Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2019 Sep 4;36(1):20–26. doi: 10.1002/kjm2.12124

MiR‐22 restrains proliferation of rheumatoid arthritis by targeting IL6R and may be concerned with the suppression of NF‐κB pathway

Qing‐Yi Yang 1,†, Kai‐Peng Yang 2,†, Zhi‐Zhou Li 3,✉
PMCID: PMC11896151  PMID: 31483954

Abstract

It has demonstrated that miR‐22 overexpression can suppress the inflammation process of rheumatoid arthritis (RA) in synoviocytes. But, the underlying mechanism of miR‐22 expression in regulating RA is still not well illustrated. In this study, we investigated the functional role and underlying mechanism of miR‐22 in regulating RA. Human RA fibroblast‐like synoviocyte (FLS) cell line MH7A cells was transfected by miR‐22 mimic and its control. CCK8 was utilized to detect cell proliferation. Cell apoptosis was analyzed by flow cytometry. MH7A cells stimulating with interleukin‐1β (IL‐1β) were transfected with miR‐22 mimic. Quantitative real time polymerase chain reaction (qRT‐PCR) and western blot assays were utilized to detect mRNA and protein expression. miR‐22 targets were predicted and validated by Targetscan and luciferase reporter assay. We revealed that miR‐22 showed downregulated expression in MH7A after stimulation with IL‐1β. Additionally, miR‐22 overexpression suppressed the proliferation and facilitated apoptosis in MH7A cells. IL6R was a target of miR‐22. Besides, miR‐22 overexpression inhibited the expression of IL6R and also suppressed inflammatory pathway NF‐κB. These results indicated that miR‐22 overexpression could restrain the activity of inflammation cells in RA by targeting IL6R and might be concerned with the inhibition of NF‐κB pathway.

Keywords: fibroblast‐like synoviocytes, IL6R, inflammatory injury, miR‐22, NF‐κB signaling pathway, rheumatoid arthritis

1. INTRODUCTION

Rheumatoid arthritis (RA), featured by synovial hyperplasia, inflammatory joints and destruction of cartilage and bone, is a chronic inflammatory, highly prevalent, and systemic autoimmune disease.1, 2 Therefore, unraveling the pathways that influence immune regulation and inflammation regression are a major concern for better understanding the pathophysiology of RA and designing new methods for treating this serious joint disease.3 A hallmark of RA is the result of persistent synovitis of immune cells continuing into the joints.4 It is reported that the global prevalence of RA is about 0.24%.5 It is clear that the disease can cause joint deformity and destruction, leading to human losing their work ability and even resulting in death.6 Despite significant advances in effective therapy, many RA patients do not respond effectively to current therapies and treatment can cause serious side effects.7 Therefore, it is necessary to find new strategies for the treatment of RA.

MicroRNAs (miRNAs) are highly endogenous, highly conserved, noncoding RNAs that bind to partially complementary sites on target messenger RNA and act as posttranscriptional inhibitors.8 miRNAs are widely present in eukaryotes.9 Following binding to the 3′ untranslated region (3′‐UTR) within the target mRNA, miRNAs act a negative effect in the expression of gene by regulating polyadenylation, translation and transcript.10 miRNAs are actively used as candidates for the treatment of various diseases, including fibrotic, metabolic, cancer, and inflammatory diseases.11, 12 miR‐22, a 22 nucleotide noncoding RNA, is originally cloned into HeLa cells.13 According to recent reports, miR‐22 overexpression can suppress the inflammation process of RA via regulating the mutation of p53 in synoviocytes.14 Fan et al15 indicated that 1,25‐(OH)2D3 inhibited the proliferation of fibroblast‐like synoviocytes and by downregulating miR‐22 to attenuate the inflammatory response in RA rats. In addition, miR‐22 shows anti‐apoptotic effects in Huntington's disease and myocardial ischemia/reperfusion injury.16, 17 Although there is some evidence to implicate that miR‐22 had a role in RA synovium, the underlying mechanism in regulating RA is still not well‐illustrated.

In this report, we intended to identify the effect of miR‐22 on synovial inflammatory cell activity in RA and therein potential mechanism of action.

2. MATERIALS AND METHODS

2.1. Cell culture and IL‐1β stimulation

Human fibroblast‐like synoviocytes (FLS) cells MH7A were obtained from ScienCell Research Laboratories, Inc. (Carlsbad, CA). The cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) with 10% fetal bovine serum (FBS) in an atmosphere supplemented with 5% CO2 at 37°C. As indicated, IL‐1β at 1, 5, 10 ng/mL induces MH7A cells to mimic the local inflammation of RA.

2.2. Cell transfection

MiR‐22 mimic and its negative control (NC) were purchased from RiboBio (Guangzhou, China). MH7A cells were conventionally cultured in 24‐well plates. When they reached 80% mixedness, the cells were transfected with miR‐22 mimic and its control utilizing Lipofectamine 2000 reagents (Invitrogen), according to the supplier's instructions. The concentration of transfection was 50 nm, and the solution was changed after 6 hours transient transfer. After 48 hours, the cells were collected to QPCR for verification.

2.3. Cell counting kit‐8

The viability of FLS cells was determined by using Cell counting kit‐8 (CCK‐8) (Sigma). Then, 100‐μL cell suspension was taken, and 1 × 103 cells/well were placed in 96‐well plates. The cells were allowed to cultivate for 12, 24, 48, and 72 hours. Then each well was added with 10 μL of CCK8 reagent, followed by incubation for 1.5 hours in 37°C incubator. The absorbance at 450 nm was measured by a microplate reader (Biotek, Winooski, Vermont) and plot the viability curve.

2.4. Apoptosis rate detection

After 48 hours transfection, cells were resuspended by adding Annexin V‐ binding buffer to adjust the cell density to 1‐5 × 106/ml and mixed with 5 μL of Annexin V/FITC, and incubated for 5 minutes in the dark at room temperature. Cells were then washed twice, and added 10 μL of propidium iodide (PI) stain. Finally, flowjo software was used to analyze the results.

2.5. Luciferase UTR reporter assays

To verify the targeting relationship between miR‐22 and IL6R, the luciferase activity assay was conducted. The 3′‐UTR of IL6R containing the predicted target sites of miR‐22 or containing the mutant binding sites were synthesized and cloned into pmir‐RB‐REPORTTM luciferase vector to build the wild type IL6R (IL6R‐WT) or mutant type IL6R (IL6R‐Mut) reporter. Then, the reporters were co‐transfected with miR‐22 mimic and miR‐22 mimic NC into MH7A cells. Then, 48 hours after co‐transfection, the luciferase activity was analyzed utilizing a dual luciferase reporter assay kit (Promega) according to the manufacturer's instruction.

2.6. Quantitative reverse transcription PCR

After transfection for 48 hours, total RNA was extracted utilizing TRIzol (Invitrogen). PrimeScript RT Reagent Kit (Takara) was used to reverse total RNA transcribed into cDNA. SYBR Premix Ex Taq II (TaKaRa) was applied to detect mRNA expression on a 7500 real‐time PCR machine. The process of qRT‐PCR was as follows: 95°C 5 minutes, 95°C 30 seconds, 40 cycles, 60°C 45 seconds, 72°C 30 minutes, each group has a set of three duplicate wells. The relative quantification of the value was detected by utilizing the 2‐ΔΔCt method and U6 was used as an internal control for miRNA detection.18 GAPDH was used as an internal reference for mRNA detecting.19 The primer sequences are as follows:

RT Primer:

U6: 5′‐CGCTTCACGAATTTGCGTGTCAT‐3′

miR‐22: 5′‐GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAACTGT‐3′

qRT‐PCR primer:

miR‐22: F: 5′‐GGAAGCTGCCAGTTGAAG ‐3′,

R: 5′‐ CAGTGCGTGTCGTGGAGT‐3′;

U6: F: 5′‐GCTTCGGCAGCACATATACTAAAAT‐3′,

R: 5′‐CGCTTCACGAATTTGCGTGTCAT‐3′.

IL6R: F: 5′‐ ACGCCTTGGACAGAATCCAG‐3′

R: 5′‐ GAATCTTGCACTGGGAGGCT‐3′

GAPDH: F: 5′‐TGTGTCCGTCGTGGATCTGA‐3′

R: 5′‐CCTGCTTCACCACCTTCTTGA‐3′

2.7. Protein extraction and western blotting

After transfection for 48 hours, the 6‐well plate were placed on ice, and the protein was extracted by RIPA lysate (with protease inhibitor), and the concentration was measured by BCA protein assay kit (Thermo Scientifc). The 15% SDS‐PAGE was used to resolve total protein from each sample. Then the total protein was transferred to PVDF membrane, and analyzed by western blotting. The membrane was blocked by 5% fat‐free milk for 1 hour, and then incubated with primary antibody for 4°C overnight, washed with tris‐buffered saline containing 0.1% Tween‐20 (TBST; Beijing Solarbio Science & Technology Co., Ltd.) for 3 × 5 minutes, and then incubated with secondary antibodies at room temperature for 1 hour. The QUANTITY ONE software was used to scan the gray value. β‐Actin was used as the internal control, and the target protein/internal reference to calculate the relative expression of each protein.

2.8. Antibodies

Primary antibodies were used as follows: rabbit anti‐human Bcl‐xl (1:1000, Proteintech Group, Inc., PTG), Bax (1:1000, PTG), Cleaved Caspase‐9 (1:1000, PTG), IκBα (1:1000, PTG), p‐IκBα (1:1000, PTG), IL6R (1:1000, PTG), NF‐κB p65 (1:1000, PTG), p‐NF‐κB p65 (1:1000, PTG). β‐Actin (1:5000, PTG) was used as control. The secondary antibody was HRP‐labeled goat anti‐rabbit (1:5000, PTG).

2.9. Statistical analyses

Date are expressed as means ± SD and analyzed using SPSS version 18 (SPSS, Chicago, Illinois). Student's t‐test was used to analyze changes in experimental results between two groups. Analysis of variance (ANOVA) with Dunnett t‐test was performed for multiple comparisons. Differences with **P < .01 were considered significant.

3. RESULTS

3.1. Over‐expression of miR‐22 suppresses synovial inflammatory cell activity in IL‐1β‐induced MH7A cells

According to the results of qRT‐PCR, the expression level of miR‐22 was inhibited by IL‐1β, and the greater the concentration of IL‐1β, the more obvious the inhibitory effect (Figure 1A). As illustrated on Figure 1B, miR‐22 expression lever was significantly increased after adding miR‐22 mimic. Conversely, based on the B chart, the expression lever of miR‐22 was significantly decreased after adding IL‐1β (Figure 1C) and miR‐22 mimic addition also caused to a significant increase level of miR‐22 in IL‐1β groups. Compared with the control group, the IL‐1β + NC group had an increased viability rate at 24, 48, 72 hours (Figure 1D). Compared with the IL‐1β + miR‐22 mimic NC group, the IL‐1β + miR‐22 mimic group had a decreased viability rate at 24, 48, 72 hours (Figure 1D). These results would seem to suggest that the miR‐22 overexpression could inhibit synovial inflammatory cell activity in IL‐1β induced inflammatory synovial cell.

Figure 1.

Figure 1

Open in a new tab

Down‐regulated expression of miR‐22 in IL‐1β‐induced MH7A cells. (A) The expression lever of miR‐22 tested by qRT‐PCR after different concentrations of IL‐1β‐induced MH7A. (B) Comparison of the miR‐22 expression lever tested by qRT‐PCR after adding miR‐22 mimic. (C) Comparison of the miR‐22 expression lever tested by qRT‐PCR after adding miR‐22 mimic+IL‐1β. (D) Relative cell viability of MH7A treated with six diffferent groups (control, IL‐1β + NC, IL‐1β + miR‐22 mimic NC, IL‐1β + miR‐22 mimic, miR‐22 mimic NC and miR‐22 mimic) was tested by CCK8 assay at 24, 48, 72 hours. N = 5, **P < .01 compared with control group. ##P < .01 compared with IL‐1β + miR‐22 mimic NC group

3.2. MiR‐22 over‐expression accelerates MH7A cell apoptosis

Compared to the control group, IL‐1β decreased inflammatory synovial cell apoptosis, of note, miR‐22 mimic treatment attenuated this effect (Figure 2A,B). Consistent with the flow cytometric results, the expression of Bcl‐xl (an anti‐apoptotic protein) increased, and the expression of Bax and Cleaved Caspase‐9 (the pro‐apoptotic proteins) decreased in IL‐1β group in contrast with sham group, while miR‐22 mimic addition reversed them by reducing Bcl‐xl and upregulating Bax and Cleaved Caspase‐9 expressions (Figure 2C, D). Taken together, the evidence from these results suggest that miR‐22 overexpression might promote IL‐1β‐treated MH7A cell apoptosis.

Figure 2.

Figure 2

Open in a new tab

Comparison of cell apoptosis among the four groups. (A, B) MH7A cells, treated with IL‐1β and miR‐22 mimic, were showed by representative flow charts (A) and quantification (B). Q1 are cells under necrosis, Q2 are late apoptotic cells, Q3 are cells under apoptosis and Q4 are region denotes live cells. (C,D) The expression levels of apoptosis‐related proteins were showing by western blot analysis(C) and quantification (D). N = 5, **P < .01 compared with control group. ##P < .01 compared with IL‐1β + NC group

3.3. The influence of miR‐22 on IL6R

The potential target site between miR‐22 and IL6R was predicted by Targetscan (Figure 3A). miR‐22 mimic inhibited the activity of WT luciferase reporter (Figure 3B). However, there are no obvious difference between miR‐22 mimic and its control group about Mut miR‐22 effect on reporter activity (Figure 3B). The expression level of IL6R was dramatically increased in IL‐1β groups. However, the expression level of IL6R was decreased after transfection with miR‐22 mimic (Figure 4). The findings from these studies suggested that miR‐22 could bind to regulator of IL6R and might relate with the inflammation of RA by regulating the expression of IL6R.

Figure 3.

Figure 3

Open in a new tab

miR‐22 targets the 3′‐UTR of IL6R. (A) The potential binding sites between miR‐22 and IL6R. (B) Luciferase reporter activity in MH7A cells transfected with WT, MUT 3′‐UTR of IL6R. N = 5, **P < .01 compared with miR‐22 mimic NC group

Figure 4.

Figure 4

Open in a new tab

The influence of miR‐22 on IL6R expression. (A) The expression level of IL6R in MH7A tested by qRT‐PCR transfected with IL‐1β + NC, IL‐1β + miR‐22 mimic NC, IL‐1β + miR‐22 mimic. (B) Analysis of IL6R protein expression in IL‐1β + NC, IL‐1β + miR‐22 mimic NC, IL‐1β + miR‐22 mimic treated MH7A via western blot. (C) Quantification of IL6R protein expression levels. N = 5, **P < .01, compared with control group. ##P < .01 compared with IL‐1β + NC group

3.4. miR‐22 over‐expression restraining RA inflammatory injury might be related to the inactivation of NF‐κB pathway

We selected the p65 and IκBα proteins as indicators to evaluate the activity of the NF‐κB signaling pathway after miR‐22 transfection. The western blot results showed that p‐p65 and p‐IκBα increased significantly in IL‐1β groups compared with control group, conversely, the expression levels of p‐p65 and p‐IκBα were decreased in inflammatory synovial cell after transfected with miR‐22 mimic (Figure 5). These results suggested that up‐regulation of miR‐22 suppressing RA inflammatory injury might be associatedwith the inactivation of NF‐κB pathway.

Figure 5.

Figure 5

Open in a new tab

Effects of miR‐22 on the NF‐κB signaling pathway in MH7A cells. (A) the expression levels of p65, p‐p65, IκBα and p‐IκBα were measured in MH7A cells transfection with miR‐22. (B) The relative protein levels of p65, p‐p65, IκBα and p‐IκBα. N = 5, **P < .01, compared with control group. ##P < .01 compared with IL‐1β + NC group

4. DISCUSSION

In this study, miR‐22, a 22 nucleotide non‐coding RNA, was preliminarily tested to determine its anti‐inflammatory effect and the underlying molecular mechanism on RA. Specifically, we showed that miR‐22 over‐expression could inhibit FLS cell line MH7A cells proliferation and promote cell apoptosis induced by IL‐1β. Besides, the findings of this study suggest that the effects of miR‐22 on MH7A were related to targeting IL6R and might be associated with the inhibition of NF‐κB signaling pathway.

Our results indicated that miR‐22 over‐expression inhibited MH7A inflammatory injury in RA by targeting IL6R. Since IL‐6R is a molecule that directly mediates the biological role of IL‐6, it has important clinical significance.20 In fact, IL‐6R has been related to biological pathways in which blood lipids and inflammatory biomarkers are significantly implicated.21 As reported, high expression of IL6R was related to increased plasma concentrations of soluble IL‐6 receptors in RA patients.22 The production of IL‐6 is mainly regulated by transcription factors such as NF‐κB, and its activity is increased during the inflammatory process.23 Recent research has suggested that IL6R was identified as a direct target of miR‐21 and served as a promoter for endothelial progenitor cells (EPCs) proliferation, migration, and invasion.24 Zhang et al. hold the view that miR‐520a‐3p inhibitor could rescue the inhibition of osteosarcoma development by si‐IL6R.25 In line with previous reports, our reports suggested that miR‐22 overexpression suppressed MH7A inflammatory injury in RA by targeting IL6R.

In our study, we also disclosured that miR‐22 overexpression inhibited RA inflammatory injury via nuclear factor kappa B (NF‐κB) pathway. NF‐κB, as a master regulator of the inflammatory response, has been widely used in many inflammatory diseases such as RA.26 According to many in the field, a new miR‐10a/NF‐κB regulatory circuit exists in FLS, which contributes to the over‐activation of NF‐κB pathway and plays a key role in the inflammatory response of RA.27 Recent research has suggested that NF‐κB pathway is affected by a variety of miRNAs.28, 29 There is a large volume of published studies found that miR‐548a‐3p adjusted inflammatory response through NF‐κB pathway in RA.30 Some evidences indicated that miR‐21 improved FLS proliferation via regulation of NF‐κB nuclear translocation in RA.31 It has demonstrated that overexpression of miR‐22 suppressed PI3K/Akt/NF‐κB signaling in tongue squamous cell carcinoma cells.32 NF‐κB has five types of subunits: Rel, RelB, p50, p52, and p65. These five types play major roles in the activation of classical NF‐κB signaling pathway.33 Many scholars hold the view that inhibition of the upstream signal of the NF‐κB p65 pathway significantly weakened the secretion of pro‐inflammatory cytokine such as IL‐1β.34 Many potential Protein kinase CK2 substrates have been noted, among which NF‐κB p65/RelA and its inhibitor IκBα are recognized as substrate proteins.35 Activation of NF‐κB occurs via classical or non‐classical pathways and is dependent on phosphorylation‐induced ubiquitination of the IκB proteins such as IκBα.36 To better clarify the potent of miR‐22 in RA, we evaluated the role of NF‐κB in miR‐22 by detecting NF‐κB p65 and IκBα after transfection miR‐22 mimic and found overexpression of miR‐22 inhibited the activity of p65 and IκBα. Our results demonstrated that miR‐22 overexpression inhibited RA inflammatory injury, which might be inhibited by the activity of NF‐κB pathway.

5. CONCLUSION

In conclusion, our findings revealed that miR‐22 might have a potential effect on inflammatory injury of RA. Meanwhile, our investigations suggested a promising molecular mechanism of miR‐22 modulating synovial inflammatory cell behaviors via targeting IL6R and might be inactivated by NF‐κB pathway. Therefore, this study may provide a novel insight in miR‐22 regulating inflammatory injury and offer an efficient treatment and prediction strategy for RA.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Yang Q‐Y, Yang K‐P, Li Z‐Z. MiR‐22 restrains proliferation of rheumatoid arthritis by targeting IL6R and may be concerned with the suppression of NF‐κB pathway. Kaohsiung J Med Sci. 2020;36:20–26. 10.1002/kjm2.12124

REFERENCES

  • 1. Cai P, Jiang T, Li B, Qin X, Lu Z, Le Y, et al. Comparison of rheumatoid arthritis (RA) and osteoarthritis (OA) based on microarray profiles of human joint fibroblast‐like synoviocytes. Cell Biochem Funct. 2019;37:31–41. [DOI] [PubMed] [Google Scholar]
  • 2. Mantej J, Polasik K, Piotrowska E, Tukaj S. Autoantibodies to heat shock proteins 60, 70, and 90 in patients with rheumatoid arthritis. Cell Stress Chaperones. 2019;24:283–287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Chen Z, Bozec A, Ramming A, Schett G. Anti‐inflammatory and immune‐regulatory cytokines in rheumatoid arthritis. Nat Rev Rheumatol. 2019;15:9–17. [DOI] [PubMed] [Google Scholar]
  • 4. Ocsko T, Toth DM, Hoffmann G, Tubak V, Glant TT, Rauch TA. Transcription factor Zbtb38 downregulates the expression of anti‐inflammatory IL1r2 in mouse model of rheumatoid arthritis. Biochim Biophys Acta Gene Regul Mech. 2018;1861:1040–1047. [DOI] [PubMed] [Google Scholar]
  • 5. Global Burden of Disease Study C . Global, regional, and national incidence, prevalence, and years lived with disability for 301 acute and chronic diseases and injuries in 188 countries, 1990–2013: A systematic analysis for the global burden of disease study 2013. Lancet. 2015;386:743–800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Choi Y, Arron JR, Townsend MJ. Promising bone‐related therapeutic targets for rheumatoid arthritis. Nat Rev Rheumatol. 2009;5:543–548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Ai R, Laragione T, Hammaker D, Boyle DL, Wildberg A, Maeshima K, et al. Comprehensive epigenetic landscape of rheumatoid arthritis fibroblast‐like synoviocytes. Nat Commun. 2018;9:1921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Liu Z, Chen X, Zhang Z, Zhang X, Saunders L, Zhou Y, et al. Nanofibrous spongy microspheres to distinctly release miRNA and growth factors to enrich regulatory T cells and rescue periodontal bone loss. ACS Nano. 2018;12:9785–9799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Prabahar A, Natarajan J. MicroRNA mediated network motifs in autoimmune diseases and its crosstalk between genes, functions and pathways. J Immunol Methods. 2017;440:19–26. [DOI] [PubMed] [Google Scholar]
  • 10. Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–297. [DOI] [PubMed] [Google Scholar]
  • 11. Soroosh A, Koutsioumpa M, Pothoulakis C, Iliopoulos D. Functional role and therapeutic targeting of microRNAs in inflammatory bowel disease. Am J Physiol Gastrointest Liver Physiol. 2018;314:G256–G262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Wang X, Meng Q, Qiao W, Ma R, Ju W, Hu J, et al. miR‐181b/Notch2 overcome chemoresistance by regulating cancer stem cell‐like properties in NSCLC. Stem Cell Res Ther. 2018;9:327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Liu M, Wang SM, Jiang ZX, Lauren H, Tao LM. Effects of miR‐22 on viability, migration, invasion and apoptosis in retinoblastoma Y79 cells by targeting high‐mobility group box 1. Int J Ophthalmol. 2018;11:1600–1607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Lin J, Huo R, Xiao L, Zhu X, Xie J, Sun S, et al. A novel p53/microRNA‐22/Cyr61 axis in synovial cells regulates inflammation in rheumatoid arthritis. Arthritis Rheumatol. 2014;66:49–59. [DOI] [PubMed] [Google Scholar]
  • 15. Fan P, He L, Hu N, Luo J, Zhang J, Mo LF, et al. Effect of 1,25‐(OH)2D3 on proliferation of fibroblast‐like Synoviocytes and expressions of pro‐inflammatory cytokines through regulating MicroRNA‐22 in a rat model of rheumatoid arthritis. Cell Physiol Biochem. 2017;42:145–155. [DOI] [PubMed] [Google Scholar]
  • 16. Yang J, Chen L, Yang J, Ding J, Li S, Wu H, et al. MicroRNA‐22 targeting CBP protects against myocardial ischemia‐reperfusion injury through anti‐apoptosis in rats. Mol Biol Rep. 2014;41:555–561. [DOI] [PubMed] [Google Scholar]
  • 17. Jovicic A, Zaldivar Jolissaint JF, Moser R, Silva Santos Mde F, Luthi‐Carter R. MicroRNA‐22 (miR‐22) overexpression is neuroprotective via general anti‐apoptotic effects and may also target specific Huntington's disease‐related mechanisms. PLoS ONE. 2013;8:e54222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. He M, Gong Y, Shi J, Pan Z, Zou H, Sun D, et al. Plasma microRNAs as potential noninvasive biomarkers for in‐stent restenosis. PLoS ONE. 2014;9:e112043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Kanno Y, Ishisaki A, Kawashita E, Chosa N, Nakajima K, Nishihara T, et al. Plasminogen/plasmin modulates bone metabolism by regulating the osteoblast and osteoclast function. J Biol Chem. 2011;286:8952–8960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Tamura Y, Phan C, Tu L, Le Hiress M, Thuillet R, Jutant EM, et al. Ectopic upregulation of membrane‐bound IL6R drives vascular remodeling in pulmonary arterial hypertension. J Clin Invest. 2018;128:1956–1970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Zegeye MM, Lindkvist M, Falker K, Kumawat AK, Paramel G, Grenegard M, et al. Activation of the JAK/STAT3 and PI3K/AKT pathways are crucial for IL‐6 trans‐signaling‐mediated pro‐inflammatory response in human vascular endothelial cells. Cell Commun Signal. 2018;16:55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Rodriguez‐Rodriguez L, Lamas JR, Varade J, Lopez‐Romero P, Tornero‐Esteban P, Abasolo L, et al. Plasma soluble IL‐6 receptor concentration in rheumatoid arthritis: Associations with the rs8192284 IL6R polymorphism and with disease activity. Rheumatol Int. 2011;31:409–413. [DOI] [PubMed] [Google Scholar]
  • 23. Topchieva LV, Kurbatova IV, Dudanova OP, Sokolovskaya AA, Shipovskaya AA. IL6R gene polymorphic variant rs2228145(C >a) as a marker of genetic liability to nonalcoholic Steatohepatitis in the Russian population of Karelia. Bull Exp Biol Med. 2018;165:64–68. [DOI] [PubMed] [Google Scholar]
  • 24. Wang W, Yuan X, Xu A, Zhu X, Zhan Y, Wang S, et al. Human cancer cells suppress behaviors of endothelial progenitor cells through miR‐21 targeting IL6R. Microvasc Res. 2018;120:21–28. [DOI] [PubMed] [Google Scholar]
  • 25. Zhang B, Yu L, Han N, Hu Z, Wang S, Ding L, et al. LINC01116 targets miR‐520a‐3p and affects IL6R to promote the proliferation and migration of osteosarcoma cells through the Jak‐stat signaling pathway. Biomed Pharmacother. 2018;107:270–282. [DOI] [PubMed] [Google Scholar]
  • 26. Min SY, Yan M, Du Y, Wu T, Khobahy E, Kwon SR, et al. Intra‐articular nuclear factor‐kappaB blockade ameliorates collagen‐induced arthritis in mice by eliciting regulatory T cells and macrophages. Clin Exp Immunol. 2013;172:217–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Mu N, Gu J, Huang T, Zhang C, Shu Z, Li M, et al. A novel NF‐kappaB/YY1/microRNA‐10a regulatory circuit in fibroblast‐like synoviocytes regulates inflammation in rheumatoid arthritis. Sci Rep. 2016;6:20059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Zheng D, Zang Y, Xu H, Wang Y, Cao X, Wang T, et al. MicroRNA‐214 promotes the calcification of human aortic valve interstitial cells through the acceleration of inflammatory reactions with activated MyD88/NF‐kappaB signaling. Clin Res Cardiol. 2019;108:691–702. [DOI] [PubMed] [Google Scholar]
  • 29. Lin C, Zong J, Lin W, Wang M, Xu Y, Zhou R, et al. EBV‐miR‐BART8‐3p induces epithelial‐mesenchymal transition and promotes metastasis of nasopharyngeal carcinoma cells through activating NF‐kappaB and Erk1/2 pathways. J Exp Clin Cancer Res. 2018;37:283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Wang Y, Zheng F, Gao G, Yan S, Zhang L, Wang L, et al. MiR‐548a‐3p regulates inflammatory response via TLR4/NF‐kappaB signaling pathway in rheumatoid arthritis. J Cell Biochem. 2018. [DOI] [PubMed] [Google Scholar]
  • 31. Chen Y, Xian PF, Yang L, Wang SX. MicroRNA‐21 promotes proliferation of fibroblast‐like Synoviocytes through mediation of NF‐kappaB nuclear translocation in a rat model of collagen‐induced rheumatoid arthritis. Biomed Res Int. 2016;2016:9279078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Gu Y, Hao L, Kong F, Ye J, Jia X, Zhang Z, et al. miR‐22/KAT6B axis is a chemotherapeutic determiner via regulation of PI3k‐Akt‐NF‐kB pathway in tongue squamous cell carcinoma. J Exp Clin Cancer Res. 2018;37:164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Giridharan S, Srinivasan M. Mechanisms of NF‐kappaB p65 and strategies for therapeutic manipulation. J Inflamm Res. 2018;11:407–419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Liu B, Wu Y, Wang Y, Cheng Y, Yao L, Liu Y, et al. NF‐kappaB p65 Knock‐down inhibits TF, PAI‐1 and promotes activated protein C production in lipopolysaccharide‐stimulated alveolar epithelial cells type II. Exp Lung Res. 2018;44:241–251. [DOI] [PubMed] [Google Scholar]
  • 35. Qaiser F, Trembley JH, Sadiq S, Muhammad I, Younis R, Hashmi SN, et al. Examination of CK2alpha and NF‐kappaB p65 expression in human benign prostatic hyperplasia and prostate cancer tissues. Mol Cell Biochem. 2016;420:43–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Liu B, Sun L, Liu Q, Gong C, Yao Y, Lv X, et al. A cytoplasmic NF‐kappaB interacting long noncoding RNA blocks IkappaB phosphorylation and suppresses breast cancer metastasis. Cancer Cell. 2015;27:370–381. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES