LncRNA‐GAS5 related to the processes of recurrent pregnancy loss by regulating Th1/Th2 balance

Abstract

Recurrent pregnancy loss (RPL) is defined as three or more consecutive spontaneous loss of pregnancy and the reason of 50% RPL is unknown. GAS5 is a long non‐coding RNA, which has been found to be an immune responses regulator and to be relate to autoimmune diseases. However, the roles of GAS5 during the pathophysiological processes of RPL is unclear. In the present study, the levels of GAS5 were examined in the plasma and trophoblasts from 30 patients with RPL and 15 healthy controls. GAS5 was found overexpressed in patients with RPL and positively correlated with the protein levels of TNF‐α in the plasma and trophoblasts. Predicted by bioinformatics tools and confirmed by luciferase assay, GAS5 was identified to function as a competing endogenous RNA (ceRNA) binding with miR‐140‐5p and protects TNF‐α expression in HTR‐8/SVneo cells and primary trophoblasts. Activated Naïve T cells co‐cultured with the medium from GAS5 overexpression HTR‐8/SVneo cells or primary trophoblasts exhibited Th1 bias by expression more IFN‐γ, TNF‐α and less IL‐4, IL‐10. In conclusion, GAS5 was overexpressed in the plasma and trophoblasts from RPL patients, which contributes to Th1 bias by binding with miR‐140‐5p.

1. INTRODUCTION

Recurrent pregnancy loss (RPL) is defined as three or more consecutive spontaneous loss of pregnancy that affects approximately 1–5% of pregnant women. ¹ Until now, the etiology of about 50% patients with RPL is unknown. Pregnancy is a well‐choreographed physiological process and the pregnancy outcomes is affected by many factors involving immune tolerance, angiogenesis, and hormonal balance, genetic and epigenetic factors. ² , ³ Emerging evidences indicate that immunological disorders are among the main causes of RPL. It is considered that a successful pregnancy needs the proposed switch from the T helper 1(Th1) cytokine profile to the T helper 2 (Th2) profile. The immunology of pregnancy is complex, in that the mother must tolerate the “foreign” fetus, and thus requires a degree of immunosuppression whilst on the other hand needs to maintain immune function to fight off infection. One mechanism, which is involved in successful pregnancy maintenance, is the proposed switch from the T helper 1 (Th1) cytokine profile to the T helper 2 (Th2) profile. While, patients with RPL have been found to have a stronger Th1 bias than the controls who underwent a normal pregnancy. ⁴ , ⁵

MicroRNAs are a group of short non‐coding RNAs that regulate target genes expression at post‐transcription level. Until recently, it is identified that more than 1900 miRNAs existed in human, which predicted control at least 60% protein coding genes expression. ⁶ Dysregulated miRNAs have been identified in the placenta and blood samples from patients with RPL. ⁷ , ⁸ Meanwhile, some DNA mutations or polymorphisms have been found to be related to RPL. ⁹ , ¹⁰

Long non‐coding RNAs (lncRNAs) are a group of more than 200 nt, non‐protein coding RNAs, and some of which have been found dysregulated in many pathophysiological processes including RPL. ¹¹ , ¹² Growth arrest‐specific 5 (GAS5) is a 725 bp lncRNA which accumulates in growth arrested cells. ¹³ It is reported that GAS5 was expressed in both preterm and term placentas, and primarily localized in the syncytiotrophoblast. ¹⁴ Placental GAS5 levels have been found to be inversely correlated with maternal stress, which may have the potential to predict birth outcomes. ¹⁴ In the placenta of preclamisa affected women, GAS5 is found overexpressed, which may influence the biological functions of trophoblast cells through repressing miR‐21 and activating of PI3K/AKT signaling pathway. ¹⁵ Meanwhile, emerging evidences indicate that GAS5 may also function as an important immune responses regulator and relate to autoimmune diseases. It is reported that GAS5 is significantly reduced in the CD4+ T cells and B cells from patients with rheumatoid arthritis and systemic lupus erythematosus. ¹⁶ , ¹⁷ GAS5 also functions as a competing endogenous RNA (ceRNA) absorbs and quenches miR‐21, which promotes Th17 cell differentiation. ¹⁸ However, the roles of GAS5 in the pathophysiological processes of RPL is still unclear.

In the present study, GAS5 expression levels were examined in the plasma and trophoblasts samples from the patients with RPL. GAS5 was identified to function as a ceRNA binding with miRNAs and regulate Th1/Th2 balance.

2. MATERIALS AND METHODS

2.1. Samples collection

Thirty women underwent three or more consecutive pregnancy loss before 20 weeks gestation were recruited in this study. Fifteen healthy women underwent terminated voluntarily pregnancies without medical reasons, history of pregnancy loss or any other pregnancy complication were defined as the control group. The clinical characteristics of all the participants were shown in Table 1. Tissue specimens were obtained from dilatation and curettage from all participants. All known causes for RPL was excluded via clinical screening including parental karyotype, uterine structure, endocrinological anomalies, immunological tests, et al. All patients had to be negative for all these tests for study inclusion. The tissue obtained from all RPL patients miscarrying were karyotyped to know the chromosomal status of embryos. Controls tissue specimens were obtained by 15 terminated voluntarily pregnancies from the 8th through the 12th week of gestation with the presence of fetal heartbeat. These women had no history of previous abortions and between 25–33 years old. Trophoblast samples were isolated under a dissecting microscope at the time of dilation and curettage and dissected into freezing tubes, transported in liquid nitrogen to the laboratory and stored at −80°C immediately after being washed thoroughly. Controls were individuals of proven fertility, who have at least two healthy children, with normal menstrual cycles and ovary morphology, without the history of subfertility treatment. Written consents were obtained from all participants prior to surgery. All activities involved in this study were done under full compliance with government policies and the Helsinki Declaration. This study was approved by the Institutional Ethics Committee of Xuzhou Medical University. This research obtains review and approval from the Xuzhou Medical University institutional research committee (IRB). Following IRB review and approval, the Investigator obtains informed consent from the mother as determined by the IRB. After lengthy review, the Committee determined that there is no difference between the moral status of a fetus destined for abortion and that of a fetus, which is expected to be carried to term. Therefore, only those research procedures that are acceptable for a fetus going to term may be performed in anticipation of abortion, to preserve the mother's right to change her mind about ending the pregnancy.

TABLE 1.

Clinical information of participants

Subject	Recurrent miscarriage (RM, mean ± S.D. n = 30)	Control (mean ± S.D. n = 15)
Age (years)	28.8 ± 3.1	27.6 ± 5.1
Gestation age(weeks)	8.3 ± 2.6	8.5 ± 3.3
Number of abortions	3 ± 1.4	0 ± 0
Parental chromosomes	No identification of chromosomal abnormalities	No identification of chromosomal abnormalities
Fetal chromosomes	No identification of chromosomal abnormalities	No identification of chromosomal abnormalities

The tissue collection processes followed regulatory requirements:

1. The decision to terminate a pregnancy and procedures of abortion must be kept independent from the retrieval and use of fetal tissue.

2. The timing and method of abortion should not be influenced by the potential uses of fetal tissue for transplantation or medical research.

2.2. Primary trophoblast isolation

The primary human trophoblasts were isolated from the placenta following the reported protocol. ¹⁹ Briefly, fresh human placentas was obtained at delivery and placed on ice before preparation. The villous tissues were gently scraped free from vessels and connective tissue using the blunt edge of a scalpel. After washing with PBS, the tissue was cut into small pieces and then subjected to three digestion cycles with 0.25% trypsin and 0.2 mg/ml DNAse. Cell suspensions were filtered and then separated using a discontinuous Percoll gradient centrifugation. The layer between the 45% and 35% Percoll aliquots was collected and the cells were obtained by centrifuge. The isolated cells were plated on a Matrigel coated culture surface in complete DMEM at 37°C in 5% CO₂. After attached for 4 h, the medium and unattached cells were removed.

2.3. Plasmid construction and virus packaging

For GAS5 overexpression plasmid construction, full length of human GAS5 was cloned into pLV‐C‐GFPSpark (Sino Biology, Shanghai, China) vector. The GAS5 overexpression vector was co‐transfected with lentivirus packaging vectors (pMDLg/pRRE, pRSV‐Rev and pMD2.G) into HEK293T cells. The supernatant was collected at 48 and 72 h after transfection.

2.4. Cell culture

Human trophoblast cell line HTR‐8/SVneo and human embryonic kidney cell (HEK293T) were purchased from American Type Culture Collection (ATCC) and cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (Hyclone, Logan, UT, USA), 100 IU/ml penicillin and 10 mg/ml streptomycin. All cells were maintained at 37°C under an atmosphere of 5% CO₂.

2.5. RNA extraction

Total RNA was extracted from tissues or cells by using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The RNA concentration and purity were determined using a model ND‐1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). Only samples with absorbance ratios 260 nm/280 nm of ~2.0, and 260 nm/230 nm of 1.9–2.2 were considered for inclusion in the study.

2.6. Quantitative RT‐PCR

The level of GAS5 and the mRNA level of TNF‐α was quantified by qRT‐PCR using SYBR Green Real‐Time PCR Master Mix (Thermal Fisher Scientific), with β‐actin level as the loading control. The miRNAs expression were determined by qRT‐PCR using commercial TaqMan miRNA probes and primers. The level of U6 snRNA was used as loading control. Each sample in each group was measured in triplicate and the experiment was repeated at least three times. The method of ‐ΔΔct was used to determine the relative level of target genes.

The primers' sequences are:

ACTB‐F: 5′‐ CACCATTGGCAATGAGC‐3′, ACTB‐R: 5′‐ AGGTCTTTGCGGATGTC‐3′; TNF‐F: 5′‐ AGGGACCTCTCTCTAATCAG‐3′, TNF‐R: 5’‐CGGCTGATGGTGTGGGTGAG‐3′; GAS5‐F: 5′‐ TGAGGAACTTCGGAGAAGA‐3′, GAS5‐R: 5′‐ GACACAACTGTCCATAAG‐3′.

2.7. Dual luciferase assay

For reporter vectors construction, the full length of human GAS5 and TNF‐α 3′UTR were cloned into pmirGLO vector separately, downstream of the firefly luciferase coding region. HEK293T cells were seeded in 48‐well plates. One of the Luciferase reporter vectors was co‐transfected with miRNAs mimics or inhibitors by using lipofectamine 2000 (Invitrogen, Carlsbad, CA USA). Two days after transfection, cells were harvested and assayed with the Dual‐Luciferase Assay (Promega, Madison, WI USA). Each treatment was performed in triplicate in three independent experiments. The results were expressed as relative luciferase activity (Firefly LUC/Renilla LUC).

2.8. Flow cytometry analysis

Cells were incubated with one of the APC labeled antibodies (BioLegend) at 25°C for 30 min. After staining by PI (1.0 μg/ml) for 10 min at 4°C, the cells were subjected to flow cytometry. Each treatment was performed in triplicate in three independent experiments, PI staining was used to separate dead cells.

2.9. Immunoblotting

All protein samples were denatured by boiling in sodium dodecyl sulfate/β‐mercaptoethanol loading buffer and then were separated using 10% PAGE GEL. The proteins in the gels were blotted onto a polyvinylidene fluoride membrane (Amersham Pharmacia Biotech, St. Albans, Herts, UK) by electrophoretic transfer and then incubated with one of the primary antibodies overnight at 4°C after blocking by 5% BSA. The membranes were incubated with horseradish peroxidase conjugated secondary antibody for another 2 h at room temperature and then the signals were detected by using ECL kit (Pierce, Appleton, WI, USA).

2.10. T cell in vitro differentiation

Human naïve T cells were isolated from human peripheral blood by using Naive Pan T Cell Isolation Kit (Miltenyi Biotec). The cells were cultured in medium containing 5 ng/ml phorbol myristate acetate (PMA) (sigma) plus 1 μM ionomycin (sigma), ²⁰ , ²¹ with the medium from trophoblasts, and differentiated for 3 days. The cells were subjected to flow cytometry after staining.

2.11. Statistical analysis

Statistical analysis was performed using SPSS software version 19.0 (IBM Corp., Armonk, NY, USA). All results were analyzed by students' t test and two tailed P < 0.05 was considered to indicate a statistically significant difference.

3. RESULTS

To explore the roles of the GAS5 in the development of RPL, the GAS expression level was detected in the clinical samples from 30 RPL patients and 15 healthy controls. As shown in Figure 1(A), the expression of GAS5 was significantly up‐regulated in the plasma and trophoblasts from patients with RPL.

FIGURE 1.

GAS5 and TNF‐α are overexpressed in patients with RPL. The plasma and trophoblasts were collected from 30 patients with RPL and 15 healthy controls. The expression of GAS5 was examined by qRT‐PCR. The levels of TNF‐α and IFN‐γ were examined by ELISA and immunoblotting. Results were analyzed by students' t test and p < 0.05 was considered significant. *p < 0.05, **p < 0.01. RPL, recurrent pregnancy loss

TNF‐α and IFN‐γ are two Th1 cytokines which has been reported up‐regulated in patients with RPL and may contribute to RPL. ²² , ²³ So, the levels of TNF‐α and IFN‐γ in plasma and trophoblasts were examined by ELISA and immunoblotting. As shown in Figure 1(B), the levels of TNF‐α and IFN‐γ in plasma were both up‐regulated in RPL patients. Meanwhile, the expression of TNF‐α was significantly increased in trophoblasts from RPL patients. The expression of IFN‐γ was slightly upregulated in trophoblasts from RPL patients, but the difference is not significant.

It has been reported that several lncRNAs are involved in the regulation of immune responses including GAS5. ²⁴ , ²⁵ To explore whether there is a relationship between upregulated GAS5 and increased TNF‐α in RPL patients, the correlations between the GAS5 expression and TNF‐α levels in the plasma or in trophoblasts were analyzed. As shown in Figure 2A, a weak positive correlation (R = 0.35, p = 0.012) between trophoblasts GAS5 expression and plasma TNF‐α level was observed in patients with RPL. Meanwhile, a strong positive correlation (R = 0.54, p = 0.0021) between trophoblasts GAS5 and trophoblasts TNF‐α protein level was found in RPL patients (Figure 2A). To understand whether GAS5 directly regulates TNF‐α transcription, the mRNA level of TNF‐α in trophoblasts from RPL patients and controls were quantified by qRT‐PCR. As shown in Figure 2B, the TNF‐α mRNA level was similar in the trophoblasts between control and RPL patients. No significant correlation was found between GAS5 and TNF‐α mRNA level in the trophoblasts (Figure 2C). Similar results were found in the control group. As shown in Figure S1, the GAS5 expression in the trophoblasts was positively correlated with the TNF‐α level in the plasma and trophoblasts, but not correlated with the TNF‐α mRNA level. These results indicated that GAS5 may regulate TNF‐α expression at post transcriptional level.

FIGURE 2.

GAS5 level is positively correlated with TNF‐α protein level. The correlations between the mRNA and protein levels of TNF‐α and the GAS5 level in trophoblasts were analyzed by the chi‐square (χ2) test

It has been reported that TNF‐α expression is regulated by several miRNAs including miR‐140‐5p, miR‐181c, miR‐187. ²⁶ , ²⁷ To explore whether GAS5 regulates TNF‐α expression via binding with miRNAs, the interactions between GAS5 and these three candidate miRNAs were predicted using RNAhybrid (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/). As shown in Figure 3(A), a strong predicted interaction was found between GAS5 and miR‐140‐5p containing 18 base pairing. Subsequently, the full length GAS5 was cloned into pmirGLO vector, downstream the firefly coding region, forming the GAS5 reporter vector. Meanwhile, full GAS5 sequence with five nucleotides mutation was constructed as the mutant reporter vector (Figure 3(A)). Results of dual luciferase assay indicated that, the relative luciferase activity was significantly suppressed by miR‐140‐5p and up‐regulated by anti‐miR‐140‐5p (Figure 3(B)). However, miR‐140‐5p cannot suppress the luciferase activity which was expressed by the mutant reporter, indicating that miR‐140‐5p inhibits luciferase expression through binding with GAS5.

FIGURE 3.

GAS5 interacts with miR‐140‐5p. (A) predicted interaction between GAS5 and miR‐140‐5p. (B) Dual luciferase assay. Results were analyzed by students' t test and p < 0.05 was considered significant. *p < 0.05, **p < 0.01

To investigate whether GAS5 regulates endogenous TNF‐α expression in trophoblasts, GAS5 was knocked down by siRNAs (Figure S2A). We found that the luciferase activity of TNF‐α 3′UTR reporter was reduced in GAS5 knock down cells (Figure S2B). Meanwhile, the secreted (Figure S2C) and intracellular (Figure S2D) TNF‐α levels were reduced in GAS5 knock down cells without significant mRNA level reduction (Figure S2). Reversibly, when GAS5 was overexpressed (Figure 2SF), the luciferase activity of TNF‐α 3′UTR reporter was upregulated (Figure S2G). The secreted (Figure S2H), and intracellular (Figure S2I) TNF‐α levels were increased, while the TNF‐α mRNA level was not significantly changed (Figure S2J).

To further understand whether GAS5 protects TNF‐α expression through binding with miR‐140‐5p, the TNF‐α 3′UTR reporter vector was transfected into HEK293T cells with or without miR‐140‐5p and GAS5 expressing vector for dual luciferase assay. As shown in Figure 4(A), the luciferase activity was significantly inhibited by miR‐140‐5p, which was totally restored by GAS5. To explore the impact of GAS5 overexpression on endogenous TNF‐α expression, HTR‐8/SVneo cells were transfected with miR‐140‐5p or control RNA oligo, with or without GAS5 expressing vector. Forty‐eight hours post‐transfection, the cells were subjected to immunoblotting, and the medium was subjected to ELISA. As shown in Figure 4(B), the intracellular TNF‐α level in HTR‐8/SVneo cells was inhibited by miR‐140‐5p, which was restored by GAS5 overexpression. Similarly, the secreted TNF‐α level was reduced by miR‐140‐5p and which was restored by GAS5(Figure 4(C)), indicating that GAS5 functions as ceRNA, protects TNF‐α expression by binding with miR‐140‐5p.

FIGURE 4.

GAS5 protects TNF‐α expression by binding with miR‐140‐5p. (A) HEK293T cells were transfected with TNF‐α reporter with or without miR‐140‐5p and GAS5 expression vector. Forty‐eight hours post transfection, the cells were subjected to dual luciferase assay. (B) HTR‐8/SVneo cells were transfected with or without miR‐140‐5p and GAS5 expression vector. Forty‐eight hours after transfection, the cells were subjected to immunoblotting. (C) The cell culture medium was subjected to ELISA. Primary trophoblasts were infected by GAS5 or control lentivirus, and then transfected with miR‐140‐5p mimic or control RNA. Forty‐eight hours after transfection, the cells were subjected to qRT‐PCR (D) and immunoblotting(E). The cell culture medium was subjected to ELISA(F). Results were analyzed by students' t test and p < 0.05 was considered significant. *p < 0.05, **p < 0.01

Similar results were found in primary trophoblasts isolated from termed placenta. GAS5 overexpression (Figure 4(D)) restored the repressive function of miR‐140‐5p on secreted (Figure 4(E)) and intracellular (Figure 4(F)) TNF‐α expression.

To explore whether GAS5 overexpression in trophoblasts regulates Th1/Th2 balance, human naïve T cells were firstly activated by PMA and ionomycin, and then incubated with the cell culture medium from GAS5 overexpression HTR‐8/SVneo cells. The cell surface CD4, TNF‐α, IFN‐γ, IL‐4 and IL‐10 were examined by flow cytometry. As shown in Figure 5(A), the number of TNF‐α or IFN‐γ positive T helper cells were increased by the medium from GAS5 overexpression HTR‐8/SVneo cells. Meanwhile, the number of IL‐4 and IL‐10 T helper cells were reduced by the medium from GAS5 overexpression HTR‐8/SVneo cells.

FIGURE 5.

Medium from GAS5 overexpression HTR‐8/SVneo cells and primary trophoblasts promotes Th1 bias (A) Human naïve T cells were isolated from human peripheral blood and cultured in medium containing PMA plus ionomycin, with the medium from HTR‐8/SVneo cells, and differentiated for 3 days. The cells were subjected to flow cytometry after staining. (B) Human naïve T cells were isolated from human peripheral blood and cultured in medium containing PMA plus ionomycin, with the medium from primary trophoblasts, and differentiated for 3 days. The cells were subjected to flow cytometry after staining. Results were analyzed by students' t test and p < 0.05 was considered significant. *p < 0.05, **p < 0.01. PMA, phorbol myristate acetate

Similarly, activated T cells co‐cultured with the medium from GAS5 overexpression primary trophoblasts exhibited increased TNF‐α, IFN‐γ and reduced IL‐4 and IL‐10 (Figure 5(B)). These results indicated that GAS5 may regulates Th1/Th2 balance through regulating cytokines secretion.

4. DISCUSSION

GAS5 has been identified to play a role in modulating human immune system, but its function during the development of RPL is still unclear. In the present study, GAS5 expression was found overexpressed in trophoblasts from patients with RPL for the first time. Since GAS5 was identified existed in the exosomes and can be released into peripheral blood, ²⁸ , ²⁹ so the plasma GAS5 level was also detected. The overexpression of GAS5 has the potential to be a biomarker for RPL prediction.

Human placenta allows an intimate contact between maternal and fetal cells during pregnancy, which results in tightly controlled immune interactions between the mother and the child. Placenta is also an endocrine organ formed during pregnancy, that produces hormones and cytokines to regulate the activation and differentiation of immune cells. Evidences indicate that Th1 bias in the maternal circulation and placenta cells contributes to miscarriages. ⁴ , ³⁰ , ³¹ An increase in Th1 cytokines, especially TNFs and INFs concentrations, ranging from 40% to 70% were observed in the abortion group compared to controls. ³² In the present study, we confirmed that the levels of circulating and placental TNF‐α and INF‐γ were all upregulated in patients with RPL, these findings were consistent with the reports of other researchers.

TNF‐α is a multiple functional Th1 cytokine which was found elevated in patients with RPL. ³³ Several researchers reported that polymorphisms in the promoter region of TNF‐α coding gene relates to the overexpression of TNF‐α in RPL patients. ³³ , ³⁴ However, controversial results were existed and these findings need to be confirmed in larger samples and in different ethnic groups. ³⁵ In the present study, the protein level of TNF‐α was found overexpressed in patients with RPL but the mRNA level of TNF‐α was not significantly altered. The finding of post transcriptional regulation of TNF‐α expression provide a new clue to explain why TNF‐α is dysregulated in patients with RPL.

MiR‐140‐5p has been found to be an immune response inhibitor in patients with acute lung injury, osteoarthritis and pulmonary arterial hypertension. ³⁶ , ³⁷ , ³⁸ It is reported that miR‐140‐5p directly target TNF‐α and repressed its expression in pulmonary artery smooth muscle cells. ³⁶ In the present study, we confirmed that miR‐140‐5p also repressed TNF‐α in trophoblasts. Meanwhile, we identified the interaction between miR‐140‐5p and GAS5 for the first time. We successfully constructed the GAS5‐miR‐140‐TNF‐α axis in trophoblast, and provided a clue to understand the role of GAS5 in RPL.

GAS5 was firstly identified to be related to the cell cycle arrest in mouse embryo NIH 3 T3 cells. ³⁹ Emerging evidences indicate that GAS5 also play a role in the placenta. D Mparmpakas et al. identified that GAS5 is expressed in both preterm and term placentas, and primarily localize in the syncytiotrophoblast, and the placental GAS5 level is inversely correlated with maternal stress, which may have the potential to predict birth outcomes. ¹⁴ In the placenta of preclamisa affected women, GAS5 is found overexpressed, which may influence the biological functions of trophoblast cells through repressing miR‐21 and activating of PI3K/AKT signaling pathway. ¹⁵ These findings indicate that GAS5 may play a key role during the normal pregnancy. In the present study, we unveiled the mechanism of how GAS5 regulates TNF‐α expression in trophoblasts. We tried to explore the role of overexpressed GAS5 in regulating the T cells differentiation in the placental microenvironment. To our knowledge, this is the first report that successfully constructs the correlation between GAS5 overexpression and Th1 bias, which provide a new angle to explain the pathophysiological processes of RPL. However, our research are all in vitro experiments, and these findings needs to be further confirmed by using in vivo models.

There are several limitations about this study. First, GAS5 was firstly identified as a cell cycle arrest related lncRNA in 3 T3 cells. In the present study, we found GAS5 is overexpressed in trophoblast from RPL patients, and regulate T cell differentiation via modulating TNF‐α expression. However, the function of GAS5 in trophoblasts is still unclear. Second, it hard to identify whether the upregulated TNF‐α is released by trophoblast in vivo. So GAS5 transgenic mouse model needs to be constructed to confirm these findings. Third, the mechanism of how GAS5 is upregulated in RPL patients is unknown which needs to be further unveiled.

In conclusion, GAS5 was found overexpressed in the plasma and trophoblasts from RPL patients and to contribute to Th1 bias by binding with miR‐140‐5p.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Supporting information

Figure S1 GAS5 level is positively correlated with TNF‐α protein level in control group.

The correlations between the mRNA and protein levels of TNF‐α and the GAS5 level in trophoblasts were analyzed by the chi‐square (χ2) test.

Figure S2 GAS5 regulate TNF‐α expression at post transcriptional level.

HTR‐8/SVneo cells were transfected with one of the GAS5 siRNAs with sequence scrambled short RNA as control. Forty‐eight hours after transfection, the cells were subjected to qRT‐PCR(A). HTR‐8/SVneo cells were transfected with TNF‐α 3′UTR reporter vector with or without GAS5 siRNAs for 48 h. The cells were then subjected to dual luciferase assay(B). HTR‐8/SVneo cells were transfected with one of the GAS5 siRNAs for 48 h. The cell culture medium was subjected to ELISA(C), and the cells were subjected to immunoblotting(D) and qRT‐PCR(E).

HTR‐8/SVneo cells were transfected with GAS5 expression vector, with empty vector as control. The cells were subjected to qRT‐PCR 48 h after transfection(F). HTR‐8/SVneo cells were transfected with TNF‐α 3′UTR reporter vector with or without GAS5 overexpression vector. Forty‐eight hours after transfection, the cells were subjected to dual luciferase assay(G). HTR‐8/SVneo cells were transfected with GAS5 overexpression vector for 48 h, with empty vector as control. The cell culture medium was subjected to ELISA(H), and the cells were subjected to immunoblotting(I) and qRT‐PCR(J). Results were analyzed by students' t test and p < 0.05 was considered significant. *p < 0.05, **p < 0.01.

Wang M‐M, Zhong J‐X, Xiang Y‐Y. LncRNA‐GAS5 related to the processes of recurrent pregnancy loss by regulating Th1/Th2 balance. Kaohsiung J Med Sci. 2021;37:479–486. 10.1002/kjm2.12360