Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2020 Oct 22;37(5):371–378. doi: 10.1002/kjm2.12316

SP1‐induced lncRNA DANCR contributes to proliferation and invasion of ovarian cancer

Peng‐Hua Cui 1,✉, Zhi‐Yan Li 1, Da‐Hai Li 1, Shu‐Yu Han 1, Yu‐Juan Zhang 1
PMCID: PMC11896170  PMID: 33089960

Abstract

Transcription factor SP1 could manipulate pathways involved in ovarian cancer progression. LncRNAs are involved in SP1‐mediated tumorigenesis. LncRNA DANCR could promote metastasis of ovarian cancer. However, the regulatory function and involvement of SP1‐induced lncRNA DANCR in ovarian cancer remain elusive. Data from this study showed that SP1 was up‐regulated in ovarian cancer tissues and cells (CAOV3, SKOV3, A2780), and SP1 could bind to the promoter region of DANCR through chromatin immunoprecipitation and leuciferase activity assays. Therefore, DANCR was transcriptionally induced by SP1 in ovarian cancer tissues and cells (CAOV3, SKOV3, A2780). Functionally, reduced expression of DANCR suppressed cell viability, migration and invasion of CAOV3, while enhanced DANCR expression contributed to SKOV3 growth. Over‐expression of SP1 reversed the suppressive effects of DANCR interference on ovarian cancer progression. In conclusion, SP1‐induced DANCR contributed to oncogenic potential of ovarian cancer, suggesting a promising therapeutic target for ovarian cancer.

Keywords: DANCR, ovarian cancer, progression, SP1

1. INTRODUCTION

Ovarian cancer is one of the most common gynecological malignancies worldwide, with high morbidity and mortality. 1 Due to devoid of specific signs or symptoms and effective or sensitive clinical screening methods, ovarian cancer is difficult in early diagnosis. 2 High recurrence rate and poor prognosis due to metastasis of malignant tumors are common serious problems in ovarian cancer. 3 Therefore, more extensive research and a better understanding of the molecular changes that lead to ovarian cancer are urgently needed.

SPs, belonging to Sp/Krüppel‐like factor (KLF) family, act as transcription factors to mediate cellular homeostasis, thus playing critical roles in diseases including cancer. 4 SP1 contains conserved C2H2 zinc finger DNA binding domain to bind with GC, CT or GT boxes of cancer‐related genes promoter. 5 Recently, SP1 has been shown to be participated in promotion of ovarian cancer progression, 6 and inhibition of SP1 contributes to suppression of ovarian cancer. 7 SP1 also binds to promoter of non‐coding RNA to regulate cell migration of ovarian cancer. 8

Long non‐coding RNAs (lncRNAs) could transcriptionally or post‐transcriptionally regulate expression and epigenetic levels of target genes, whose dysregulation are widely known to be involved in the development and progression of many cancers. 9 Large numbers of lncRNAs regulate tumor progression in ovarian cancer. 10 For example, lncRNA SNHG20 promotes tumor progression, 11 while AOC4P suppresses metastasis of ovarian cancer. 12 DANCR, a promising cancer‐associated lncRNA, could function as oncogene to promote various tumor progression. 13 , 14 , 15 , 16 Recent study has shown that DANCR directly promote ovarian cancer growth and angiogenesis. 17 However, whether SP1 could positively regulate DANCR to promote ovarian cancer progression needs further study.

In this study, we hypothesized that SP1 could regulate lncRNA DANCR to participate in ovarian cancer progression. To verify this hypothesis, we determined the expressional relation between SP1 and DANCR in in ovarian cancer tissues and cells. Binding ability between SP1 and promoter of DANCR was then determined. By performing in vitro experimental assays, the functional relevance of SP1/DANCR in ovarian cancer progression was investigated, suggesting the regulator role of DANCR in ovarian cancer progression and providing new insights into lncRNA‐mediated malignancy progression in ovarian cancer.

2. MATERIALS AND METHODS

2.1. Tissues collection

Study was approved ethically by the Medical Ethics Committee of XXX University. Total of 65 paired ovarian cancer tissues and adjacent non‐tumor tissues were collected from patients in XXX University with notified consents. Patients were diagnosed by histopathological evidence. Fresh tissues after surgery were immediately stored at −80°C for RNA extraction.

2.2. Cell culture

HEK293‐T, ovarian cancer cell lines (CAOV3, SKOV3, A2780) and normal ovarian cell IOSE80, purchased from JENNIO Biological Technology (Guangzhou, China), were maintained in DMEM (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco) at 37°C chamber with 5% CO2.

2.3. Cell transfection

Two short hairpin RNAs targeting DANCR (shDANCR #1 or #2) or SP1 (shSP1 #1 or #2) and the negative control (shNC) were, as well as pcDNA3.1 vectors containing full‐length of DANCR or SP1 and empty vector (Control), were synthesized from RiboBio company (Guangzhou, China). CAOV3 or SKOV3 cells were seeded for 24 hours before transfection, and then employed for the transfection with shRNAs or pcDNA3.1 vectors via Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). Cells were harvested 48 hours after transfection for functional assays.

2.4. CCK8 assay

CAOV3 or SKOV3 cells with various transfection were seeded and incubated with 10 μL CCK8 solution (Dojindo, Tokyo, Japan) for 2 hours. Absorbance at 450 nm was then determined every 24 hours intervals (0, 24, 48, 72 hours) by FLx800 Fluorescence Microplate Reader (Biotek, Winooski, VT, USA).

2.5. Wound healing

CAOV3 or SKOV3 cells with various transfection were seeded and then scratched with plastic pipette tip. After removing the detached cells, cells were cultured in DMEM medium for 24 hours. The wound width was calculated under an inverted microscope.

2.6. Transwell Assay

CAOV3 or SKOV3 cells with various transfection were cultured with fetal bovine serum‐free medium in the top chamber (BD Biosciences, Bedford, MA, USA) loaded with Matrigel. DMEM with 10% fetal bovine serum was added to the bottom chamber. Medium in the top chamber and the filters were removed 8 hours later. Invasive cells to the bottom chamber were fixed in 100% methanol 24 hours later, and then stained with 0.1% crystal violet. Cells were counted under microscope (Olympus, Tokyo, Japan).

2.7. Chromatin immunoprecipitation (ChIP)

Putative SP1‐binding sites in promoter of DANCR were identified via JASPAR database. HEK293‐T cells were fixed in 4% formaldehyde and then subjected to ultrasonication. Proteins‐DNA fragments were then immune‐precipitated with SP1 or IgG antibodies (Abcam, Cambridge, MA, USA). After incubation with Dynabeads Protein G (Life Technologies, CA, USA), the fragments were purified and DNAs were retrieved for further qRT‐PCR analysis.

2.8. Luciferase reporter assay

Three different fragment sequences of DANCR promoter containing putative SP1‐binding sites (E1, E2, E3) were synthesized inserted into pmirGLO luciferase vector with following combinations: pmirGLO‐E1 + E2 + E3 (PF); pmirGLO‐E1 + E3 (P1); pmirGLO‐E2 (P2). HEK293‐T cells were cotransfected with PF, P1, P2 reporter vectors and pcDNA3.1‐SP1 or pcDNA3.1 empty vector. Forty‐eight hours after transfection, relative luciferase activity was determined by dual‐luciferase reporter assay system (Promega, Madison, WI, USA).

2.9. qRT‐PCR

The extracted RNAs from tissues and cells were reverse transcribed into cDNAs by SuperScript III (Invitrogen, Carlsbad, CA, USA). cDNAs were conducted qRT‐PCR assay with SYBR (Roche, Mannheim, Germany) on BioRad CFX96 Sequence Detection System (BioRad, Berkeley, CA, USA). Relative expression was normalized to GAPDH expression. All the primer sequences were shown as below: GAPDH (F: 5'‐ACCACAGTCCATGCCATCAC‐3′; R: 5'‐TCCACCACCCTGTTGCTGTA‐3′); DANCR, PF or P1 (F: 5'‐GCGCCACTATGTAGCGGGTT‐3′; R: 5'‐TCAATGGCTTGTGCCTGTAGTT‐3′); SP1 (F: 5'‐ATCTGGTGGTGTGGGATACA‐3′; R: 5'‐GAGGCTCTTCCCTCACTGTCT‐3′); E1 (F: 5'‐TGACCTCGCTGATGGCTCT‐3′; R: 5'‐TCAGGCGTCCGCTCCCCACT‐3′); E2 or P2 (F: 5'‐TGAGGGGACCGTGGCA‐3′; R: 5'‐TGGTAGCGCTTCCAGCGCGACA‐3′); E3 (F: 5'‐GGGAGATACCATGATCACGAAGGT‐3′; R:5' CCACAAATTATGCAGTCGAGTTTCCC‐3′).

2.10. Western blot

Tissue or cell lysates were conducted via RIPA buffer, and proteins were then separated by SDS‐PAGE. After electro‐transferring onto PVDF membrane, the membrane was blocked in 5% BSA and incubated overnight with primary antibodies against SP1 or actin (1:2500, Abcam). HRP labeled secondary antibody (1:5000; Abcam) was then used for immunostaining, and signals were determined by enhanced chemiluminescence (Pierce, Rockford, IL, USA).

2.11. Statistical analysis

Data were shown as mean ± SD, and processed by SPSS software version 17.0. Statistical analyses were determined by one‐way analysis of variance, and the survival curves were analyzed by Kaplan‐Meier method and log‐rank test. Value of P < 0.05 was considered to be statistically significant.

3. RESULTS

3.1. LncRNA DANCR was up‐regulated in ovarian cancer

qRT‐PCR analysis showed up‐regulation of DANCR in ovarian cancer tissues compared to adjacent non‐tumor tissues (Figure 1(A)). Patients with high DANCR expression revealed significantly shorter survival than patients with low expression (Figure 1(B)). Moreover, high DANCR expression was markedly associated with tumor size, FIGO stage and lymph node metastasis (Table 1), suggesting that DANCR might be associated with metastatic property of ovarian cancer. Up‐regulation of DANCR was also verified in ovarian cancer cell lines (CAOV3, SKOV3, A2780) (Figure 1(C)). These results showed up‐regulated DANCR may participate in ovarian cancer progression.

FIGURE 1.

FIGURE 1

Open in a new tab

LncRNA DANCR was up‐regulated in ovarian cancer. (A) Expression of DANCR in ovarian cancer tissues and adjacent noncancer tissues detected by qRT‐PCR (N = 65). (B) Overall survival analysis of ovarian cancer patients with high DANCR expression and low levels of DANCR. (C) Expression of DANCR in ovarian cancer cell lines (CAOV3, SKOV3, A2780) and normal ovarian cell IOSE80 detected by qRT‐PCR. ** P < 0.01

TABLE 1.

Association between DANCR expression and clinicopathological characteristics of patients with OC

Characteristics Number of patients Low DANCR expression(< median) High DANCR expression(≥ median) p value
Number 65 32 33
Age (years) 0.685
< 50 39 20 19
≥ 50 26 12 14
Histological subtype 0.110
Serous 11 3 8
Others 54 29 25
Tumor size 0.001*
< 8 CM 37 25 12
≥ 8 CM 28 7 21
FIGO stage 0.024*
I‐II 38 30 24
III‐IV 27 2 9
Histological grade 0.108
G1‐G2 30 18 12
G3 35 14 21
Lymph node metastasis 0.018*
Absent 35 22 13
Present 30 10 20
CA125 level (U/ml) 0.718
< 500 36 17 19
≥ 500 29 15 14
Open in a new tab
*

P < 0.05.

3.2. SP1 was up‐regulated in ovarian cancer

Western blot (Figure 2(A)) and qRT‐PCR (Figure 2(B)) analyses showed up‐regulation of SP1 in ovarian cancer tissues compared to adjacent non‐tumor tissues, showing a positive correlation with DANCR in ovarian cancer (Figure 2(C)). Moreover, high SP1 expression was also verified in ovarian cancer cell lines (Figure 2(D)), suggesting up‐regulated SP1/DANCR may participate in ovarian cancer progression.

FIGURE 2.

FIGURE 2

Open in a new tab

SP1 was up‐regulated in ovarian cancer. (A) Expression of SP1 in ovarian cancer tissues and adjacent noncancer tissues detected by western blot (N = 4). (B) Expression of SP1 in ovarian cancer tissues and adjacent noncancer tissues detected by qRT‐PCR (N = 65). (C) Positive correlation between DANCR and SP1 in patients with ovarian cancer. (D) Expression of SP1 in ovarian cancer cell lines (CAOV3, SKOV3, A2780) and normal ovarian cell IOSE80 detected by qRT‐PCR. ** p < 0.01

3.3. SP1 regulated DANCR expression in ovarian cancer

JASPAR database (http://jaspardev.genereg.net/) showed three potential SP1‐binding sites in promoter of DANCR at the regions E1, E2 and E3 (Figure 3(A)). Three paired primers (E1, E2, E3) were designed and ChIP assay was performed to determine the SP1‐binding sites in promoter of DANCR. Data revealed that SP1 bind to E2 site of DANCR (Figure 3(B)). To further confirm this result, full promoter region of DANCR (PF), E2 deleted promoter region of DANCR (P1) and E2 promoter region of DANCR were cloned into pmirGLO vector (Figure 3(C)). Luciferase reporter assay indicated that deletion of E2 region abolished luciferase activity (Figure 3(D)), suggesting that SP1 could bind to E2 region of DANCR promoter. However, luciferase activity was also decreased in P2 compared to PF (Figure 3(D)), suggesting that E1 or E3 region could also participate in binding with SP1. Moreover, over‐expression of SP1 increased DANCR expression, while knockdown of SP1 decreased DANCR expression (Figure 3(E)), showing that SP1 could bind to promoter of DANCR to regulate transcription of DANCR in ovarian cancer.

FIGURE 3.

FIGURE 3

Open in a new tab

SP1 regulated DANCR expression in ovarian cancer. (A) Predicted positions of putative SP1 binding motif in DANCR promoter. (B) Quantitative ChIP assays were performed to show direct binding of SP1 to endogenous DANCR promoter regions. (C) Luciferase reporter assay was used by cotransfecting the full DANCR promoter (PF), deleted DANCR promoter fragment E2 (P1) or single E2 fragment (P2) with pcDNA3.1‐SP1 plasmid or blank vector in 293 T cells. (D) Effect of SP1 on luciferase activity of PF, P1 P2 detected by qRT‐PCR. (E) qPCR analysis of DANCR expression levels following the treatment of pcDNA3.1‐SP1 or shSP1 #1/#2 in SKOV3 or CAOV3 cells. ** p < 0.01

3.4. DANCR promoted malignant behaviors of ovarian cancer

SKOV3 was transfected with pcDNA3.1‐DANCR, and CAVO3 was transfected with shDANCR #1 or #2 to evaluate potential function of DANCR in ovarian cancer progression (Figure 4(A)). Cell viability of SKOV3 was increased by pcDNA3.1‐DANCR, while cell viability of CAVO3 was decreased by shDANCR #1 or #2 (Figure 5(B)). Cell migration (Figure 4(C)) and invasion (Figure 4(D)) were promoted by DANCR over‐expression while suppressed by knockdown of DANCR, furtherly suggesting that DANCR contributed to malignant phenotypes of ovarian cancer.

FIGURE 4.

FIGURE 4

Open in a new tab

DANCR promoted malignant behaviors of ovarian cancer. (A) Transfection efficiency of pcDNA‐DANCR in SKOV3 cells, and shDANCR #1 or #2 in CAOV3 cells, were detected by qRT‐PCR. (B) The influence of DANCR on cell viability of SKOV3 or CAOV3 cells cells detected by CCK8. (C) The influence of DANCR on cell migration of SKOV3 or CAOV3 cells detected by wound healing assay. (D) The influence of DANCR on cell invasion of SKOV3 or CAOV3 cells detected by transwell assay. ** p < 0.01

FIGURE 5.

FIGURE 5

Open in a new tab

SP1 counteracted the suppressive effects of DANCR interference on malignant behaviors of ovarian cancer. (A) The influence of DANCR and SP1 on cell viability of SKOV3 or CAOV3 cells cells detected by CCK8. (B) The influence of DANCR and SP1 on cell migration of SKOV3 or CAOV3 cells detected by wound healing assay. (C) The influence of DANCR and SP1 on cell invasion of SKOV3 or CAOV3 cells detected by transwell assay. **, ## p < 0.01

3.5. SP1 counteracted the suppressive effects of DANCR interference on malignant behaviors of ovarian cancer

SKOV3 was cotransfected with pcDNA3.1‐SP1 and shDANCR #2 to investigate function of SP1/DANCR axis in regulation of ovarian cancer progression. Result showed that SP1 over‐expression attenuated DANCR knockdown‐inhibited cell viability (Figure 5(A)). In addition, DANCR silence‐suppressed cell migration (Figure 5(B)) and invasion (Figure 5(C)) were also reversed by SP1 over‐expression. Taken together, SP1 could counteract the suppressive effects of DANCR interference on malignant behaviors of ovarian cancer.

4. DISCUSSION

Recurrence and metastasis of ovarian cancer cells confer abnormally proliferation, migration and invasion, as well as resistance to apoptosis, to ovarian cancer development. 18 LncRNAs, with the ability to mediate onset, development and progression of ovarian cancer, have been considered as potential therapeutic targets for ovarian cancer. 19 Here, we identified an oncogenic lncRNA, DANCR, and evaluated its function and mechanism involved in ovarian cancer progression.

Previous study has shown that ovarian cancer is devoid of routine and efficient methods for the early diagnosis. 20 LncRNAs, closely related to clinicopathological variables in patients with ovarian cancer, such as histological grade, tumor size or lymph node metastasis, could function as potential biomarkers for ovarian cancer. 19 Up‐regulated DANCR in ovarian cancer tissues has been shown to be associated with distant metastasis of ovarian cancer, thus predicting a prognostic marker. 21 Data from this study also showed a dramatically up‐regulation of DANCR in ovarian cancer tissues, and high DANCR expression was associated with tumor size, FIGO stage and lymph node metastasis of patients with ovarian cancer. Moreover, high DANCR expression demonstrated shorter overall survival in patients than low DANCR expression, confirming that DANCR might be prognostic marker for ovarian cancer.

DANCR has been shown to accelerate proliferative and migratory abilities of ovarian cancer cells, 21 and inhibition of DANCR suppressed in vivo tumor growth of ovarian cancer. 18 Our results also indicated that DANCR promoted cell viability, migration and invasion of ovarian cancer, while inhibition of DANCR demonstrated suppressive effects. LncRNAs could affect target genes expression at transcriptional, post‐transcriptional and post‐translational levels in ovarian cancer. 22 DANCR could regulate protein stabilization of up‐frameshift 1 21 or p21 23 to aggravates ovarian cancer progression. DANCR functions as competing endogenous RNA to sponge miR‐145, thus regulating angiogenesis in ovarian cancer. 17 The target gene of DANCR in the present study should be also investigated in further study.

Dysregulation of lncRNAs by transcriptional factors could participate in tumor progression. 24 , 25 , 26 For example, signal transducer and activator of transcription 3 could induce lncRNA ABHD11‐AS1 to promote papillary thyroid carcinoma progression. 27 LncRNA LUCAT1 was activated by signal transducer and activator of transcription 3 to drive metastasis of hepatoblastoma. 28 Recently, report showed that transcription of DANCR was stimulated by oncogene, MYC, and MYC‐promoted DANCR could induce ovarian cancer growth. 23 Here, our results showed that DANCR was stimulated by SP1 at transcriptional level. SP1 was up‐regulated in ovarian cancer tissues, and showed positive correlation with DANCR in ovarian cancer. Moreover, SP1 could bind to E2 region of DANCR promoter, thus regulating transcription of DANCR in ovarian cancer. SP1 has been widely shown to induce lncRNAs, such as ZFAS1, 29 TINCR 30 or AGAP2‐AS1, 31 to contribute to tumor progression. Moreover, SP1 could also bind to promoter of heparin‐binding epidermal growth factor‐like growth factor, 32 CLDN4 33 or MDM2 34 to affect tumorigenesis of ovarian cancer. Here functional assays indicated that over‐expression of SP1 could counteract the suppressive effects of DANCR interference on cell viability, migration and invasion of ovarian cancer. Pathways, including MAP3K, PI3K/AKT and JNK1, are involved in SP1‐promoted ovarian cancer progression, 35 the pathways associated with SP1/DANCR‐mediated ovarian cancer needs to be investigated.

In summary, up‐regulation of DANCR in ovarian cancer tissues and cells were stimulated by SP1. SP1 could bind to E2 region of DANCR promoter, and knockdown of DANCR suppressed cell migration and invasion of ovarian cancer. This finding provided potential application of SP1/DANCR axis in ovarian cancer.

CONFLICT OF INTEREST

The authors declare no conflict of interest

Cui P‐H, Li Z‐Y, Li D‐H, Han S‐Y, Zhang Y‐J. SP1‐induced lncRNA DANCR contributes to proliferation and invasion of ovarian cancer. Kaohsiung J Med Sci. 2021;37:371–378. 10.1002/kjm2.12316

Funding information Chengde Science and Technology Support Project, Grant/Award Number: 201706A037

REFERENCES

  • 1. Kim YS, Hwang JY, Kim TH, Lee EG, Lee HH. Genome‐wide association study of recurrent endometriosis related with ovarian cancer. Clin Exp Obstet Gynecol. 2019;46(4):553–559. [Google Scholar]
  • 2. Rottmann M, Burges A, Mahner S, Anthuber C, Beck T, Grab D, et al. Cancer of the ovary, fallopian tube, and peritoneum: a population‐based comparison of the prognostic factors and outcomes. J Cancer Res Clin Oncol. 2017;143(9):1833–1844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Parida S, Chakraborty S, Maji R K, Ghosh Z. Elucidating the gene regulatory networks modulating cancer stem cells and non‐stem cancer cells in high grade serous ovarian cancer. Genomics 2019;111(1):103–113. [DOI] [PubMed] [Google Scholar]
  • 4. Suske G, Bruford E, Philipsen S. Mammalian SP/KLF transcription factors: bring in the family. Genomics. 2005;85(5):551–556. [DOI] [PubMed] [Google Scholar]
  • 5. Safe S, Abbruzzese J, Abdelrahim M, Hedrick E. Specificity Protein Transcription Factors and Cancer: Opportunities for Drug Development. Cancer Prev Res (Phila). 2018;11(7):371–382. [DOI] [PubMed] [Google Scholar]
  • 6. Mahalaxmi I, Santhy KS. Role and hallmarks of Sp1 in promoting ovarian cancer. J Oncol Sci. 2018;4(2):102–105. [Google Scholar]
  • 7. Sankpal UT, Ingersoll SB, Ahmad S, Holloway RW, Bhat VB, Simecka JW, et al. Association of Sp1 and survivin in epithelial ovarian cancer: Sp1 inhibitor and cisplatin, a novel combination for inhibiting epithelial ovarian cancer cell proliferation. Tumour Biol. 2016;37(10):14259–14269. [DOI] [PubMed] [Google Scholar]
  • 8. Wang S, Li Y, Sun S, Cai J, Cao J. Sp1 promotes ovarian cancer cell migration through repressing miR‐335 expression. Biochem Biophys Res Commun. 2020;524(1):211–216. [DOI] [PubMed] [Google Scholar]
  • 9. Tang Y, Cheung BB, Atmadibrata B, Marshall GM, Dinger ME, Liu PY, et al. The regulatory role of long noncoding RNAs in cancer. Cancer Lett. 2017;391:12–19. [DOI] [PubMed] [Google Scholar]
  • 10. Yuan D, Zhang X, Zhao Y, Qian H, Wang H, He C, et al. Role of lncRNA‐ATB in ovarian cancer and its mechanisms of action. Exp Ther Med. 2020;19(2):965–971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. van de Ven R, Verbrugge SE, Al M, Dekker H, Verheul HM, Anderl JL, et al. Enhanced Dendritic Cell Development Through Long‐Term Proteasome Inhibition. J Mol Clin Med. 2018;1(1):37–46. [Google Scholar]
  • 12. Lin X, Tang X, Zheng T, Qiu J, Hua K. Long non‐coding RNA AOC4P suppresses epithelial ovarian cancer metastasis by regulating epithelial‐mesenchymal transition. J Ovarian Res. 2020;13(1):45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Luo Y, Wang Q, Teng L, Zhang J, Song J, Bo W, et al. LncRNA DANCR promotes proliferation and metastasis in pancreatic cancer by regulating miRNA‐33b. FEBS Open Bio. 2020;10(1):18–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Chen Z, Chen X, Xie R, Huang M, Dong W, Han J, et al. DANCR Promotes Metastasis and Proliferation in Bladder Cancer Cells by Enhancing IL‐11‐STAT3 Signaling and CCND1 Expression. Mol Ther. 2019;27(2):326–341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Wang Y, Zeng X, Wang N, Zhao W, Zhang X, Teng S, et al. Long noncoding RNA DANCR, working as a competitive endogenous RNA, promotes ROCK1‐mediated proliferation and metastasis via decoying of miR‐335‐5p and miR‐1972 in osteosarcoma. Mol Cancer. 2018;17(1):89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Wang Y, Lu Z, Wang N, Feng J, Zhang J, Luan L, et al. Long noncoding RNA DANCR promotes colorectal cancer proliferation and metastasis via miR‐577 sponging. Exp Mol Med. 2018;50(5):1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Sha QK, Chen L, Xi JZ, Song H. Long non‐coding RNA LINC00858 promotes cells proliferation, migration and invasion by acting as a ceRNA of miR‐22‐3p in colorectal cancer. Artif Cells Nanomed Biotechnol. 2019;47(1):1057–1066. [DOI] [PubMed] [Google Scholar]
  • 18. Wang X, Ivan M, Hawkins SM. The role of MicroRNA molecules and MicroRNA‐regulating machinery in the pathogenesis and progression of epithelial ovarian cancer. Gynecol Oncol. 2017;147(2):481–487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Salamini‐Montemurri M, Lamas‐Maceiras M, Barreiro‐Alonso A, Vizoso‐Vázquez Á, Rodríguez‐Belmonte E, Quindós‐Varela M, et al. The Challenges and Opportunities of LncRNAs in Ovarian Cancer Research and Clinical Use. Cancers (Basel). 2020;12(4):1020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Suh‐Burgmann EJ, Alavi M. Detection of early stage ovarian cancer in a large community cohort. Cancer Med. 2019;8(16):7133–7140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Pei CL, Fei KL, Yuan XY, Gong XJ. LncRNA DANCR aggravates the progression of ovarian cancer by downregulating UPF1. Eur Rev Med Pharmacol Sci. 2019;23(24):10657–10663. [DOI] [PubMed] [Google Scholar]
  • 22. Rongzhang H, Luo DX, Mo YY. Emerging roles of lncRNAs in the post‐transcriptional regulation in cancer. Genes Dis. 2019;6(1):6–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Lu Y, Hu Z, Mangala L, Stine Z, Hu X, Jiang D, et al. MYC targeted long non‐coding RNA DANCR promotes cancer in part by reducing p21 levels. Cancer Res. 2018;78(1):64–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Liu G, Ye Z, Zhao X, Ji Z. SP1‐induced up‐regulation of lncRNA SNHG14 as a ceRNA promotes migration and invasion of clear cell renal cell carcinoma by regulating N‐WASP. Am J Cancer Res. 2017;7(12):2515–2525. [PMC free article] [PubMed] [Google Scholar]
  • 25. Liu Y, Du Y, Hu X, Zhao L, Xia W. Up‐regulation of ceRNA TINCR by SP1 contributes to tumorigenesis in breast cancer. BMC Cancer. 2018;18(1):367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Zhao W, Li L. SP1‐induced upregulation of long non‐coding RNA HCP5 promotes the development of osteosarcoma. Pathol Res Pract. 2019;215(3):439–445. [DOI] [PubMed] [Google Scholar]
  • 27. Wen J, Wang H, Dong T, Gan P, Fang H, Wu S, et al. STAT3‐induced upregulation of lncRNA ABHD11‐AS1 promotes tumour progression in papillary thyroid carcinoma by regulating miR‐1301‐3p/STAT3 axis and PI3K/AKT signalling pathway. Cell Prolif. 2019;52(2):e12569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Wang X Q., Guo S, Zhao R, Liu Y F., Yang G Y. STAT3‐activated long non‐coding rna lung cancer associated transcript 1 drives cell proliferation, migration, and invasion in hepatoblastoma through regulation of the miR‐301b/STAT3 axis. Hum Gene Ther 2019;30(6):702–713. [DOI] [PubMed] [Google Scholar]
  • 29. Chen X, Zeng K, Xu M, Hu X, Liu X, Xu T, et al. SP1‐induced lncRNA‐ZFAS1 contributes to colorectal cancer progression via the miR‐150‐5p/VEGFA axis. Cell Death Dis. 2018;9(10):982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Xu TP, Liu XX, Xia R, Yin L, Kong S, Chen WM, et al. SP1‐induced upregulation of the long noncoding RNA TINCR regulates cell proliferation and apoptosis by affecting KLF2 mRNA stability in gastric cancer. Oncogene. 2015;34(45):5648–5661. [DOI] [PubMed] [Google Scholar]
  • 31. Dong H, Wang W, Mo S, Chen R, Zou K, Han J, et al. SP1‐induced lncRNA AGAP2‐AS1 expression promotes chemoresistance of breast cancer by epigenetic regulation of MyD88. J Exp Clin Cancer Res. 2018;37(1):202. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 32. Miyata K, Yotsumoto F, Nam SO, Odawara T, Manabe S, Ishikawa T, et al. Contribution of transcription factor, SP1, to the promotion of HB‐EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma. Cancer Med. 2014;3(5):1159–1169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Honda H, Pazin MJ, Ji H, Wernyj RP, Morin PJ. Crucial Roles of Sp1 and Epigenetic Modifications in the Regulation of the CLDN4 Promoter in Ovarian Cancer Cells. J Biol Chem. 2006;281(30):21433–21444. [DOI] [PubMed] [Google Scholar]
  • 34. Knappskog S, Bjørnslett M, Myklebust LM, Huijts PEA, Vreeswijk MP, Edvardsen H, et al. The MDM2 Promoter SNP285C/309G Haplotype Diminishes Sp1 Transcription Factor Binding and Reduces Risk for Breast and Ovarian Cancer in Caucasians. Cancer Cell. 2011;19(2):273–282. [DOI] [PubMed] [Google Scholar]
  • 35. Vellingiri B, Iyer M, Devi Subramaniam M, Jayaramayya K, Siama Z, Giridharan B, et al. Understanding the Role of the Transcription Factor Sp1 in Ovarian Cancer: from Theory to Practice. Int J Mol Sci. 2020;21(3):1153. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES