 2020;19:814–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Song Z, Wei D, Chen Y, Chen L, Bian Y, Shen Y, et al. Association of astragaloside IV‐inhibited autophagy and mineralization in vascular smooth muscle cells with lncRNA H19 and DUSP5‐mediated ERK signaling. Toxicol Appl Pharmacol. 2019;364:45–54. [DOI] [PubMed] [Google Scholar]
  • 12. Castella S, Bernard R, Corno M, Fradin A, Larcher JC. Ilf3 and NF90 functions in RNA biology. Wiley Interdiscip Rev RNA. 2015;6(2):243–56. [DOI] [PubMed] [Google Scholar]
  • 13. Vrakas CN, Herman AB, Ray M, Kelemen SE, Scalia R, Autieri MV. RNA stability protein ILF3 mediates cytokine‐induced angiogenesis. FASEB J. 2019;33(3):3304–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Baker SJ, Reddy EP. CDK4: a key player in the cell cycle, development, and cancer. Genes Cancer. 2012;3(11–12):658–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Goel S, DeCristo MJ, McAllister SS, Zhao JJ. CDK4/6 inhibition in cancer: beyond cell cycle arrest. Trends Cell Biol. 2018;28(11):911–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Kim SA, Ryu HW, Lee KS, Cho JW. Application of platelet‐rich plasma accelerates the wound healing process in acute and chronic ulcers through rapid migration and upregulation of cyclin a and CDK4 in HaCaT cells. Mol Med Rep. 2013;7(2):476–80. [DOI] [PubMed] [Google Scholar]
  • 17. Liu X, Shang S, Chu W, Ma L, Jiang C, Ding Y, et al. Astragaloside IV ameliorates radiation‐induced senescence via antioxidative mechanism. J Pharm Pharmacol. 2020;72(8):1110–8. [DOI] [PubMed] [Google Scholar]
  • 18. Gagliardi M, Matarazzo MR. RIP: RNA immunoprecipitation. Methods Mol Biol. 2016;1480:73–86. [DOI] [PubMed] [Google Scholar]
  • 19. Bobadilla AVP, Arevalo J, Sarro E, Byrne HM, Maini PK, Carraro T, et al. In vitro cell migration quantification method for scratch assays. J R Soc Interface. 2019;16(151):20180709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Justus CR, Leffler N, Ruiz‐Echevarria M, Yang LV. In vitro cell migration and invasion assays. J Vis Exp. 2014;88:51046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Chen X, Peng LH, Li N, Li QM, Li P, Fung KP, et al. The healing and anti‐scar effects of astragaloside IV on the wound repair in vitro and in vivo. J Ethnopharmacol. 2012;139(3):721–7. [DOI] [PubMed] [Google Scholar]
  • 22. Sevimli‐Gur C, Onbasilar I, Atilla P, Genc R, Cakar N, Deliloglu‐Gurhan I, et al. In vitro growth stimulatory and in vivo wound healing studies on cycloartane‐type saponins of Astragalus genus. J Ethnopharmacol. 2011;134(3):844–50. [DOI] [PubMed] [Google Scholar]
  • 23. Li FL, Li X, Wang YF, Xiao XL, Xu R, Chen J, et al. Astragaloside IV downregulates beta‐catenin in rat keratinocytes to counter LiCl‐induced inhibition of proliferation and migration. Evid Based Complement Alternat Med. 2012;2012:956107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Wang J, Ke J, Wu X, Yan Y. Astragaloside prevents UV‐induced keratinocyte injury by regulating TLR4/NF‐kappaB pathway. J Cosmet Dermatol. 2022;21(3):1163–70. [DOI] [PubMed] [Google Scholar]
  • 25. Cheng S, Zhang X, Feng Q, Chen J, Shen L, Yu P, et al. Astragaloside IV exerts angiogenesis and cardioprotection after myocardial infarction via regulating PTEN/PI3K/Akt signaling pathway. Life Sci. 2019;227:82–93. [DOI] [PubMed] [Google Scholar]
  • 26. Zhang C, Li L, Hou S, Shi Z, Xu W, Wang Q, et al. Astragaloside IV inhibits hepatocellular carcinoma by continually suppressing the development of fibrosis and regulating pSmad3C/3L and Nrf2/HO‐1 pathways. J Ethnopharmacol. 2021;279:114350. [DOI] [PubMed] [Google Scholar]
  • 27. Li B, Zhou Y, Chen J, Wang T, Li Z, Fu Y, et al. Long non‐coding RNA H19 contributes to wound healing of diabetic foot ulcer. J Mol Endocrinol. 2020;65:69–84. [DOI] [PubMed] [Google Scholar]
  • 28. Li B, Zhou Y, Chen J, Wang T, Li Z, Fu Y, et al. Long noncoding RNA H19 acts as a miR‐29b sponge to promote wound healing in diabetic foot ulcer. FASEB J. 2021;35(1):e20526. [DOI] [PubMed] [Google Scholar]
  • 29. Li CX, Li HG, Huang LT, Kong YW, Chen FY, Liang JY, et al. H19 lncRNA regulates keratinocyte differentiation by targeting miR‐130b‐3p. Cell Death Dis. 2017;8(11):e3174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Shi L, Zhao G, Qiu D, Godfrey WR, Vogel H, Rando TA, et al. NF90 regulates cell cycle exit and terminal myogenic differentiation by direct binding to the 3′‐untranslated region of MyoD and p21WAF1/CIP1 mRNAs. J Biol Chem. 2005;280(19):18981–9. [DOI] [PubMed] [Google Scholar]
  • 31. Li K, Wu JL, Qin B, Fan Z, Tang Q, Lu W, et al. ILF3 is a substrate of SPOP for regulating serine biosynthesis in colorectal cancer. Cell Res. 2020;30(2):163–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Sun X, Yan X, Liu K, Wu M, Li Z, Wang Y, et al. lncRNA H19 acts as a ceRNA to regulate the expression of CTGF by targeting miR‐19b in polycystic ovary syndrome. Braz J Med Biol Res. 2020;53(11):e9266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Zhong ME, Chen Y, Zhang G, Xu L, Ge W, Wu B. LncRNA H19 regulates PI3K‐Akt signal pathway by functioning as a ceRNA and predicts poor prognosis in colorectal cancer: integrative analysis of dysregulated ncRNA‐associated ceRNA network. Cancer Cell Int. 2019;19:148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Li A, Mallik S, Luo H, Jia P, Lee DF, Zhao Z. H19, a long non‐coding RNA, mediates transcription factors and target genes through interference of MicroRNAs in Pan‐cancer. Mol Ther Nucleic Acids. 2020;21:180–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Monnier P, Martinet C, Pontis J, Stancheva I, Ait‐Si‐Ali S, Dandolo L. H19 lncRNA controls gene expression of the imprinted gene network by recruiting MBD1. Proc Natl Acad Sci U S A. 2013;110(51):20693–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Veeraperumal S, Qiu HM, Zeng SS, Yao WZ, Wang BP, Liu Y, et al. Polysaccharides from Gracilaria lemaneiformis promote the HaCaT keratinocytes wound healing by polarised and directional cell migration. Carbohydr Polym. 2020;241:116310. [DOI] [PubMed] [Google Scholar]
  • 37. Ma T, Fu B, Yang X, Xiao Y, Pan M. Adipose mesenchymal stem cell‐derived exosomes promote cell proliferation, migration, and inhibit cell apoptosis via Wnt/beta‐catenin signaling in cutaneous wound healing. J Cell Biochem. 2019;120(6):10847–54. [DOI] [PubMed] [Google Scholar]
  • 38. Xu F, Cui WQ, Wei Y, Cui J, Qiu J, Hu LL, et al. Astragaloside IV inhibits lung cancer progression and metastasis by modulating macrophage polarization through AMPK signaling. J Exp Clin Cancer Res. 2018;37(1):207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Xia C, He Z, Cai Y. Quantitative proteomics analysis of differentially expressed proteins induced by astragaloside IV in cervical cancer cell invasion. Cell Mol Biol Lett. 2020;25:25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Luo X, Huang P, Yuan B, Liu T, Lan F, Lu X, et al. Astragaloside IV enhances diabetic wound healing involving upregulation of alternatively activated macrophages. Int Immunopharmacol. 2016;35:22–8. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES