Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2020 May 11;36(9):682–691. doi: 10.1002/kjm2.12226

LncRNA MALAT1 promoted high glucose‐induced pyroptosis of renal tubular epithelial cell by sponging miR‐30c targeting for NLRP3

Chan Liu 1, Hui Zhuo 1, Mu‐Yao Ye 2, Gu‐Xiang Huang 1, Min Fan 1, Xian‐Zhe Huang 3,✉
PMCID: PMC11896152  PMID: 32391974

Abstract

Diabetic nephropathy (DN), characterized by the chronic loss of kidney function during diabetes, is a long‐term kidney disease that affects millions of populations. However, the etiology of DN remains unclear. DN cell model was established by treating HK‐2 cells with high glucose (HG) in vitro. Expression of metastasis‐associated lung adenocarcinoma transcript‐1 (MALAT1), miR‐30c, nucleotide binding and oligomerization domain‐like receptor protein 3 (NLRP3), caspase‐1, IL‐1β, and IL‐18 in treated HK‐2 cells were tested by quantitative polymerase chain reaction. HK‐2 cell pyroptosis was assessed using flow cytometry analysis. Lactate dehydrogenase (LDH) activity was examined with a LDH assay kit. Correlation among MALAT1, miR‐30c, and NLRP3 was examined via dual‐luciferase reporter assay. Here, we revealed that MALAT1 was upregulated, but miR‐30c was downregulated in HG‐treated HK‐2 cells, leading to upregulation of NLRP3 expression and cell pyroptosis. Knockdown of MALAT1 or overexpression of miR‐30c protected HK‐2 cells from HG‐induced pyroptosis. Meanwhile, we found that MALAT1 promoted NLRP3 expression by sponging miR‐30c through dual‐luciferase reporter assay. Moreover, the co‐transfection of sh‐MALAT1 and miR‐30c inhibitor could reverse the protective effects of the sh‐MALAT1 on the HG‐induced pyroptosis. These results confirmed that MALAT1 regulated HK‐2 cell pyroptosis by inhibiting miR‐30c targeting for NLRP3, contributing to a better understanding of DN pathogenesis and help to find out the effective treatment for DN.

Keywords: diabetic nephropathy, MALAT1, miR‐30c, NLRP3, pyroptosis

1. INTRODUCTION

Diabetic nephropathy (DN) is a most frequent microvascular complication of the diabetes mellitus (DM) with a high mortality.1, 2, 3 The DN has been reported to be caused by many factors, such as genetic factors and activation of the polyol pathway; however, its pathogenesis is still not clear.4, 5, 6 Fully understanding the pathogenesis of DN could help to find out its effective treatment.

Currently, inflammation, as an important pathogenic factor of DN, has attracted a lot of attention. 7 High glucose (HG) environment of the DM can induce the pro‐inflammatory responses through the overexpression of cellular NF‐κB and macrophage infiltration. In the pro‐inflammatory environment, a large amount of inflammatory cytokines are released and immune cells accumulate and infiltrate in renal tissue, causing further synthesis of pro‐inflammatory cytokines and pyroptosis. 8 However, the molecular mechanisms that modulate inflammatory process in DN are still not clear. Nucleotide binding and oligomerization domain like receptor protein 3 (NLRP3) is one of the inflammasome corpuscles located in cells. It can activate caspase‐1 and indirectly regulate the secretion of IL‐1β and IL‐18, resulting in inflammatory reaction and pyroptosis.9, 10 Therefore, NLRP3 plays an important role in renal tubular epithelial cell pyroptosis in DN. 11

miRNAs (microRNAs) are a class of single‐stranded RNAs that consisted of 22 nucleotides (nt) and encoded by endogenous genes. Several studies have reported that microRNAs play a key role in regulating biological processes.12, 13, 14, 15 For example, miR‐30c has been demonstrated to protect DN by repressing epithelial‐to‐mesenchymal transition in db/db mice. 16 In addition, it was predicted by an online tool (http://www.microrna.org/microrna/home.do) that miR‐30c had targeting sites for NLRP3. Therefore, miR‐30c was closely related to NLRP3 expression. Long noncoding RNAs (lncRNAs) are another important noncoding RNA that consist of over 200 nt. They are also involved in diverse physiological processes, such as epigenetic regulation, cell cycle regulation, and cell differentiation regulation.17, 18 Studies demonstrated that lncRNA metastasis‐associated lung adenocarcinoma transcript‐1 (MALAT1) was increased in the rats with DM and HG‐treated HK‐2 cells, and downregulating the MALAT1 can inhibit the cell pyroptosis. 19 Moreover, according to the analysis results from Starbase (Version 2.0, http://starbase.sysu.edu.cn/index.php) that MALAT1 has targeting sites for miR‐30c.

Taken together, previous studies have shown the important roles of MALAT1 and miR‐30c. Moreover, considering the bioinformatics results, we speculated that the interaction among MALAT1, miR‐30c, and NLRP3 might play a role in the pathogenesis of DN. Therefore, we aim to study the roles of MALAT1, miR‐30c, and NLRP3 in regulating HK‐2 cell pyroptosis in DN and figure out whether MALAT1 promotes HK‐2 cell pyroptosis by inhibiting miR‐30c targeting for NLRP3 in DN.

2. METHODS

2.1. Cell culture

Human proximal tubular epithelial cell line (HK‐2), obtained from ATCC, was maintained in RPMI 1640 medium (Life Technologies, Carlsbad, California) supplemented with 10% fetal calf serum (F2442; Sigma, St. Louis, Missouri) in 5% carbon dioxide. The HK‐2 cells cultured with normal (5 mM, NG) or high (40 mM, HG) glucose, or osmotic control (5 mM glucose and 35 mM mannitol, OH) for 48 hours after starvation for 24 hours in serum‐free medium.

2.2. RNA extraction and quantitative polymerase chain reaction

The total RNA of HK‐2 cells was isolated by TRIzol reagent (DP424; Tiangen Biotech, Beijing, China) according to the protocols provided by the manufacturer. After testing the quality, the extracted RNA was reverse‐transcribed into cDNA using a Reverse Transcription kit (RR037B; TaKaRa, Japan). The PCR process was performed using a SYBR quantitative polymerase chain reaction (qPCR) Master Mix kit (4 334 973; Thermo Fisher Scientific, Waltham, Massachusetts) according to the instructions on a Bio‐Rad iCycler system (Bio‐Rad, Hercules, California). The primers used in the present study were summarized in Table 1. GAPDH or U6 was applied as internal control and the relative gene expressions were counted using the 2‐△△Ct method.

TABLE 1.

Primer sequences

Name Sequence (5′‐3′)
MALAT1‐F AAAGCAAGGTCTCCCCACAAG
MALAT1‐R GGTCTGTGCTAGATCAAAAGGCA
miR‐30c‐F GCCGCTGTAAACATCCTACACT
miR‐30c‐R GTGCAGGGTCCGAGGT
NLRP3‐F AAGGCCGACACCTTGATATG
NLRP3‐R CCGAATGTTACAGCCAGGAT
Caspase‐1‐F CTCAGGCTCAGAAGGGAATG
Caspase‐1‐R CGCTGTACCCCAGATTTTGT
IL‐1β‐F CTGAGCTCGCCAGTGAAATG
IL‐1β‐R TGTCCATGGCCACAACAACT
IL‐18‐F TGGCTGCTGAACCAGTAGAA
IL‐18‐R ATAGAGGCCGATTTCCTTGG
GAPDH‐F CCAGGTGGTCTCCTCTGA
GAPDH‐R GCTGTAGCCAAATCGTTGT
U6‐F CTCGCTTCGGCAGCACA
U6‐R AACGCTTCACGAATTTGCGT
Open in a new tab

2.3. The measurement of lactate dehydrogenase

The lactate dehydrogenase (LDH) assay kit (K313; Biovision, Tucson, Arizona) was used to measure the activity of LDH in the culture medium for the evaluation of cell damage. The 10 μL of culture medium was collected and subjected to the analysis of the LDH assay kit.

2.4. Cell pyroptosis detected by flow cytometry

Cell pyroptosis was investigated by Carboxyfluorescein‐fluorochrome inhibitor of caspases (FAM‐FLICA) in vitro Caspase‐1 Detection Kit (#98, ImmunoChemistry, Bloomington, Minnesota) by flow cytometry according to manufacturer's instruction. The 5 × 105 cells were harvested by trypsinization and washed with phosphate‐buffered saline. Then collected cells were incubated with carboxyfluorescein‐tyrosylvalylalanylaspartate‐fluoromethyl ketone (FAM‐YVAD‐FMK) at 37°C for 1 hour in the dark. After centrifugation, the supernatant was removed by aspiration and the cell pellet was washed with buffer twice. Cells were respuspended in PI staining buffer and kept on ice. After 15 minutes, the stained cells were detected by flow cytometry (BD Biosciences, San Jose, California).

2.5. Western blotting

The cells were lysed on ice for 1 hour using RIPA buffer (R0010; Solarbio, Beijing, China) and then the total proteins were extracted through high‐speed centrifugation (12 000 rpm, 15 minutes). The concentration of total proteins was examined via a bicinchoninic acid (BCA) kit (P0011; Beyotime, Shanghai, China). Next, 50 μg protein samples were isolated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred to a polyvinylidene fluoride membrane. After incubated with the primary antibodies against NLRP3 (1:2000; ab263899, Abcam, UK), caspase‐1 (1:1000; ab238979, Abcam), IL‐1β (sc‐52 771, 1:500, Santa Cruz), IL‐18 (PA5‐79479; 1:500, Invitrogen, Carlsbad, California) overnight, the membranes were incubated with corresponding secondary antibodies (1:200, Santa Cruz) for 2 hours. The signals were visualized using an enhanced chemiluminescence kit and analyzed with the ImageJ software (National Institutes of Health Software, Bethesda, Maryland).

2.6. Dual‐luciferase reporter assay

The MALAT1 fragments containing wild‐type (WT) potential binding sites of miR‐30c and corresponding mutant‐type fragments (MUT) were amplified and inserted into psiCHECK‐2 plasmid (E2231; Promega, Madison, Wisconsin). Similarly, the WT fragment from the NLRP3 3′‐untranslated region (UTR) (NLRP3‐WT) and the corresponding MUT fragment (NLRP3‐MUT) were cloned into psiCHECK‐2 plasmid vector to generate the NLRP3 3′‐UTR luciferase reporter construct. Next, the vectors and miR‐30c mimics were co‐transfected into HK‐2 cells. After 48 hours of culture, the luciferase intensity was measured using the Dual‐Luciferase Reporter Assay System (E1910; Promega).

2.7. Cell transfection

The sh‐MALAT1, miR‐30c mimics and inhibitor, as well as their negative control (sh‐NC, miR‐NC), were all provided by GenePharma Co., Ltd (Shanghai, China). HK‐2 cells were transfected with corresponding oligonucleotides using Lipo 2000 reagent. After transfection, cells were incubated under normal conditions or incubated under HG condition.

2.8. Statistics

The experiments were performed three times and the data were expressed as mean ± SD. Unpaired two‐tailed Student t test was used to compare the difference between two groups. One‐way analysis of variance followed by Tukey's post hoc test was used for multiple comparisons. The data obtained in this study were statistically processed using the SPSS software (Version 17.0, Chicago, Illinois).

3. RESULTS

3.1. HG treatment promoted HK‐2 cell pyroptosis

To explore the pathogenesis of DN, we established a cell model of DN by treating the HK‐2 cells with 40 mM glucose, the HK‐2 cells growing under normal conditions were used as control group and those cells growing under 40 mM mannitol were used as an osmotic control. First, the influences of HG treatment on HK‐2 cell pyroptosis were evaluated by flow cytometry analysis. Different concentrations of HG treatment (10, 20, 30, 40, and 50 mM) remarkably promoted the HK‐2 cell pyroptosis (Figure 1A); moreover, we found that after 12, 24, 48, and 72 hours of 40 mM HG treatment, the HK‐2 cell pyroptosis was significantly upregulated (Figure 1B). Next, the cell samples were subjected to the qPCR for the determination of the expression levels of MALAT1, miR‐30c, NLRP3, caspase‐1, IL‐1β, and IL‐18. As results indicated that the MALAT1 (Figure 1C), NLRP3 (Figure 1D), caspase‐1 (Figure 1E), IL‐1β (Figure 1F), and IL‐18 (Figure 1G) were overexpressed in the HG group; however, for miR‐30c, the decreased expression was observed (Figure 1C). Then, the LDH assay kit was used for the determination of the LDH released into the cell culture medium. As results indicated that the LDH level was increased after the cells incubated with HG (Figure 1H). In addition, Western blotting was utilized to examine the production of NLRP3, caspase‐1, IL‐1β, and IL‐18 in HK‐2 cells under HG condition. The results demonstrated that the expressions of the above proteins were all upregulated (Figure 1I,J), which was consistent with the results obtained from the qPCR. All these results indicated that the HG treatment could upregulate the production of NLRP3, caspase‐1, IL‐1β, IL‐18, and LDH and, meanwhile, it could lead to the cell pyroptosis and miR‐30c downregulation.

FIGURE 1.

FIGURE 1

Open in a new tab

Influence of HG on the pyroptosis of renal tubular epithelial cell. Flow cytometry analysis showed the influences of deferent concentration of glucose, A, and deferent time on the pyroptosis of HK‐2 cells. B, Quantitative polymerase chain reaction analysis of MALAT1 and miR‐30c, C, NLRP3 mRNA, D, caspase‐1 mRNA, E, IL‐1β mRNA, F, and IL‐18, G, mRNA in HK‐2 cells cultured under HG. H, LDH level was examined in HK‐2 cells cultured under HG by LDH assay kit. I‐J, Protein expression of NLRP3, caspas‐1, IL‐1β and IL‐18 were tested in HK‐2 cells treated with HG using Western blot assay. *P < .05, **P < .01, ***P < .001. HG, high glucose; LDH, lactate dehydrogenase

3.2. Results of dual‐luciferase reporter gene assay

The dual‐luciferase reporter gene assay was carried out to figure out the interplay between MALAT1 and miR‐30c, miR‐30c, and NLRP3. The expression level of MALAT1 was detected by qPCR in HK‐2 cells transfected with sh‐MALAT1 (Figure 2A), and the expression level of miR‐30c was also assessed after transfected with miR‐30c mimics or inhibitor (Figure 2B). The targeting sites were shown in Figure 2C,D. To confirm the interaction between miR‐30c and MALAT1, the MALAT1 fragments containing the WT or mutant miR‐30c target site were subcloned into the reporter plasmid. The MALAT1‐WT or MALAT1‐MUT recombinant plasmids were co‐transfected with mimics NC or miR‐30c mimics into HK‐2 cells, and then the luciferase activity of HK‐2 cells was detected. As results indicated, transient co‐transfection of the MALAT1‐WT and miR‐30c mimics caused an obvious decrease in the luciferase activity of HK‐2 cells; however, the luciferase activity of the MALAT1‐MUT and miR‐30c mimics co‐transfected HK‐2 cells was not affected (Figure 2E). The same procedures were carried out to verify the interplay between NLRP3 and miR‐30c. Co‐transfected HK‐2 cells with NLRP3‐WT and miR‐30c mimics resulted in a significant inhibition of luciferase activity; however, no significant effects were observed in the HK‐2 cells treated with NLRP3‐MUT and miR‐30c mimics (Figure 2F). These results demonstrated that MALAT1 and NLRP3 could be targeted by miR‐30c in HK‐2 cells.

FIGURE 2.

FIGURE 2

Open in a new tab

Results of dual‐luciferase reporter gene assay. A, QPCR measure of MALAT1 in HK‐2 cells transfected with sh‐MALAT1. B, QPCR assessment of miR‐30c transfected with miR‐30c mimics or inhibitor. C, Sequence alignment between MALAT1 and miR‐30c. D, Sequence alignment between miR‐30c and NLRP3. E, Verification of the interaction between MALAT1 and miR‐30c in HK‐2 cells using dual‐luciferase reporter experiment. F, Verification of the interaction between NLRP3 and miR‐30c in HK‐2 cells using dual‐luciferase reporter experiment. *P < .05, **P < .01. QPCR, quantitative polymerase chain reaction

3.3. MALAT1 knockdown protected HK‐2 cells from HG‐induced pyroptosis

To investigate whether MALAT1 has a role in the HK‐2 cell pyroptosis caused by HG, shRNA was generated to knockdown MALAT1 in HK‐2 cells treated with HG. We first assessed the influences of MALAT1 silencing on the expression levels of MALAT1, miR‐30c, NLRP3, caspase‐1, IL‐1β, IL‐18, and LDH under HG condition. As results indicated that the HG treatment induced upregulation of MALAT1, NLRP3, caspase‐1, IL‐1β, IL‐18, and LDH, as well as downregulation of miR‐30c, were reversed by MALAT1 knockdown (Figure 3A‐G). We, subsequently, assessed the influences of MALAT1 silencing on the HG caused promotion of HK‐2 cell pyroptosis via flow cytometry analysis. MALAT1 knockdown also reversed the HG‐induced HK‐2 pyroptosis (Figure 3H,I). Moreover, consistent with the qPCR results, MALAT1 knockdown could also reverse the HG‐induced upregulation of protein expression levels of NLRP3, caspase‐1, IL‐1β, and IL‐18 in HK‐2 cells (Figure 3J,K). These phenomena indicated that the MALAT1 knockdown could lead to the upregulation of the miR‐30c and downregulation of NLRP3, thereby inhibiting the HG induced pyroptosis.

FIGURE 3.

FIGURE 3

Open in a new tab

Influences of MALAT1 knockdown on the HG caused cell pyroptosis. Quantitative polymerase chain reaction analysis of MALAT1, A, miR‐30c, B, NLRP3 mRNA, C, caspase‐1 mRNA, D, IL‐1β mRNA, E, and IL‐18 mRNA, F in MALAT1 silenced HK‐2 cells cultured under HG condition, G, LDH level was detected in the HK‐2 cells transfected with sh‐MALAT1 in HG condition by LDH assay kit. H and I, Effects of sh‐MALAT1 on HK‐2 cell pyroptosis were examined with flow cytometry. J and K, Western blotting analysis of NLRP3, caspase‐3, IL‐1β and IL‐18. *P < .05, **P < .01. HG, high glucose; LDH, lactate dehydrogenase

3.4. miR‐30c overexpression protected HK‐2 cells from HG‐induced pyroptosis

To study the influence of miR‐30c overexpression on the HG‐induced pyroptosis, the HK‐2 cells treated with miR‐30c mimics were used as experimental group. All cell samples were subjected to the qPCR, Western blotting, and LDH assay for the determination of the related mRNA and proteins expression levels. Treated HK‐2 cells with miR‐30c mimics under HG condition reversed the HG‐induced reduction in miR‐30c and the increase in NLRP3, caspase‐1, IL‐1β, IL‐18, and LDH (Figure 4A‐F). In the flow cytometry analysis, we demonstrated that miR‐30c overexpression could reverse the HG‐induced HK‐2 cell pyroptosis (Figure 4G,H). Moreover, Western blot assay also confirmed the reversed effects of miR‐30c overexpression on HG‐induced upregulation of protein expression levels of NLRP3, caspase‐1, IL‐1β, and IL‐18 of HK‐2 cells (Figure 4I,J). Taken together, miR‐30c might act as a protector of HK‐2 cells under HG condition.

FIGURE 4.

FIGURE 4

Open in a new tab

Influences of miR‐30c overexpression on the HG caused cell pyroptosis. Quantitative polymerase chain reaction analysis of miR‐30c, A, NLRP3 mRNA, B, caspase‐1 mRNA, C, IL‐1β mRNA, D, and IL‐18 mRNA, E, LDH level, F in the HK‐2 cells transfected with miR‐30c mimics growing under HG condition by LDH assay kit. G and H, Flow cytometry was adopted to test the influences of miR‐30c mimics on HK‐2 cell pyroptosis. I and J, Western blotting was applied to examine the protein levels of NLRP3, caspase‐3, IL‐1β and IL‐18 in miR‐30c overexpressed HK‐2 cells. All data are presented as the mean ± SD from three replicated experiments. *P < .05, **P < .01. HG, high glucose; LDH, lactate dehydrogenase

3.5. miR‐30c inhibition abolished the protective effects of sh‐MALAT1 on HG caused cell pyroptosis

In order to further validate the interplay among MALAT1, miR‐30c, and NLRP3, we investigated the effect of miR‐30c inhibition on the HG caused pyroptosis in MALAT1 silenced HK‐2 cells. After the sh‐MALAT1 and miR‐30c inhibitor were transfected into the HK‐2 cells under HG condition, the NLRP3, caspase‐1, IL‐1β, IL‐18, and LDH levels were evaluated. The NLRP3, caspase‐1, IL‐1β, IL‐18, and LDH levels were all downregulated after the transfection of sh‐MALAT1 under HG condition, while these sh‐MALAT1 caused downregulation of NLRP3, caspase‐1, IL‐1β, IL‐18, and LDH levels were reversed by the co‐transfection of sh‐MALAT1 and miR‐30c inhibitor (Figure 5A‐E). In addition, the HG caused HK‐2 cell pyroptosis were inhibited after the transfection of sh‐MALAT1, while these effects also abolished by the co‐transfection of sh‐MALAT1 and miR‐30c inhibitor (Figure 5F,G). The results from Western blotting confirmed the effects of co‐transfection of sh‐MALAT1 and miR‐30c inhibitor on the NLRP3, caspase‐1, IL‐1β, and IL‐18 protein expression in MALAT1 blocked HK‐2 cells under HG condition (Figure 5H,I). These results demonstrated that the co‐transfection of sh‐MALAT1 and miR‐30c inhibitor could reverse the effect of the transfection of sh‐MALAT1 on the cell pyroptosis, which confirmed that inhibiting the miR‐30c expression could remove the repression of its target mRNA NLRP3.

FIGURE 5.

FIGURE 5

Open in a new tab

Effect of sh‐MALAT1 and miR‐30c inhibitor co‐transfection on the HG caused HK‐2 cell pyroptosis. Quantitative polymerase chain reaction analysis of NLRP3, A, caspase‐1 mRNA, B, IL‐1β mRNA, C, and IL‐18 mRNA, D, in sh‐MALAT1 and miR‐30c co‐transfected HK‐2 cells under HG condition. LDH level, E of HK‐2 cells treated with sh‐MALAT1 or miR‐30c under HG condition by LDH assay kit. F and G, The influences of sh‐MALAT1 and miR‐30c co‐transfection on HG induced HK‐2 cell pyroptosi was evaluated by flow cytometry. H and I, Western blotting analysis of NLRP3, caspase‐3, IL‐1β and IL‐18 in HK‐2 cells treated with sh‐MALAT1 and miR‐30c mimics under HG condition. *P < .05, **P < .01. HG, high glucose; LDH, lactate dehydrogenase

4. DISCUSSION

DN is a major complication of DM and usually leads to the end‐stage renal disease.20, 21 Numerous researches focused on its pathogenesis in order to find out the effective treatment. 22 Inflammation is an important pathogenic factor of DN, which can cause the renal tubular epithelial cell pyroptosis. The pyroptosis involves in the activation NLRP3 (a pyroptosis‐associated protein), the subsequent activation of caspase‐1 and the further promotion of IL‐1β and IL‐18 secretion, which can amplify the inflammatory response and lead to the pyroptosis. Recently, miRNA and lncRNAs have been reported to play a critical role in the development of DN by regulating cellular inflammation.11, 23, 24

Among these miRNAs and lncRNAs, miR‐30c and lncRNA MALAT1 are the most well researched two RNA molecules. In 2015, miR‐30c was reported to be sharply decreased in DN and contributed to renal fibrosis by targeting connective tissue growth factor (CTGF). 25 In functional investigation, miR‐30c was demonstrated to act as an important protector against DN by repressing epithelial‐to‐mesenchymal transition (EMT) through inhibition of Snail1‐TGF cascades. 16 LncRNA MALAT1 was revealed to be increased in kidney tissue samples of diabetic mice and in HG‐treated HK‐2 cells, and it was demonstrated to promote HG‐induced HK‐2 cell injury through Foxo1/SIRT1 signaling pathway. 26 LncRNA MALAT1 was also found to facilitate HG‐induced EMT and fibrosis by miR‐145/ZEB2 axis in HK‐2 cells. 27 Moreover, lncRNA MALAT1 was reported to modulate renal tubular epithelial pyroptosis through miR‐23c/embryonic lethal, abnormal vision, drosophila, homolog‐like 1 (ELAVL1) axis in DN. 28 Consistent with the previous studies, we also confirmed the downregulation of miR‐30c and upregulation of MALAT1 in HG‐induced cell model of DN. In this work, we found that MALAT1 knockdown resulted in an inhibition of HK‐2 cell pyroptosis induced by HG and miR‐30c overexpression exhibited similar results. These findings suggested that MALAT1 acted as a promoter, whereas miR‐30c acted as an inhibitor of DN. Despite the contrary roles of miR‐30c and MALAT1 in DN have been determined by many studies, no researcher has investigated whether miR‐30c and MALAT1 share a common mechanism that remains unknown. In this work, we studied the interplay between MALAT1 and miR‐30c in regulating renal tubular epithelial cell pyroptosis to clarify the underlying mechanisms involved.

The mutual regulation between miRNA and mRNA, miRNA, and lncRNA has become one of the hot bioinformatics research in the recent years.29, 30 It has been reported that miRNA could silence the mRNA expression through its specific base pairing with their target mRNAs, then lncRNA can be a competitive endogenous RNA to combine with the miRNA and further involved in the regulation of mRNA expression.31, 32 Li et al 28 proposed that MALAT1 could reduce the miR‐23c expression by serving as its sponge and thereby removing the repression of the mRNA of ELAVL1 (a target gene of miR‐23c), leading to the activation NLRP3 and ultimately resulting in pyroptosis. NLRP3, as an inflammasome corpuscle, has been reported to be closely associated with DN pathogenesis. It can activate the caspase‐1 and then indirectly activate the pro‐inflammatory cytokines IL‐1β and IL‐18 in response to “danger” signals, which can result in pyroptosis. 11 Inhibition of NLRP3 inflammasome was revealed to mediate the protective effects of ginsenoside metabolite compound K against DN in high‐fat diet‐induced diabetic mice. 33 miR‐30c depletion has been reported to protect PC12 cells against oxygen‐glucose deprivation‐induced inflammation by modulating SIRT1. 34 Due to the characteristic of multiple targets of miRNAs, miR‐30c has also been reported to target other genes, such as SOX9, BCL9, and CTGF.25, 35, 36 In this work, to determine the interaction between MALAT1 and miR‐30c, miR‐30c, and NLRP3, we designed two recombinant luciferase reporter plasmids by inserting the miR‐30c binding sequence of lncRNA MALAT1 or NLRP3 into the psiCHECK‐2 plasmid vector. The psiCHECK‐2 vector, a dual‐luciferase plasmid, has both the synthetic Firefly Luciferase gene and the synthetic Renilla Luciferase gene incorporated, each possessing its own promoter and poly (A)‐addition sites. Luciferase reporter plasmids were constructed by inserting a perfectly complementary WT of MALAT1 or 3′ UTR fragment of NLRP3 between the XhoI‐NotI restriction sites in the multiple cloning regions in the hRluc gene in the psiCHECK‐2 vector. As results showed that miR‐30c, directly inhibited NLRP3 expression and HG‐induced cell pyroptosis, is sponged by MALAT1. Moreover, the co‐transfection of sh‐MALAT1 and miR‐30c inhibitor could reverse the effect of the transfection of sh‐MALAT1 on the NLRP3 expression and pyroptosis, which indicated inhibiting the miR‐30c expression could remove the repression of its target mRNA NLRP3. These results confirmed that MALAT1 was a critical regulator of the miR‐30c‐targeting for NLRP3 and MALAT1 regulated renal tubular epithelial pyroptosis by inhibiting miR‐30c targeting for NLRP3 in DN.

In conclusion, this study highlighted the mutual regulation between MALAT1 and miR‐30c, miR‐30c, and NLRP3 in regulating renal tubular epithelial cell pyroptosis of DN. This research could contribute to a better understanding of the pathogenesis of DN and help to find out the effective treatment for DN.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

Liu C, Zhuo H, Ye M‐Y, Huang G‐X, Fan M, Huang X‐Z. LncRNA MALAT1 promoted high glucose‐induced pyroptosis of renal tubular epithelial cell by sponging miR‐30c targeting for NLRP3. Kaohsiung J Med Sci. 2020;36:682–691. 10.1002/kjm2.12226

Funding information Natural Science Foundation of Hunan Province, China, Grant/Award Number: 2019JJ50887

REFERENCES

  • 1. Wada J, Makino H. Inflammation and the pathogenesis of diabetic nephropathy. Clin Sci. 2013;124(3–4):139–152. [DOI] [PubMed] [Google Scholar]
  • 2. Yang SK, Zhao L, Han YC, Liu Y, Chen C, Zhan M, et al. Probucol ameliorates renal injury in diabetic nephropathy by inhibiting the expression of the redox enzyme p66Shc. Redox Biol. 2017;13:482–497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Yang SK, Han YC, Liu J, Song PN, Xu XX, Zhao L, et al. Mitochondria: A novel therapeutic target in diabetic nephropathy. Curr Med Chem. 2017;24(29):3185–3202. [DOI] [PubMed] [Google Scholar]
  • 4. Sun YM, Su Y, Li J, Wang LF. Recent advances in understanding the biochemical and molecular mechanism of diabetic nephropathy. Biochem Biophys Res Commun. 2013;433(4):359–361. [DOI] [PubMed] [Google Scholar]
  • 5. Chen C, Wang C, Hu C, Han YC, Zhao L, Zhu XJ, et al. Normoalbuminuric diabetic kidney disease. Front. Med. 2017;11(3):310–318. [DOI] [PubMed] [Google Scholar]
  • 6. Li Y, Chen Q, Liu FY, Peng YM, Hou T, Duan SB, et al. Norcantharidin attenuates tubulointerstitial fibrosis in rat models with diabetic nephropathy. Ren Fail. 2011;33(2):233–241. [DOI] [PubMed] [Google Scholar]
  • 7. Tziastoudi M, Stefanidis I, Hadjigeorgiou GM, Stravodimos K, Zintzaras E. A systematic review and meta‐analysis of genetic association studies for the role of inflammation and the immune system in diabetic nephropathy. Clin Kidney J. 2017;10(3):293–300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Sindhughosa DA, Pranamartha A. The involvement of proinflammatory cytokines in diabetic nephropathy: Focus on interleukin 1 (Il‐1), interleukin 6 (Il‐6), and tumor necrosis factor‐alpha (TNF‐A.) signaling mechanism. Bali Med J. 2017;6(1):44–51. [Google Scholar]
  • 9. Qiu YY, Tang LQ. Roles of the NLRP3 inflammasome in the pathogenesis of diabetic nephropathy. Pharmacol Res. 2016;114:251–264. [DOI] [PubMed] [Google Scholar]
  • 10. Xin R, Sun XH, Wang ZY, Yuan WD, Jiang WD, Wang L, et al. Apocynin inhibited NLRP3/XIAP signalling to alleviate renal fibrotic injury in rat diabetic nephropathy. Biomed Pharmacother. 2018;106:1325–1331. [DOI] [PubMed] [Google Scholar]
  • 11. Hutton HL, Ooi JD, Holdsworth SR, Kitching AR. The NLRP3 inflammasome in kidney disease and autoimmunity. Nephrology (Carlton). 2016;21(9):736–744. [DOI] [PubMed] [Google Scholar]
  • 12. Simpson K, Wonnacott A, Fraser DJ, Bowen T. MicroRNAs in diabetic nephropathy: From biomarkers to therapy. Curr Diab Rep. 2016;16(3):35–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Cuenda A, Rousseau S. p38 MAP‐kinases pathway regulation, function and role in human diseases. Biochim Biophys Acta. 2007;1773(8):1358–1375. [DOI] [PubMed] [Google Scholar]
  • 14. Chen HM, Li XY, Liu SY, Gu L, Zhou XM. MircroRNA‐19a promotes vascular inflammation and foam cell formation by targeting HBP‐1 in atherogenesis. Sci Rep. 2017;7(1):12089–12098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Yang Y, Xiao L, Li J, Kanwar YS, Liu F, Sun L. Urine miRNAs: Potential biomarkers for monitoring progression of early stages of diabetic nephropathy. Med Hypotheses. 2013;81(2):274–278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Zhao Y, Yin Z, Li H, Fan J, Yang S, Chen C, et al. MiR‐30c protects diabetic nephropathy by suppressing epithelial‐to‐mesenchymal transition in db/db mice. Aging Cell. 2017;16(2):387–400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Leti F, Morrison E, DiStefano JK. Long noncoding RNAs in the pathogenesis of diabetic kidney disease: Implications for novel therapeutic strategies. Pers Med. 2017;14(3):271–278. [DOI] [PubMed] [Google Scholar]
  • 18. Li Z, Huang J, Ni JD. LncRNA GAS5‐AS1 inhibits osteosarcoma cell growth and invasion by regulating MMP2. Int J Clin Exp Pathol. 2017;10(3):2843–2851. [Google Scholar]
  • 19. Zhou L, Xu DY, Sha WG, Shen L, Lu GY. Long non‐coding RNA MALAT1 interacts with transcription factor Foxo1 to regulate SIRT1 transcription in high glucose‐induced HK‐2 cells injury. Biochem Biophys Res Commun. 2018;503(2):849–855. [DOI] [PubMed] [Google Scholar]
  • 20. Duan SB, Liu GL, Wang YH, Zhang JJ. Epithelial‐to‐mesenchymal transdifferentiation of renal tubular epithelial cell mediated by oxidative stress and intervention effect of probucol in diabetic nephropathy rats. Ren Fail. 2012;34(10):1244–1251. [DOI] [PubMed] [Google Scholar]
  • 21. Yuan F, Liu YH, Liu FY, Peng YM, Tian JW. Intraperitoneal administration of the globular adiponectin gene ameliorates diabetic nephropathy in Wistar rats. Mol Med Rep. 2014;9(6):2293–2300. [DOI] [PubMed] [Google Scholar]
  • 22. Kanwar YS, Sun L, Xie P, Liu FY, Chen S. A glimpse of various pathogenetic mechanisms of diabetic nephropathy. Annu Rev Pathol. 2011;6:395–423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Sani HM, Hejazian M, Khatibi SMH, Ardalan M, Vahed SZ. Long non‐coding RNAs: An essential emerging field in kidney pathogenesis. Biomed Pharmacother. 2018;99:755–765. [DOI] [PubMed] [Google Scholar]
  • 24. Petrillo F, Iervolino A, Zacchia M, Simeoni A, Masella C, Capolongo G, et al. MicroRNAs in renal diseases: A potential novel therapeutic target. Kidney Dis. 2017;3(3):111–119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Wang J, Duan L, Guo T, Gao Y, Tian L, Liu J, et al. Downregulation of miR‐30c promotes renal fibrosis by target CTGF in diabetic nephropathy. J Diabetes Complications. 2016;30(3):406–414. [DOI] [PubMed] [Google Scholar]
  • 26. Zhou L, Xu DY, Sha WG, Shen L, Lu GY. Long non‐coding RNA MALAT1 interacts with transcription factor Foxo1 to regulate SIRT1 transcription in high glucose‐induced HK‐2cells injury. Biochem Biophys Res Commun. 2018;503(2):849–855. [DOI] [PubMed] [Google Scholar]
  • 27. Liu B, Qiang L, Wang GD, Duan Q, Liu J. LncRNA MALAT1 facilities high glucose induced endothelial to mesenchymal transition and fibrosis via targeting miR‐145/ZEB2 axis. Eur Rev Med Pharmacol Sci. 2019;23(8):3478–3486. [DOI] [PubMed] [Google Scholar]
  • 28. Li X, Zeng L, Cao C, Lu C, Lian W, Han J, et al. Long noncoding RNA MALAT1 regulates renal tubular epithelial pyroptosis by modulated miR‐23c targeting of ELAVL1 in diabetic nephropathy. Exp Cell Res. 2017;350(2):327–335. [DOI] [PubMed] [Google Scholar]
  • 29. Cesana M, Cacchiarelli D, Legnini I, Santini T, Sthandier O, Chinappi M, et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 2011;147(2):358–369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Bartel DP. MicroRNAs: Target recognition and regulatory functions. Cell. 2009;136(2):215–233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Yoon JH, Abdelmohsen K, Gorospe M. Functional interactions among microRNAs and long noncoding RNAs. Semin Cell Dev Biol. 2014;34:9–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Sumazin P, Yang XR, Chiu HS, Chung WJ, Iyer A, Llobet‐Navas D, et al. An extensive microRNA‐mediated network of RNA‐RNA interactions regulates established oncogenic pathways in glioblastoma. Cell. 2011;147(2):370–381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Song W, Wei L, Du Y, Wang Y, Jiang S. Protective effect of ginsenoside metabolite compound K against diabetic nephropathy by inhibiting NLRP3 inflammasome activation and NF‐kappaB/p38 signaling pathway in high‐fat diet/streptozotocin‐induced diabetic mice. Int Immunopharmacol. 2018;63:227–238. [DOI] [PubMed] [Google Scholar]
  • 34. Wang X, Su X, Gong F, Yin J, Sun Q, Lv Z, et al. MicroRNA‐30c abrogation protects against spinal cord ischemia reperfusion injury through modulating SIRT1. Eur J Pharmacol. 2019;851:80–87. [DOI] [PubMed] [Google Scholar]
  • 35. Liu S, Li X, Zhuang S. miR‐30c impedes glioblastoma cell proliferation and migration by targeting SOX9. Oncol Res. 2019;27(2):165–171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Zhao DW, Li MM, Han JP, Wang Y, Jiang LX, Chang HL. MiR‐30c exerts tumor suppressive functions in colorectal carcinoma by directly targeting BCL9. Eur Rev Med Pharmacol Sci. 2019;23(8):3335–3343. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES