Skip to main content
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2021 Nov 6;38(2):120–128. doi: 10.1002/kjm2.12450

MiR‐32‐5p promoted epithelial‐to‐mesenchymal transition of oral squamous cell carcinoma cells via regulating the KLF2/CXCR4 pathway

Shi‐Yu Qin 1,, Bo Li 1, Mei Chen 1, Ming‐Qun Qin 1, Ji‐Mu Liu 1, Qiu‐Li Lv 1
PMCID: PMC11896135  PMID: 34741382

Abstract

Oral squamous cell carcinoma (OSCC) is one of the most common carcinomas of the oral cavity. However, the regulatory mechanisms on miR‐32‐5p remain poorly understood in OSCC. The expression of miR‐32‐5p, Krüppel‐like factor 2 (KLF2), C‐X‐C motif chemokine receptor 4 (CXCR4), and epithelial‐to‐mesenchymal transition (EMT)‐related proteins (E‐cadherin, Vimentin, N‐cadherin, and Snail) were evaluated were assessed using RT‐qPCR and Western blot. 3‐(4, 5‐Dimethylthiazolyl2)‐2, 5‐diphenyltetrazolium bromide assay, wound healing assay, and transwell assay were employed to detect cell proliferation, migration, and invasion of OSCC cells. Finally, dual‐luciferase reporter assay was performed to verify the binding relationship between KLF2 and miR‐32‐5p. MiR‐32‐5p was highly expressed while KLF2 was lowly expressed in OSCC cells, and miR‐32‐5p knockdown or KLF2 overexpression could markedly reduce cell proliferation, migration, invasion, and EMT of OSCC cells. What is more, KLF2 was the target of miR‐32‐5p, and knockdown of KLF2 abolished the inhibitory effect of miR‐32‐5p inhibitor on progression of OSCC. Finally, CXCR4 expression was negatively regulated by KLF2, and inhibition of CXCR4 obviously alleviated the biological effects of si‐KLF2 on the progression of OSCC. MiR‐32‐5p could enhance cell proliferation, migration, invasion, and EMT of OSCC cells, and the discovery of miR‐32‐5p/KLF2/CXCR4 axis might provide potential therapeutic targets for OSCC.

Keywords: CXCR4, EMT, KLF2, miR‐32‐5p, oral squamous cell carcinoma


Abbreviations

CXCR4

C‐X‐C motif chemokine receptor 4

DMEM

Dulbecco's modified eagle media

EMT

epithelial‐to‐mesenchymal transition

HNSC

head and neck squamous carcinoma

HOK

human oral keratinocytes

KLF2

Krüppel‐like factor 2

miR

microRNA

MTT

3‐(4,5‐dimethylthiazolyl2)‐2,5‐diphenyltetrazolium bromide

OSCC

oral squamous cell carcinoma

qRT‐PCR

quantitative real‐time polymerase chain reaction

SDS‐PAGE

sodium dodecyl sulfate‐polyacrylamide gel electrophoresis

UTR

untranslated regions

WB

western blot

1. INTRODUCTION

OSCC is the most common type of malignant tumor of the head and neck, which accounts for about 3% of diagnosed clinical cancer cases. 1 OSCC is characterized by fast growth, strong infiltration, and regional metastasis. 2 Local recurrence and systemic metastasis are the main causes of death in OSCC patients. 3 However, there has been little improvement in the survival rate of OSCC over the past few decades. 4 epithelial‐to‐mesenchymal transition (EMT) refers to the process by which epithelial cells transform into mesenchymal cells under specific physiological and pathological conditions to obtain migration and invasion characteristics. 5 As we all known, EMT plays a key role in regulating infiltration and metastasis of OSCC. 6 , 7 Therefore, it is of great significance to better understand the molecular mechanisms underlying EMT and search for novel therapeutic targets for OSCC.

MiRNAs refer to a class of endogenous non‐coding single‐stranded RNA molecules with a length of approximately 22 nts. 8 MiRNAs have the ability to regulate expression of target mRNAs via directly binding to their 3′‐UTR, thus play pivotal roles in tumorigenesis. 9 , 10 Many studies have shown that miRNAs are closely related to the development of OSCC. 11 , 12 For example, Wang et al. revealed that miR‐204‐5p expression was markedly increased in OSCC tissues and cells, and miR‐204‐5p overexpression could suppress cell proliferation and metastasis of OSCC cells. 12 Besides, miR‐433 was reported to be downregulated in OSCC, and miR‐433 overexpression inhibited OSCC growth and metastasis. 13 MiR‐32‐5p was previously identified as an oncogene in colorectal cancer tissues. 14 More importantly, miR‐32‐5p was reported to be upregulated in the tissues and serum of OSCC patients. 15 Therefore, it was suggested that miR‐32‐5p could act as a potential biomarker of OSCC. However, the specific mechanism of miR‐32‐5p in OSCC still remains unknown.

KLF2 is an important member of KLF family, which is considered as a tumor suppressor in many malignant tumors including OSCC. 16 , 17 KLF2 was reported to be downregulated in many malignant tumors and had the characteristics of suppressing cell proliferation. 18 For example, Lian et al. revealed that lncRNA LINC00460 could enhance cell proliferation of colorectal cancer cells via reducing KLF2 expression. 16 Besides, KLF2 overexpression suppressed cell migration and invasion of prostate cancer cells. 19 More importantly, Dai et al. suggested that miR‐32‐5p could participate in the myocardial damage, endothelial injury and inflammatory responses of AMI by targeting KLF2. 20 However, there was no report on the research that KLF2 participated in OSCC progression as the target of miR‐32‐5p.

CXCR4 is a ligand for stromal cell‐derived factor 1a/chemokine 12, which is an important molecule involved in tumor spread and progression. 21 Previous study demonstrated that CXCR4‐positive cells had the molecular characteristics of EMT in lung cancer, revealing CXCR4 was closely related to EMT. 22 Besides, CXCR4 expression was markedly increased in OSCC, which was closely to the malignant progression of OSCC. 12 , 23 What is more, Duan et al. showed that CXCR4 silence could inhibit EMT of OSCC cells, thereby suppressing tumor metastasis. 24 It was noteworthy that KLF2 could weaken the activity of CXCR4 promoter in OSCC to downregulate CXCR4 expression. 25 However, the role of CXCR4 in regulating EMT process in OSCC has not been reported, and further research is needed. AMD3100, a bicyclam that specifically and reversibly blocks SDF‐1/CXCL12 binding to, and signaling through CXCR4, is identified as a classic inhibitor of CXCR4. 26 , 27 In the current study, AMD3100 was employed to inhibit CXCR4 to explore the role of CXCR4 in regulating EMT process in OSCC.

Here, our results proved that upregulated miR‐32‐5p in OSCC increased CXCR4 expression by targeting KLF2, which in turn regulated cell proliferation, invasion, migration, and EMT process in OSCC and ultimately participated in the pathogenesis of OSCC. Our study proposed a new insight for the pathological mechanisms of OSCC.

2. MATERIALS AND METHODS

2.1. Clinical samples collection

Thirty OSCC tissues and the paired adjacent normal tissues were dissected from patients in the Affiliated Stomatology Hospital of Guilin Medical University. After surgery, all fresh tissues were immediately stored in liquid nitrogen for subsequent use. Patients involved in this study were diagnosed via pathology, and none of the patients received any other treatments, such as chemotherapy or radiotherapy. This study received the approval of the Affiliated Stomatolagy Hospital of Guilin Medical University and has obtained the informed consents from all patients.

2.2. Cell culture

Human OSCC cell lines (SCC‐9, SCC‐15, SCC‐25, CAL‐27, and Tca‐8113) and HOK were obtained from American type culture collection (ATCC, Virginia). All cells were cultured in DMEM (Gibco, Rockville, Maryland) containing 10% FBS (Gibco) and 1% penicillin/streptomycin solution (Sangon, Shanghai, China) in a humidified atmosphere of 5% CO2 at 37°C.

2.3. 3‐(4,5‐Dimethylthiazolyl2)‐2,5‐diphenyltetrazolium bromide assay

Cells were cultured in complete DMEM medium mixed with 5 mg/ml MTT (Sigma‐Aldrich, Missouri). Cells were incubated in MTT solution for 4 h at 37°C. After incubation, all medium was removed. Then dimethyl sulfoxide (DMSO) (Sigma‐Aldrich) was added and the absorbance at 490 nm was detected by a microplate reader (Bioteke, Beijing, China). The absorbance value relative to the control was taken as the relative cell viability.

2.4. Cell transfection

The overexpression plasmid of KLF2 (oe‐KLF2), small interference RNA against KLF2 (si‐KLF2) and miR‐32‐5p inhibitor or mimics as well as their negative controls (inhibitor NC, mimics NC) were purchased from GenePharma (Shanghai, China). The inhibitor of CXCR4 (AMD3100) was purchased from MedChemExpress (New Jersey). For in vitro transfection, cells were transfected with oe‐KLF2, si‐KLF2, miR‐32‐5p inhibitor, or miR‐32‐5p mimics, and their negative controls using Lipofectamine™ 3000 (Invitrogen, California) for 24 h in accordance with the manufacturer's instruction. Cells were treated with AMD3100 to suppress CXCR4.

2.5. Transwell migration and invasion assay

24‐well transwell dishes with a pore size of 8 mm (BD, New Jersey) were used to detect cell migration. Briefly, Cells were cultured in 500 μl DMEM without FBS at a density of 1 × 104. The cells were placed in the upper chamber and 1000 μl of FBS‐containing DMEM was placed in the bottom chamber. Cells were cultured for 12 h. The cells were then fixed in ice methanol for 5–10 min and stained with hematoxylin for 30 min. Cells on the upper side of the filter were removed. Cells were observed and photographed under a microscope (Thermo Fisher Scientific, California). The transwell invasion assay was the same as migration assay except the upper chamber was precoated with Matrigel (Corning, New York) at a 1:8 ratio.

2.6. Wound healing assay

Cells were plated into six‐well plates (Corning) and then DMEM without FBS was added. An artificial wound was created in the confluent cell monolayer using a 200 μl pipette tip. The medium was removed and washed twice gently with PBS. Cells were cultured, and the images were taken at 0 and 24 h using a microscope (Olympus Corporation, Tokyo, Japan).

2.7. Dual‐luciferase reporter gene assay

We predicted the target of gene binding site using a common online tool, Targetscan (http://www.targetscan.org). Wild‐type (wt) and mutant‐type (mut) reporter plasmids of KLF2 3′‐UTR sequences were cloned into pGL3 vector (GenePharma). Then, cells were plated onto 24‐well plate and were co‐transfected with KLF2‐wt or KLF2‐mut plasmids and miR‐32‐5p mimics or mimics NC by Lipofectamine™ 3000 (Invitrogen). The Luciferase activity was examined using a dual‐luciferase reporter assay system (Promega, Wisconsin).

2.8. Quantitative real‐time polymerase chain reaction

Total RNA was isolated from cells and tissues by using TRIzol reagent (Thermo Fisher Scientific). cDNA was synthesized with HiFiScript cDNA synthesis kit in accordance with manufacturer's instruction (Life Technologies, California). Then, the cDNA was used for RT‐qPCR assay conducted on an Eppendorf MasterCycler RealPlex4 (Eppendorf, Wesseling‐Berzdorf, Germany) using an Ultra SYBR Mixture kit (Thermo Fisher Scientific). The relative expressions of miRNA and mRNA were respectively normalized by U6 and GAPDH and calculated by 2−ΔΔCT method. The primers used in the study were listed as follows (5′–3′):

  • miR‐32‐5p (F): CGGTATTGCACATTACTAAGTTGCA

  • miR‐32‐5p (R): CTCGCTTCGGCAGCACA

  • KLF2 (F): CACCAAGAGTTCGCATCTGA

  • KLF2 (R): CGTGTGCTTTCGGTAGTGG

  • CXCR4 (F): ACTACACCGAGGAAATGGGCT

  • CXCR4 (R): CCCACAATGCCAGTTAAGAAGA

  • GAPDH (F): GGAGCGAGATCCCTCCAAAAT

  • GAPDH (R): GGCTGTTGTCATACTTCTCATGG

  • U6 (F): CTCGCTTCGGCAGCACA

  • U6 (R): AACGCTTCACGAATTTGCGT

2.9. Western blot

The proteins were isolated from cells by using RIPA (Thermo Fisher Scientific) mixed with 1% protease inhibitor and phosphorylase inhibitor (Beyotime, Shanghai, China), and concentrations of protein were determined by a BCA Kit (Beyotime). Lysate samples were separated using SDS‐PAGE, and then transferred to a PVDF membrane (Millipore, Massachusetts). Then membranes were incubated with primary antibodies including KLF2 (Abcam, 1:1000, ab236507), CXCR4 (Abcam, 1:1000, ab181020), E‐cadherin (Abcam, 1:1000, ab231303), Vimentin (Abcam, 1:1000, ab8069), E‐cadherin (Abcam, 1:1000, ab76011), and Snail (Abcam, 1:1000, ab216347). Anti‐GAPDH antibody (Sigma‐Aldrich, 1:10,000, SAB2701826) was served as a loading control. After washed with PBST, membranes were then incubated with the corresponding secondary antibodies labeled with HRP (Abcam, 1:10,000, ab7090, ab97035) for 60 min. The membranes were covered with ECL reagents (Beyotime) and the images were performed by GEL imaging system (Bio‐Rad, California). The quantification of proteins was analyzed by the software Image J.

2.10. Data analysis

All data were obtained from at least three replicate experiments. Results were expressed as mean ± SD. Statistical analysis was performed using SPSS 22.0 (IBM, New York). Differences between normally distributed data were analyzed by Student's t‐tests and one‐way ANOVA. The p values less than 0.05 were considered significant. Correlation was analyzed using Pearson correlation analysis.

3. RESULTS

3.1. MiR‐32‐5p knockdown suppressed cell proliferation, migration, invasion and EMT of OSCC cells

To figure out the implication of miR‐32‐5p, KLF2, and CXCR4 in OSCC, we first browsed the cancer genome atlas database, finding that KLF2 presented a lower level in HNSC samples compared with the normal samples, CXCR4 presented a higher level in HNSC samples, while miR‐32‐5p expression in HNSCC and normal samples was not significantly different (Figure S1A). To gain more evidence, we collected 30 samples of OSCC tissues and the matched adjacent non‐cancerous tissues, and detected miR‐32‐5p, CXCR4 and KLF2 expressions. As a result, RT‐qPCR analysis showed that miR‐32‐5p and CXCR4 expressions were markedly increased in OSCC tissues, while KLF2 was significantly downregulated (Figure S1B). Additionally, results of Pearson correlation analysis displayed that miR‐32‐5p expression was negatively correlated with KLF2 expression, and CXCR4 expression was negatively correlated with KLF2 expression (Figure S1C). Then, the roles of miR‐32‐5p and KLF2 in OSCC were explored by using RT‐qPCR assays to measure miR‐32‐5p and KLF2 expressions in different OSCC cell lines (SCC‐9, SCC‐15, SCC‐25, CAL‐27, and Tca‐8113) and HOK. Results of RT‐qPCR demonstrated that the expression of miR‐32‐5p was markedly increased in OSCC cells compared to HOK cells, while KLF2 was significantly downregulated (Figure 1A). In order to further examine the roles of miR‐32‐5p in regulating OSCC progression, first, we transfected miR‐32‐5p inhibitor or inhibitor NC into SCC‐9 and CAL‐27 cells, and we found miR‐32‐5p was obviously decreased in SCC‐9 and CAL‐27 cells after transfection with miR‐32‐5p inhibitor, revealing the transfection was successful (Figure 1B). MTT assay subsequently demonstrated that silencing miR‐32‐5p suppressed cell proliferation of SCC‐9 and CAL‐27 cells (Figure 1C). What is more, results of transwell assay and wound healing assay displayed that miR‐32‐5p knockdown resulted in decreased cell migration and invasion of SCC‐9 and CAL‐27 cells (Figure 1D,E). Furthermore, we explored the regulatory effect of miR‐32‐5p on EMT process by detecting EMT‐related protein. The results showed that the expression of KLF2 and epithelial marker (E‐cadherin) were increased, while CXCR4 and mesenchymal markers (Vimentin, Snail, and N‐cadherin) were decreased in miR‐32‐5p inhibitor group compared with inhibitor NC group (Figure 1F). Taken together, miR‐32‐5p was significantly upregulated in OSCC, and miR‐32‐5p inhibition could suppress cell proliferation, migration, invasion, and EMT process in OSCC.

FIGURE 1.

FIGURE 1

MiR‐32‐5p silence suppressed EMT and metastasis of OSCC cells. (A) MiR‐32‐5p and KLF2 mRNA expression in SCC‐9, SCC‐15, SCC‐25, CAL‐27, Tca‐8113, and HOK cells were assessed using RT‐qPCR. SCC‐9 and CAL‐27 cells were transfected with inhibitor NC or miR‐32‐5p inhibitor. (B) MiR‐32‐5p expression in SCC‐9 and CAL‐27 cells was determined using RT‐qPCR. (C) Cell proliferation of SCC‐9 and CAL‐27 cells was evaluated using MTT assay. (D) Transwell assay was employed to evaluate cell migration and invasion of SCC‐9 and CAL‐27 cells. (E) Cell migration of SCC‐9 and CAL‐27 cells was detected by wound healing assay. (F) Western blot was performed to assess protein levels of KLF2, CXCR4, E‐cadherin, Vimentin, N‐cadherin, and Snail in SCC‐9 and CAL‐27 cells. The data were expressed as mean ± SD. n = 3. *p < 0.05, ** p < 0.01, *** p < 0.001

3.2. KLF2 overexpression suppressed cell proliferation, migration, invasion, and EMT of OSCC cells

Then, we aimed to explore the roles of KLF2 in OSCC, and we overexpressed KLF2 in SCC‐9 and CAL‐27 cells. First, RT‐qPCR was employed to examine transfection efficiency, and the results demonstrated that KLF2 overexpression increased KLF2 expression and decreased CXCR4 expression (Figure 2A). Results of MTT assay showed that cell proliferation of SCC‐9 and CAL‐27 cells were repressed by KLF2 overexpression (Figure 2B). In addition, cell migration and invasion were reduced after KLF2 was overexpressed (Figure 2C,D). Furthermore, KLF2 overexpression resulted in the increased levels of KLF2 and E‐cadherin, and the decreased levels of CXCR4, Vimentin, N‐cadherin, and Snail (Figure 2E). The above results suggested that overexpression of KLF2 could inhibit cell proliferation, migration, invasion, and EMT process in OSCC.

FIGURE 2.

FIGURE 2

KLF2 overexpression suppressed EMT and metastasis of OSCC cells. SCC‐9 and CAL‐27 cells were transfected with KLF2‐overexpression vectors. (A) KLF2 and CXCR4 expression in SCC‐9 and CAL‐27 cells were determined using RT‐qPCR. (B) MTT assay was conducted to evaluate cell proliferation of SCC‐9 and CAL‐27 cells. (C) Cell migration and invasion of SCC‐9 and CAL‐27 cells were detected by transwell assay. (D) Cell migration of SCC‐9 and CAL‐27 cells was detected by wound healing assay. (E) Protein levels of KLF2, CXCR4, E‐cadherin, Vimentin, N‐cadherin, and Snail in SCC‐9 and CAL‐27 cells were assessed using Western blot. The data were expressed as mean ± SD. n = 3. *p < 0.05, **p < 0.01, ***p < 0.001

3.3. MiR‐32‐5p regulated CXCR4 expression via targeting KLF2

Then, we sought to explore the relationship among miR‐32‐5p, KLF2, and CXCR4 in regulating OSCC development. First, western blot was performed to evaluate KLF2 and CXCR4 expressions, and the result demonstrated that the expression level of KLF2 was obviously reduced, while CXCR4 expression was markedly elevated in SCC‐9 and CAL‐27 cells following knockdown of KLF2 (Figure 3A,B). The above results indicated that KLF2 could negatively regulate CXCR4 expression. Then, we further evaluated the relationship between miR‐32‐5p and KLF2. Targetscan was employed to predict the potential binding site between miR‐32‐5p and KLF2 mRNA (Figure 3C). Besides, results of dual‐luciferase reporter assay subsequently displayed that luciferase activity of KLF2‐wt group was markedly inhibited after treatment with miR‐32‐5p mimics, while the luciferase activity in the KLF2‐mut group remained unchanged (Figure 3D). In summary, miR‐32‐5p could regulate CXCR4 expression via targeting KLF2.

FIGURE 3.

FIGURE 3

MiR‐32‐5p regulated CXCR4 expression via targeting KLF2. (A,B) The mRNA levels and protein levels of CXCR4 and KLF2 in SCC‐9 and CAL‐27 cells were determined by RT‐qPCR and Western blot, respectively. (C) Bioinformatics software Targetscan was applied to predict the binding site between KLF2 mRNA and miR‐32‐5p. (D) Cells were cultured and then cotransfected with KLF2‐wt or KLF2‐mut plasmids and miR‐32‐5p mimics, or mimics NC, then luciferase activity was measured. The data were expressed as mean ± SD. n = 3. **p < 0.01, ***p < 0.001

3.4. MiR‐32‐5p promoted cell proliferation, migration, invasion, and EMT of OSCC cells via regulating KLF2/CXCR4 axis

In order to verify whether miR‐32‐5p/KLF2/CXCR4 axis could regulate the development of OSCC, miR‐32‐5p inhibitor and si‐KLF2 were co‐transfected into SCC‐9 and Cal‐27 cells, and CXCR4 antagonist AMD3100 was added at the same time. Firstly, MTT assay displayed that knockdown of KLF2 abolished the inhibitory effect of miR‐32‐5p inhibitor on cell proliferation, while AMD3100 could reverse the effect of si‐KLF2 on cell proliferation (Figure 4A). The similar trend was observed in cell migration evaluated by wound healing assay (Figure 4B). Furthermore, we also found that the protein levels of KLF2 and E‐cadherin was decreased, while CXCR4, Vimentin, N‐cadherin, and Snail were increased in cotranfection with miR‐32‐5p inhibitor and si‐KLF2, compared to miR‐32‐5p inhibitor group (Figure 4C). Meanwhile, CXCR4 inhibitor could weaken the promotion effect of si‐KLF2 on EMT process (Figure 4C). In total, miR‐32‐5p/KLF2/CXCR4 axis could regulate development of OSCC.

FIGURE 4.

FIGURE 4

MiR‐32‐5p promoted EMT and metastasis of OSCC cells via regulating KLF2/CXCR4 axis. SCC‐9 and Cal‐27 cells were transfected with miR‐32‐5p inhibitor or inhibitor NC or co‐transfected with miR‐32‐5p inhibitor and si‐KLF2 or co‐treated with miR‐32‐5p inhibitor, AMD3100 and si‐KLF2. (A) MTT assay was employed to evaluate cell proliferation of SCC‐9 and Cal‐27 cells. (B) Cell migration of SCC‐9 and Cal‐27 cells was detected by wound healing assay. (C) Protein levels of KLF2, CXCR4, E‐cadherin, Vimentin, N‐cadherin, and Snail in SCC‐9 and Cal‐27 cells were assessed using Western blot. The data were expressed as mean ± SD. n = 3. *p < 0.05, **p < 0.01, ***p < 0.001

4. DISCUSSION

OSCC has a very high fatality rate due to its high metastasis and invasion. According to reports, the 5‐year overall survival rate of OSCC patients is only about 50%. 28 EMT refers to a phenomenon in which epithelial cells transform into mesenchymal cells under specific physiological and pathological conditions. 29 EMT plays a key role in the infiltration and metastasis of epithelial tumors such as OSCC. 30 Therefore, studying the potential molecular mechanisms regulating EMT process in OSCC is of great significance for reducing the mortality of OSCC patients. Accumulative evidence has shown that miRNAs play a key role in regulating EMT process in OSCC. 4 , 31 For example, miR‐205 was obviously downregulated in OSCC cells, and miR‐205 overexpression could suppress EMT of OSCC cells. 32 Besides, Shi et al. revealed that miR‐106a expression was markedly decreased in OSCC tissues and cell lines, and miR‐106a overexpression obviously suppressed EMT of OSCC cells. 33 Previous study demonstrated that miR‐32‐5p was significantly upregulated in tissues and serum of OSCC patients, 15 revealing that miR‐32‐5p was closely related to OSCC progression. However, the molecular mechanism of miR‐32‐5p regulating the development of OSCC has not been found. In the present study, we found that miR‐32‐5p was significantly upregulated in multiple OSCC cell lines and human OSCC tissues. Besides, miR‐32‐5p inhibition dramatically inhibited OSCC cell proliferation, migration, invasion, and EMT process. Thus, miR‐32‐5p was considered to promote EMT process in OSCC in the present study.

Since miRNAs do not have the ability to encode proteins, miRNAs participate in the process of carcinogenesis by regulating the expression of target mRNAs. 34 For example, miRNA‐101 suppressed development of OSCC via downregulating TGF‐βR1. 35 The other finding also displayed that miRNA‐10a enhanced cell proliferation of OSCC cells via targeting GLUT1. 36 KLF2 is reported as a tumor suppressor gene, which is downregulated in various human malignancies, such as gastric cancer and pancreatic cancer. 17 , 37 For example, Dai et al. suggested that KLF2 overexpression could induce senescence of pancreatic cancer cells, thus suppressing development of pancreatic cancer. 37 However, the role of KLF2 in OSCC remains unclear. Our results suggested that KLF2 overexpression obviously suppressed OSCC cell proliferation, migration, invasion, and EMT process. Additionally, we found that miR‐32‐5p had a binding site to KLF2, and miR‐32‐5p could negatively regulate KLF2 expression. Furthermore, KLF2 silence eliminated the inhibitory effect of miR‐32‐5p inhibitor on cell proliferation, migration, invasion, and EMT behaviors of OSCC cells. Therefore, we came to the conclusion that miR‐32‐5p promoted cell proliferation, migration, invasion, and EMT of OSCC cells via targeting KLF2.

Growing evidence has displayed that CXCR4 is as a driver oncogene in many human malignancies, including OSCC. 24 , 38 Previous study indicated that the high expression of CXCR4 was associated with EMT process in OSCC, and inhibition of CXCR4 dramatically inhibited EMT of OSCC cells. 24 Besides, Daisuke et al. illustrated that KLF2 could suppress migration and lymph node metastasis in OSCC via downregulating CXCR4. 25 In the present study, we proved that CXCR4 was negatively regulated by KLF2, which was totally consistent with previous study. Besides, inhibition of CXCR4 obviously weakened the biological effects of si‐KLF2 on cell proliferation, migration, invasion, and EMT of OSCC cells. These results provided evidence that CXCR4 was the downstream target of miR‐32‐5p/KLF2 axis with the function of regulating cell proliferation, migration, invasion, and EMT of OSCC cells.

In total, our research proved that miR‐32‐5p promoted cell proliferation, migration, invasion, and EMT of OSCC cells by KLF2‐mediated regulation of CXCR4. Our research clarified the regulatory mechanism of cell proliferation, migration, invasion, and EMT in OSCC, which was of great significance for the treatment of OSCC. Our work also has some limitations. Potentially malignant diseases can be called carcinogenesis as it conveys that not all disorders described under this term may transform into cancer. 39 Study related to human oral potentially premalignant disorders using the human premalignant cell line DOK was of great significance for the early detection and diagnosis of OSCC. Therefore, we need to perform future study related to human oral potentially premalignant disorders using DOK cell line. In addition, we only performed in vitro experiments. In the future, we need to further verify and explore on the animal level and signal pathways, and the results will be more accurate.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Supporting information

Figure S1 MiR‐32‐5p, KLF2 and CXCR4 expressions in OSCC samples and the normal samples. Figure S1A. MiR‐32‐5p, KLF2 and CXCR4 expressions in HNSC samples and the normal samples were detected using TCGA data. Figure S1B. RT‐qPCR assay was employed to determine miR‐32‐5p, KLF2 and CXCR4 expressions in 30 samples of OSCC tissues and the matched adjacent non‐cancerous tissues. The data were expressed as mean ± standard deviation (SD). n = 30. *** P < 0.001. Figure S1C. Correlation between miR‐32‐5p expression, KLF2 expression and CXCR4 expression was analyzed using Pearson correlation analysis. The data were expressed as mean ± standard deviation (SD). n = 30. * P < 0.05.

KJM2-38-120-s001.tif (364.1KB, tif)

Qin S‐Y, Li B, Chen M, Qin M‐Q, Liu J‐M, Lv Q‐L. MiR‐32‐5p promoted epithelial‐to‐mesenchymal transition of oral squamous cell carcinoma cells via regulating the KLF2/CXCR4 pathway. Kaohsiung J Med Sci. 2022;38:120–128. 10.1002/kjm2.12450

REFERENCES

  • 1. Chi AC, Day TA, Neville BW. Oral cavity and oropharyngeal squamous cell carcinoma—An update. CA Cancer J Clin. 2015;65(5):401–21. [DOI] [PubMed] [Google Scholar]
  • 2. Genden EM, Ferlito A, Bradley PJ, Rinaldo A, Scully C. Neck disease and distant metastases. Oral Oncol. 2003;39(3):207–12. [DOI] [PubMed] [Google Scholar]
  • 3. Sant'Ana JMDA, Servato JPS, Matsuo FS, Andrade MF, Pitorro TEA, Moraes ADS, et al. The role of the histones H3K9ac, H3K9me3, HP1γ, and H3K36me3 in oral squamous cell carcinoma loco‐regional metastasis and relapse. Pathol Res Pract. 2020;216:153201. [DOI] [PubMed] [Google Scholar]
  • 4. Arunkumar G, Deva Magendhra Rao AK, Manikandan M, Prasanna Srinivasa Rao H, Subbiah S, Ilangovan R, et al. Dysregulation of miR‐200 family microRNAs and epithelial‐mesenchymal transition markers in oral squamous cell carcinoma. Oncol Lett. 2018;15(1):649–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Rout‐Pitt N, Farrow N, Parsons D, Donnelley M. Epithelial mesenchymal transition (EMT): A universal process in lung diseases with implications for cystic fibrosis pathophysiology. Respir Res. 2018;19(1):136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. De Craene B, Berx G. Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer. 2013;13(2):97–110. [DOI] [PubMed] [Google Scholar]
  • 7. Song Q, Wang B, Liu M, Ren Z, Fu Y, Zhang P, et al. MTA1 promotes the invasion and migration of oral squamous carcinoma by inducing epithelial‐mesenchymal transition via the hedgehog signaling pathway. Exp Cell Res. 2019;382(1):111450. [DOI] [PubMed] [Google Scholar]
  • 8. Salunkhe S, Vaidya T. CD40‐miRNA axis controls prospective cell fate determinants during B cell differentiation. Mol Immunol. 2020;126:46–55. [DOI] [PubMed] [Google Scholar]
  • 9. Wu M, Wang G, Tian W, Deng Y, Xu Y. MiRNA‐based therapeutics for lung cancer. Curr Pharm Des. 2018;23(39):5989–96. [DOI] [PubMed] [Google Scholar]
  • 10. Mishra S, Yadav T, Rani V. Exploring miRNA based approaches in cancer diagnostics and therapeutics. Crit Rev Oncol Hematol. 2016;98:12–23. [DOI] [PubMed] [Google Scholar]
  • 11. Gomes CC, de Sousa SF, Gomez RS. MicroRNAs: small molecules with a potentially role in oral squamous cell carcinoma. Curr Pharm Des. 2013;19(7):1285–91. [DOI] [PubMed] [Google Scholar]
  • 12. Wang X, Li F, Zhou X. miR‐204‐5p regulates cell proliferation and metastasis through inhibiting CXCR4 expression in OSCC. Biomed Pharmacother. 2016;82:202–7. [DOI] [PubMed] [Google Scholar]
  • 13. Wang XC, Ma Y, Meng PS, Han JL, Yu HY, Bi LJ. miR‐433 inhibits oral squamous cell carcinoma (OSCC) cell growth and metastasis by targeting HDAC6. Oral Oncol. 2015;51(7):674–82. [DOI] [PubMed] [Google Scholar]
  • 14. Liang H, Tang Y, Zhang H, Zhang C. MiR‐32‐5p regulates radiosensitization, migration and invasion of colorectal cancer cells by targeting TOB1 gene. Onco Targets Ther. 2019;12:9651–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Schneider A, Victoria B, Lopez YN, Suchorska W, Barczak W, Sobecka A, et al. Tissue and serum microRNA profile of oral squamous cell carcinoma patients. Sci Rep. 2018;8(1):675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Lian Y, Yan C, Xu H, Yang J, Yu Y, Zhou J, et al. A novel lncRNA, LINC00460, affects cell proliferation and apoptosis by regulating KLF2 and CUL4A expression in colorectal cancer. Mol Ther Nucleic Acids. 2018;12:684–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Wang Q, He Y, Kan W, Li F, Ji X, Wu X, et al. microRNA‐32‐5p targets KLF2 to promote gastric cancer by activating PI3K/AKT signaling pathway. Am J Transl Res. 2019;11(8):4895–908. [PMC free article] [PubMed] [Google Scholar]
  • 18. Zhang W, Levi L, Banerjee P, Jain M, Noy N. Kruppel‐like factor 2 suppresses mammary carcinoma growth by regulating retinoic acid signaling. Oncotarget. 2015;6(34):35830–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Wang B, Liu M, Song Y, Li C, Zhang S, Ma L. KLF2 inhibits the migration and invasion of prostate cancer cells by downregulating MMP2. Am J Mens Health. 2019;13(1):1557988318816907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Dai Y, Yan T, Gao Y. Silence of miR‐32‐5p promotes endothelial cell viability by targeting KLF2 and serves as a diagnostic biomarker of acute myocardial infarction. Diagn Pathol. 2020;15(1):19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Zlotnik A. New insights on the role of CXCR4 in cancer metastasis. J Pathol. 2008;215(3):211–3. [DOI] [PubMed] [Google Scholar]
  • 22. Yin H, Wang Y, Chen W, Zhong S, Liu Z, Zhao J. Drug‐resistant CXCR4‐positive cells have the molecular characteristics of EMT in NSCLC. Gene. 2016;594(1):23–9. [DOI] [PubMed] [Google Scholar]
  • 23. Xia J, Chen N, Hong Y, Chen X, Tao X, Cheng B, et al. Expressions of CXCL12/CXCR4 in oral premalignant and malignant lesions. Mediators Inflamm. 2012;2012:516395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Duan Y, Zhang S, Wang L, Zhou X, He Q, Liu S, et al. Targeted silencing of CXCR4 inhibits epithelial‐mesenchymal transition in oral squamous cell carcinoma. Oncol Lett. 2016;12(3):2055–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Uchida D, Onoue T, Begum NM, Kuribayashi N, Tomizuka Y, Tamatani T, et al. Vesnarinone downregulates CXCR4 expression via upregulation of Krüppel‐like factor 2 in oral cancer cells. Mol Cancer. 2009;8:62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. De Clercq E. The bicyclam AMD3100 story. Nat Rev Drug Discov. 2003;2(7):581–7. [DOI] [PubMed] [Google Scholar]
  • 27. Joo EK, Broxmeyer HE, Kwon HJ, Kang HB, Kim JS, Lim JS, et al. Enhancement of cell survival by stromal cell‐derived factor‐1/CXCL12 involves activation of CREB and induction of Mcl‐1 and c‐Fos in factor‐dependent human cell line MO7e. Stem Cells Dev. 2004;13(5):563–70. [DOI] [PubMed] [Google Scholar]
  • 28. Salazar C, Nagadia R, Pandit P, Cooper‐White J, Banerjee N, Dimitrova N, et al. A novel saliva‐based microRNA biomarker panel to detect head and neck cancers. Cell Oncol (Dordr). 2014;37(5):331–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Hayashi T, Gust K, Jäger W, Awrey S, Li N, Altamirano‐Dimas M, et al. MP36‐17 canonical Notch2 signaling promotes tumor growth and metastasis in bladder cancer through cell cycle progress, dedifferentiation and EMT. J Urol. 2015;193(4):e436. [Google Scholar]
  • 30. Joseph JP, Harishankar MK, Pillai AA, Devi A. Hypoxia induced EMT: a review on the mechanism of tumor progression and metastasis in OSCC. Oral Oncol. 2018;80:23–32. [DOI] [PubMed] [Google Scholar]
  • 31. Kim EJ, Kim JS, Lee S, Lee H, Yoon JS, Hong JH, et al. QKI, a miR‐200 target gene, suppresses epithelial‐to‐mesenchymal transition and tumor growth. Int J Cancer. 2019;145(6):1585–95. [DOI] [PubMed] [Google Scholar]
  • 32. Hashiguchi Y, Kawano S, Goto Y, Yasuda K, Kaneko N, Sakamoto T, et al. Tumor‐suppressive roles of ΔNp63β‐miR‐205 axis in epithelial‐mesenchymal transition of oral squamous cell carcinoma via targeting ZEB1 and ZEB2. J Cell Physiol. 2018;233(10):6565–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Shi B, Ma C, Liu G, Guo Y. MiR‐106a directly targets LIMK1 to inhibit proliferation and EMT of oral carcinoma cells. Cell Mol Biol Lett. 2019;24:1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. He B, Lin X, Tian F, Yu W, Qiao B. MiR‐133a‐3p inhibits oral squamous cell carcinoma (OSCC) proliferation and invasion by suppressing COL1A1. J Cell Biochem. 2018;119(1):338–46. [DOI] [PubMed] [Google Scholar]
  • 35. Wang Y, Jia RZ, Diao S, He J, Jia L. miRNA‐101 targets TGF‐βR1 to retard the progression of oral squamous cell carcinoma. Oncol Res. 2020;28(2):203–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Chen YH, Song Y, Yu YL, Cheng W, Tong X. miRNA‐10a promotes cancer cell proliferation in oral squamous cell carcinoma by upregulating GLUT1 and promoting glucose metabolism. Oncol Lett. 2019;17(6):5441–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Yuedi D, Houbao L, Pinxiang L, Hui W, Min T, Dexiang Z. KLF2 induces the senescence of pancreatic cancer cells by cooperating with FOXO4 to upregulate p21. Exp Cell Res. 2020;388(1):111784. [DOI] [PubMed] [Google Scholar]
  • 38. Huang SJ, Tseng YK, Lo YH, Wu PC, Lee JH, Liou HH, et al. Association of SDF‐1 and CXCR4 polymorphisms with susceptibility to oral and pharyngeal squamous cell carcinoma. Anticancer Res. 2019;39(6):2891–902. [DOI] [PubMed] [Google Scholar]
  • 39. Rathore AS, Katyal S, Jain A, Shetty DC. Biochemical analysis of cytokeratin fragment 21‐1 concentration and expression of cytokeratin 19 in oral potentially malignant disorders. J Cancer Res Ther. 2020;16(3):452–7. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1 MiR‐32‐5p, KLF2 and CXCR4 expressions in OSCC samples and the normal samples. Figure S1A. MiR‐32‐5p, KLF2 and CXCR4 expressions in HNSC samples and the normal samples were detected using TCGA data. Figure S1B. RT‐qPCR assay was employed to determine miR‐32‐5p, KLF2 and CXCR4 expressions in 30 samples of OSCC tissues and the matched adjacent non‐cancerous tissues. The data were expressed as mean ± standard deviation (SD). n = 30. *** P < 0.001. Figure S1C. Correlation between miR‐32‐5p expression, KLF2 expression and CXCR4 expression was analyzed using Pearson correlation analysis. The data were expressed as mean ± standard deviation (SD). n = 30. * P < 0.05.

KJM2-38-120-s001.tif (364.1KB, tif)

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES