Skip to main content
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2020 Apr 20;36(9):741–749. doi: 10.1002/kjm2.12219

MiR‐370 accelerated cerebral ischemia reperfusion injury via targeting SIRT6 and regulating Nrf2/ARE signal pathway

Zhong‐Fan Ruan 1, Ming Xie 1, Shu‐Jia Gui 2, Fang Lan 1, Juan Wan 1, Yan Li 3,✉
PMCID: PMC11896186  PMID: 32311231

Abstract

Cerebral ischemia reperfusion (CIR) is one of the highly lethal diseases in the world. MicroRNA‐370 (miR‐370) exerts multiple functions in different diseases. However, further research is needed to investigate the potential role of miR‐370 in CIR injury. The in vivo middle cerebral artery occlusion (MCAO) rat model and in vitro oxygen‐glucose deprivation/reoxygenation (OGD/R) SH‐SY5Y cell model were successfully established to mimic CIR injury. The infarct sizes of brain tissues from rats were evaluated. The relationship between miR‐370 and silencing information regulatory protein 6 (SIRT6) was confirmed by luciferase activity assay. The cell viability and apoptosis were determined by CCK‐8 assay and terminal‐deoxynucleoitidyl transferase mediated nick end labeling staining. In this study, miR‐370 was upregulated in brain tissues of MCAO rats and knockdown of miR‐370 decreased cerebral infarction volume of MCAO rats and it alleviated CIR injury in vivo. The in vitro experiments indicated that knockdown of miR‐370 promoted cell viability and alleviated OGD/R‐induced SH‐SY5Y cell apoptosis. Additionally, the TargetScan predicted that SIRT6 was a target of miR‐370 and confirmed by luciferase activity assay. Moreover, miR‐370 inhibited SIRT6 expression and regulated Nrf2/ARE signal pathway, whereas overexpression of SIRT6 partly reversed the effect of miR‐370 on OGD/R‐induced SH‐SY5Y cell injury. Thus, we could conclude that miR‐370 accelerated CIR injury via targeting SIRT6 and regulating Nrf2/ARE signal pathway, which might provide novel therapeutic targets for CIR injury treatment.

Keywords: cerebral ischemia reperfusion injury, MiR‐370, Nrf2/ARE signal pathway, SIRT6

1. INTRODUCTION

Cerebral ischemic stroke is one of the highly lethal diseases in the world, which might be caused by a variety of risk factors including hypertension, atherosclerosis, thrombosis, and diabetes. 1 Recovery of blood flow and reoxygenation after cerebral ischemia can lead to hemorrhagic transformation, blood‐brain barrier destruction, and brain damage, followed by oxidative stress, apoptosis, the activation of inflammatory, and the abnormal expression of proteins.2, 3, 4 Unfortunately, limited drugs and therapeutic strategies are limited to decrease the high death rate. Therefore, the suppression of oxidative stress, apoptosis, and inflammatory activation is of great importance for the treatment and prognosis of cerebral ischemia reperfusion (CIR) injury. Nevertheless, the mechanism of CIR‐injury‐induced responses is more complicated and needs further exploration.

MicroRNAs (miRNAs), a series of noncoding single‐stranded RNA at a length of 18 to 25 nucleotides, play an important role in the regulation of transcription by targeting downstream genes. 5 Accumulating evidences have confirmed that the dysregulation of miRNA is associated with neurological diseases, including stroke, 6 Parkinson's disease, 7 and Alzheimer's disease. 8 In ischemic stroke, miRNAs regulate angiogenesis, apoptosis, and oxidative stress. Compared with healthy subjects, miR‐181c is decreased in the plasma of stroke patients and resulted in aggravated brain damage. 9 A recent study has demonstrated that miR‐370 is increased in hepatic reperfusion and it aggravates hepatic injury via regulating NF‐κB pathway. 10 It has also reported that miR‐370 promotes ischemia‐reperfusion‐induced inflammatory response by targeting TbRII. 11 In mesenchymal stem cells, miR‐370 is downregulated and protects against liver ischemia‐reperfusion injury. 12 On the contrary, Zhao et al have confirmed that miR‐370 has protective effects on myocardial ischemia‐reperfusion injury. 13 In the nervous system, Yang et al have pointed that delta opioid receptor (DOR) can reduce the expression of miR‐370 in the hypoxic‐induced animal cortex, and then promote cell survival, indicating that miR‐370 may be involved in hypoxic‐treated nerve damage. 14 Moreover, upregulation of miR‐370 is associated with the reduction of heat shock protein 40 and then promotes the pathological progression of brain diseases in spinocerebellar ataxia type 3. 15 Thus, the effect of miR‐370 on multiple diseases has been clarified. However, the studies about the function of miR‐370 on CIR injury remain unclear. This study focused on the impact of miR‐370 on the diagnosis, prognosis, and therapeutic intervention of CIR injury.

In this study, miR‐370 was upregulated in CIR rat model, and knockdown of miR‐370 could reduce CIR‐induced brain damage and suppress neuronal apoptosis. Through TargetScan website prediction and the luciferase activity assay, silencing information regulatory protein 6 (SIRT6) was verified to be a target of miR‐370. Previous studies have demonstrated that SIRT6 activates the Nrf2/ARE pathway to protect against CIR injury. 16 This study has confirmed that miR‐370 accelerates CIR injury via targeting SIRT6 and regulating the Nrf2/ARE signaling pathway, which could provide novel therapeutic targets for CIR injury treatment.

2. METHODS AND MATERIALS

All animal experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the Ethics Committee of The First Affiliated Hospital of University of South China.

2.1. In vivo rat model establishment and treatment

Male Sprague‐Dawley (SD) rats, weighting 210 ± 20 g, were purchased from NanJingJunKe company (NanJing, Jiangsu Province, China). All rats were fed with standard feeding and adequate water, and adopted for a week before experiments. The Middle Cerebral Artery Occlusion (MCAO) rats were induced by CIR injury. The antagomir miR‐370 and antagomir NC were purchased from Riobio company (China). Before MCAO surgery, all rats were randomly divided into four groups, including Sham, MCAO, MCAO + antagomir NC, and MCAO + antagomir miR‐370 groups (n = 5 in each group). Briefly, the MCAO + antagomir NC and MCAO + antagomir miR‐370 rats (a total of 10 SD rats, five rats per group) were deeply anesthetized, and antagomirmiR‐370 (20 nmol/mL) or antagomir NC was injected into the lateral ventricle of the rat. The injection position was 0.8 mm posterior, 4.8 mm dorsal abdomen, and 1.5 mm lateral bregma. After 3 days, the rats received MCAO surgery.

2.2. MCAO model establishment

A total of 15 rats from MCAO, MCAO + antagomir NC, and MCAO + antagomir miR‐370 groups were received MCAO surgery. Briefly, rats were anaesthetized using 10% chloral hydrate (300 mg/kg). After deep anesthesia, the blood vessels were separated and the middle cerebral artery was closed with 18 to 20 mm monofilament nylon suture. The rats were housed at 37°C after operation. After 2 hours, the suture was removed to induce reperfusion. Sham rats underwent the same surgery without the suture insertion.

2.3. Cell culture and transfection

The SH‐SY5Y cells were purchased from Procell company and cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Las Vegas, Nevada) containing 10% fetal bovine serum (FBS, Gibco) in 5% CO2 at 37°C.

The miR‐370 inhibitor, NC‐inhibitor, miR‐370 mimic, or miR‐NC was transfected into SH‐SY5Y cells by Lipofectamine 2000 Transfection Reagent (Invitrogen, Waltham, Massachusetts). The pcDNA3.1‐SIRT6 vector was generated by inserting the open reading frame of SIRT6 without 3′‐UTR into the pcDNA3.1 vector (Beijing Genomics Institute BGI, China). Before OGD/R treatment, SH‐SY5Y cells were cultured in six‐well plates and transfected with miR‐370 mimic at a final concentration of 30 nM to overexpress miR‐370. The overexpression of SIRT6 was performed by transfected with pcDNA3.1‐SIRT6 at a final concentration of 20 μM. In the rescue experiments, SH‐SY5Y cells were co‐transfected with pcDNA3.1 or pcDNA3.1‐SIRT6 and miR‐370 mimic or miR‐NC.

To establish an OGD/R in vitro model, the SH‐SY5Y cells after transfection were transferred to glucose‐free DMEM medium and maintained for 30 minutes in the hypoxic condition (5% CO2, 1% O2, 94% N2), followed by reoxygenation for 4 hours.

2.4. Measurement of infarct size in brain tissue

Rats (n = 5 per group) were euthanized by decapitating under chloral hydrate anesthesia (10%, 0.5 mL/100 g) and decollated to remove the brain tissue. Then, the brain was cut into slices, immersed in 2% 2, 3, 5‐triphenyltetrazolium chloride (TTC; G3005, Solarbio, China), and washed with normal saline for 20 minutes. After that, the brain slices were fixed in 4% paraformaldehyde solution and photographed. The Image J software (ver1.37c; Bethesda, Maryland) was used to evaluate infarct size. The infarct volume presented as a percentage of the contralateral hemisphere, which was calculated by 100% × (contralateral hemisphere volume minus noninfarct ipsilateral hemisphere volume)/contralateral hemisphere volume.

2.5. Detection of lactate dehydrogenase and malondialdehyde

The activity of lactate dehydrogenase (LDH) and the concentration of malondialdehyde (MDA) was measured by using corresponding commercial kits that were purchased from NanJingJianCheng company (NanJing, Jiangsu Province, China) according to the manufacturer's instructions.

2.6. Cell Counting Kit‐8 assay

The changes of cell viability were detected by a Cell Counting Kit‐8 (CCK‐8 Kit; C0038, Beyotime, China). The SH‐SY5Y cells after treatment were cultured in 96‐well plates for 48 hours and then incubated with 100 μL CCK‐8 solution at 37°C for 1 hour. Then, the absorbance at 450 nm was determined by microplate.

2.7. Terminal‐deoxynucleoitidyl transferase mediated nick end labeling staining

The cell apoptosis was determined by terminal‐deoxynucleoitidyl transferase mediated nick end labeling (TUNEL) assay. The SH‐SY5Y cells after treatment were collected, fixed in 4% paraformaldehyde, and then washed with phosphatic buffer solution (PBS). The apoptosis level was assessed by a One Step TUNEL Apoptosis Assay Kit (MA0224; Meilune, China) according to the manufacturer's instructions. The cell apoptosis was stained in red and the cell nucleus was stained in blue (DAPI), which were visualized with a fluorescence microscopy (DMi8, Leica, Germany).

2.8. Luciferase activity analysis

The TargetScan website predicted that miR‐370 could bind to SIRT6 3′‐UTR. Based on this finding, the wild type of SIRT6 3′‐UTR (SIRT6‐WT) harboring the miR‐370 binding site and mutation of SIRT6 3′‐UTR (SIRT6‐MUT) seed sequences were inserted into pGL3 luciferase promoter plasmid (Promega, Madison, Wisconsin), marked as SIRT6‐WT and SIRT6‐MUT, which were co‐transfected with miR‐NC or miR‐370 into HEK293 cells using lipofectamine 3000. Finally, the luciferase reporter activity was measured by using a Dual Luciferase Reporter Assay System (Promega) according the protocols.

2.9. Quantitative real‐time polymerase chain reaction

Total RNA was isolated by TRIzol reagent (15596‐026; Ambion, Austin, Texas), and reverse transcription to obtain cDNA was performed by PrimeScript RT reagent Kit gDNA Eraser (RR047A; Takara, Japan). Quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed with SYBR Premix EX Taq Kit (DRR041A; Takara, Japan). GAPDH or U6 was regarded as the internal control. The gene expression was calculated with 2−ΔΔCt method. The primer sequences were as follows: GAPDH‐forward: 5′‐AGACAGCCGCATCTTCTTGT‐3′, GAPDH‐reverse: 5′‐TGATGGCAACAATGTCCACT‐3′; U6‐forward: 5′‐CTCGCTTCGGCAGCACA‐3′, U6‐reverse: 5′‐AACGCTTCACGAATTTGCGT‐3′; miR‐370‐forward: 5′‐TACTCAGGATCCTGTGCAAGGCGGGCTACT‐3′, miR‐370‐reverse: 5′‐TACTCAAAGCTTCCCTCCCTCACCCAAATC‐3′; SIRT6‐forward: 5′‐CCAAGTTCGACACCACCTTT‐3′; SIRT6‐reverse: 5′‐CGGACGTACTGCGTCTTACA‐3′.

2.10. Western blot

The total proteins from tissues or cells were isolated by RIPA Lysis and Extraction Buffer RIPA (89 900, Pierce). Then, the proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS‐PAGE) and then transferred to a polyvinylidene fluoride membrane. The membrane was incubated with 5% skim milk for 1 hour and then immunoblotted with primary antibodies against SIRT6 (1:500; sc‐517 196, Santa Cruz Biotechnology [SCBT]), β‐actin (1:500; sc‐47 778, SCBT, Dallas, Texas ), Nrf2 (1:500; sc‐365 949, SCBT), HO‐1 (1:400; ab69545, Abcam, Eugene, Oregon), NQO1 (1:400; ab28947, Abcam), Cleaved caspase‐3 (1:500; sc‐7272, SCBT) or Cleaved PARP (1:500; sc‐56 196, SCBT) overnight at 4°C. Then, the membrane was washed with Tris‐buffered saline with Tween 20 (TBST) for three times and incubated with m‐IgGκ BP‐HRP (mouse IgGκ binding protein‐HRP; 1:5000; sc‐8017, SCBT) at room temperature for 1 hour. Finally, the expression of protein was visualized by an ECL Western Blotting Substrate Kit (K820‐50, Biovision, Milpitas, California).

2.11. Statistical analysis

All data were expressed as mean ± SD (SD) and calculated by Graphpad 7.0 (La Jolla, California). The comparison among more than two groups was using one‐way analysis of variance followed by a post hoc Bonferroni test. The comparison between two groups was using the student's t test. Differences with a value less than 0.05 (P < .05) were considered statistically significant.

3. RESULTS

3.1. MiR‐370 was upregulated in brain tissues of MCAO rats and knockdown of miR‐370 alleviated CIR injury

To verify the effects of miR‐370 on CIR injury, the MCAO rat model was successfully established with 2 hours of ischemia and 24 hours of reperfusion. In Figure 1A, the miR‐370 was upregulated in brain tissues of MCAO rats compared with that of sham rats (n = 5 in each group). Moreover, compared to antagomir NC, the antagomir miR‐370 could significantly downregulate the expression of miR‐370 in brain tissues of MCAO rats. As shown in Figure 1B, the cerebral infarction volume in MCAO rats was significantly increased as compared that in sham rats. Furthermore, antagomir miR‐370 reduced the increase of cerebral infarction volume in MCAO rats compared to antagomir NC. Then, the effects of miR‐370 on LDH expression and inflammatory responses in response to CIR injury were assessed. As illustrated in Figure 1C, the activity of LDH and the concentration of MDA were significantly increased in brain tissues of MCAO rats compared with that of sham group, whereas these changes were reversed by knockdown of miR‐370. More importantly, we examined the expression of Nrf2 and HO‐1, suggesting that MCAO induced the expression of Nrf2 and HO‐1, and knockdown of miR‐370 further promoted the expression of Nrf2 and HO‐1 in vivo. These findings indicated that miR‐370 was upregulated in brain tissues of MCAO rats and knockdown of miR‐370 alleviated CIR injury, which might participate in Nrf2/HO‐1 signal pathway.

FIGURE 1.

FIGURE 1

MicroRNA‐370 (MiR‐370) was upregulated in middle cerebral artery occlusion (MCAO) rats and knockdown of miR‐370 alleviated cerebral ischemia reperfusion (CIR) injury. A, The expression of miR‐370 was detected in rats of the sham, MCAO, MCAO+antagomir NC and MCAO + antagomir miR‐370 group by qRT‐PCR (n = 5 in each group). B, The 2, 3, 5‐triphenyltetrazolium chloride (TTC) staining was performed to evaluate the brain infarct volumes of rats in different groups. C, The activity of lactate dehydrogenase (LDH) and the concentration of malondialdehyde (MDA) were determined in rats of different groups by commercially available kits. D, The expression of Nrf2 and HO‐1 in rats. **P < .01

3.2. Knockdown of miR‐370 alleviated OGD/R‐induced SH‐SY5Y cell injury

In order to investigate the influence of miR‐370 on CIR injury, an OGD/R‐induced SH‐SY5Y cell injury model was established to mimic CIR injury in vitro. As shown in Figure 2A, the qRT‐PCR assay suggested that the miR‐370 expression was significantly promoted in SH‐SY5Y cells after OGD treated for 30 minutes and reperfusion for 4 hours compared to control cells. However, the increase of miR‐370 expression in OGD/R‐treated SH‐SY5Y cells was inhibited by transfected with miR‐370 inhibitor. Additionally, the CCK‐8 assay indicated that OGD/R treatment significantly decreased the ability of SH‐SY5Y cell, whereas the decreased cell viability was increased by miR‐370 inhibitor, suggesting that OGD/R treatment inhibited cell viability and miR‐370 inhibitor partly reversed the results (Figure 2B). Then, the effects of miR‐370 on LDH expression and inflammatory responses in OGD/R‐induced SH‐SY5Y cells were determined. As shown in Figure 2C, the activity of LDH and the concentration of MDA were inhibited by OGD/R treatment but promoted by miR‐370 inhibitor, which was consistent with the in vivo results. Furthermore, OGD/R treatment remarkably induced cell apoptosis, which was reversed by miR‐370, as determined by TUNEL apoptosis assay (Figure 2D). Thus, knockdown of miR‐370 alleviated OGD/R‐induced SH‐SY5Y cell injury.

FIGURE 2.

FIGURE 2

Knockdown of microRNA‐370 (miR‐370) alleviated oxygen‐glucose deprivation/reoxygenation (OGD/R)‐induced SH‐SY5Y cell injury. The SH‐SY5Y cells were transfected with miR‐370 inhibitor or NC inhibitor, and then were exposed to OGD for 30 minutes and reperfusion for 4 hours. A, The miR‐370 expression was detected by qRT‐PCR. B, The cell viability was determined by CCK‐8 assay. C, The activity of lactate dehydrogenase (LDH) and the concentration of malondialdehyde (MDA) were measured by commercially available kits. D, Cell apoptosis was analyzed by terminal‐deoxynucleoitidyl transferase mediated nick end labeling (TUNEL) apoptosis assay. **P < .01

3.3. SIRT6 was a direct target of miR‐370

To further investigate the potential mechanisms of miR‐370 on the OGD/R‐induced SH‐SY5Y cell injury, its potential target was analyzed by TargetScan prediction website (http://www.targetscan.org/vert_72/). As the results indicated, the 3′‐UTR of SIRT6 mRNA was predicted to contain the complementary sequence of miR‐370 (Figure 3A). First, the miR‐370 mimic or miR‐NC was transfected into HEK293 cells. MiR‐370 mimic significantly increased the miR‐370 level in HEK293 cells (Figure 3B). Then the interaction between miR‐370 and 3′‐UTR of SIRT6 mRNA was evaluated by luciferase assay. As shown in Figure 3C, miR‐370 significantly suppressed the SIRT6‐WT luciferase activities in HKE293 cells but had no significant impact on the SIRT6‐MUT luciferase activities. After that, the SIRT6 mRNA was inhibited by OGD/R treatment but promoted by miR‐370 inhibitor in SH‐SY5Y cells (Figure 3D). Similarly, the protein expression of SIRT6 was decreased by OGD/R treatment but increased by miR‐370 inhibitor in SH‐SY5Y cells (Figure 3E). Thus, SIRT6 was a direct target of miR‐370 and participated in OGD/R‐induced injury.

FIGURE 3.

FIGURE 3

Silencing information regulatory protein 6 (SIRT6) was a direct target of microRNA (miR‐370). A, The binding site of miR‐370 and 3′‐UTR of SIRT6 mRNA. B, The transfection efficiency of miR‐370 over‐expression in HEK293 cells. C, The interaction of miR‐370 and 3′‐UTR of SIRT6 mRNA was determined by luciferase activity assay in HEK293 cells. D, The mRNA level of SIRT6 was detected in SH‐SY5Y cells by qRT‐PCR. E, The protein level of SIRT6 was detected in SH‐SY5Y cells by western blot. **P < .01

3.4. MiR‐370 regulated Nrf2/ARE signal pathway via SIRT6

SIRT6 is a direct target of miR‐370, though, the regulation mechanism of how miR‐370 regulates SIRT6 expression and affects downstream signal pathway, and then participates in OGD/R‐induced SH‐SY5Y cell injury is still unknown. To solve this problem, the SIRT6 overexpression vector was transfected into SH‐SY5Y cells with miR‐370 mimic. From Figure 4A, SIRT6 was significantly over‐expressed in SH‐SY5Y cells compared with Vector. Then, the western blot assay indicated that OGD/R treatment inhibited the expression of SIRT6, but promoted the expression of Nrf2, HO‐1, and NQO1. Moreover, the miR‐370 mimic could further aggravate the inhibition of OGD/R treatment, inhibited the expression of SIRT6 and promoted the expression of Nrf2, HO‐1, and NQO1, indicating that miR‐370 could regulate Nrf2/ARE signal pathway (Figure 4B). However, the activation of NrF2 not only depended on SIRT6 but also related to the miR‐370 mimic. When miR‐370 mimics damaged cells and induced oxidative stress, the NrF2 signal pathway was further activated. Thus, we could conclude that miR‐370 regulated Nrf2/ARE signal pathway via SIRT6.

FIGURE 4.

FIGURE 4

MiroRNA‐370 (MiR‐370) regulated Nrf2/ARE signal pathway via silencing information regulatory protein 6 (SIRT6). A, The mRNA level of SIRT6 was detected by qRT‐PCR. B, The expression levels of SIRT6, Nrf2, HO‐1, and NQO1 were determined by western blot. **P < .01

3.5. Overexpression of SIRT6 partly reversed the effect of miR‐370 on OGD/R‐induced SH‐SY5Y cell injury

To clarify the effect of miR‐370 on OGD/R‐induced SH‐SY5Y cell injury, rescue experiments were performed. As shown in Figure 5A, compared to vector, the overexpression of SIRT6 could partly alleviate the induction of cell viability caused by miR‐370 mimics in OGD/R treated SH‐SY5Y cells. Moreover, the activity of LDH and the concentration of MDA were promoted by miR‐370 mimic, and then inhibited by co‐transfected with miR‐370 mimic and SIRT6 over‐expression vector (Figure 5B). Additionally, the expression of apoptosis‐related proteins, Cleaved caspase‐3 and Cleaved PARP, were determined by western blot. As shown in Figure 5C, miR‐370 induced the expression of Cleaved caspase‐3 and Cleaved PARP, whereas these changes were reversed by over‐expression of SIRT6. Thus, these findings indicated that overexpression of SIRT6 partly reversed the effect of miR‐370 on OGD/R‐induced SH‐SY5Y cell injury.

FIGURE 5.

FIGURE 5

Overexpression of silencing information regulatory protein 6 (SIRT6) partially reversed the effect of miR‐370 on oxygen‐glucose deprivation/reoxygenation (OGD/R)‐induced SH‐SY5Y cell injury. A, The cell viability was detected by CCK‐8 assay in SH‐SY5Y cells. B, The activity of lactate dehydrogenase (LDH) and the concentration of malondialdehyde (MDA) in SH‐SY5Y cells were measured by commercial kit. C, The expression of Cleaved caspase‐3 and Cleaved PARP were determined by western blot. **P < .01

4. DISCUSSION

In recent years, miRNAs have attracted more attention as vital regulators in response to CIR injury. In this study, the miR‐370 was upregulated in brain tissues of MCAO rats and knockdown of miR‐370 decreased cerebral infarction volume of MCAO rats and it alleviated CIR injury in vivo. The in vitro experiments indicated that knockdown of miR‐370 promoted cell proliferation and alleviated OGD/R‐induced SH‐SY5Y cell apoptosis. Additionally, the TargetScan predicted that SIRT6 was the target of miR‐370. Moreover, miR‐370 inhibited SIRT6 expression and regulated Nrf2/ARE signal pathway, whereas overexpression of SIRT6 partly reversed the effect of miR‐370 on OGD/R‐induced SH‐SY5Y cell injury. Thus, we could conclude that miR‐370 accelerated CIR injury via targeting SIRT6 and regulating Nrf2/ARE signal pathway.

Accumulating evidences have proved that miR‐370 was a novel miRNA and involved in multiple diseases. It has been reported that miR‐370 inhibits apoptosis and oxidative stress by targeting FOXO1 in cardiac myocytes. 17 Xian et al have demonstrated that miR‐370 induces high glucose‐induced podocyte injuries. 18 A recent study has pointed that miR‐370 inhibits oxidative stress and vascular inflammation via targeting TLR4. 19 In current study, we found that the expression of miR‐370 was upregulated in brain tissues of MCAO rats. As a previous study shown, miR‐370‐3p was significantly downregulated in hippocampal pyramidal cells of chronic unpredictable mild stressed (CUMS) rats. 20 The main reason that causes the different results might due to the tissue specificity. However, the effects of miR‐370 on CIR injury remain unclear and need more investigation.

After established an OGD/R‐induced SH‐SY5Y cell model, we have proved that knockdown of miR‐370 promoted cell proliferation, increased the activity of LDH and the concentration of MDA, and inhibited cell apoptosis, suggesting that miR‐370 alleviated OGD/R‐induced SH‐SY5Y cell injury. In gastric cancer, overexpression of miR‐370 suppressed the proliferation of gastric cancer cells, while downregulation of miR‐370 promoted cell proliferation, 21 which was consistent with our findings. Nevertheless, miR‐370 was confirmed to decrease the MDA concentration in THP‐1 cells. 19 The main reason for the different phenomenon might be the various functions of miRNA in different cell lines.

Previous studies have demonstrated that miR‐370 targets FOXO1, BEX2, or WNK2 and regulates the pathogenesis of cardiac myocytes, hepatocellular carcinoma cells, or breast cancer cells and.17, 22, 23 In current study, the luciferase activity analysis confirmed that miR‐370 could bind to 3′‐UTR of SIRT6 mRNA. Besides, the western blot assay proved that miR‐370 mimic, inhibited the expression of SIRT6 and regulated Nrf2/ARE signal pathway, resulting in aggravating the inhibition of OGD/R treatment in SH‐SY5Y cells. Otherwise, compared to the Figure 1D, the results seemed to be opposite in cells. For this problem, we speculated that while antagomir miR‐370 could inhibit the production of miR‐370 but promote the expression of SIRT6, the Nrf2/ARE signal pathway preferred to be modulated by SITR6 rather than miR‐370. In general, it is the first evidence demonstrating that miR‐370 inhibited the expression of SIRT6 and regulated Nrf2/ARE signal pathway.

The activation of Nrf2/ARE signal pathway is a self‐defensible and protective mechanism in cells. SIRT6 has been served as a positive regulator of Nrf2/ARE signal pathway, and it enhanced the Nrf2/ARE signal pathway under oxidative stress. 24 Given that oxidative stress induced cell apoptosis, we found that overexpression of SIRT6 partly reversed miR‐370‐induced cell apoptosis, which thus accelerated OGD/R‐inducedSH‐SY5Y cell injury. Furthermore, consistent with our findings, Zhang et al. have pointed out that SIRT6 attenuates CIR injury‐induced apoptosis by activating Nrf2 signal pathway and deacetylating Nrf2. 16 Thus, we suspected that whether miR‐370 inhibited the expression of SIRT6 and regulated Nrf2/ARE signal pathway via suppressing the deacetylation of Nrf2. On the other hand, knockout of SIRT6 promotes hepatic steatosis and inflammation, which is associated with increased Bach1 expression and regulates Nrf2 signal pathway. 25 Furthermore, overexpression of Bach1 reverses the SIRT6‐mediated effects on Nrf2/ARE signal pathway in retinal ganglion cells, indicating that SIRT6 activates Nrf2/ARE signal pathway via inhibiting Bach1 expression. 25 Based on these researches, we suspected that whether miR‐370 inhibited the expression of SIRT6 and then regulated SIRT6/Bach1/Nrf2/ARE signaling pathway. Anyway, these hypotheses might need more investigation in the future analysis.

In conclusion, our findings demonstrated that miR‐370 accelerated CIR injury via targeting SIRT6 and down‐regulating Nrf2/ARE signal pathway. Our study also indicates that miR‐370 acts as a crucial regulator for CIR injury. More importantly, miR‐370 might provide a novel potential therapeutic target for CIR injury in the future.

CONFLICT OF INTEREST

The authors state that there are no conflicts of interest to disclose.

Ruan Z‐F, Xie M, Gui S‐J, Lan F, Wan J, Li Y. MiR‐370 accelerated cerebral ischemia reperfusion injury via targeting SIRT6 and regulating Nrf2/ARE signal pathway. Kaohsiung J Med Sci. 2020;36:741–749. 10.1002/kjm2.12219

REFERENCES

  • 1. Zhao JJ, Xiao H, Zhao WB, Zhang XP, Xiang Y, Ye ZJ, et al. Remote ischemic postconditioning for ischemic stroke: A systematic review and meta‐analysis of randomized controlled trials. Chin Med J (Engl). 2018;131(8):956–965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Hu YQ, Chen W, Yan MH, Lai JJ, Tang N, Wu L. Ischemic preconditioning protects brain from ischemia/reperfusion injury by attenuating endoplasmic reticulum stress‐induced apoptosis through PERK pathway. Eur Rev Med Pharmacol Sci. 2017;21(24):5736–5744. [DOI] [PubMed] [Google Scholar]
  • 3. Wu MY, Yiang GT, Liao WT, Tsai AP, Cheng YL, Cheng PW, et al. Current mechanistic concepts in ischemia and reperfusion injury. Cell Physiol Biochem. 2018;46(4):1650–1667. [DOI] [PubMed] [Google Scholar]
  • 4. He L, He R, Liang R, Li Y, Li X, Li C, et al. Protein expression profiling in the hippocampus after focal cerebral ischemia injury in rats. J Integr Neurosci. 2018;17(2):149–158. [DOI] [PubMed] [Google Scholar]
  • 5. Bhat SS, Jarmolowski A, Szweykowska‐Kulinska Z. MicroRNA biogenesis: Epigenetic modifications as another layer of complexity in the microRNA expression regulation. Acta Biochim Pol. 2016;63(4):717–723. [DOI] [PubMed] [Google Scholar]
  • 6. Bhalala OG, Srikanth M, Kessler JA. The emerging roles of microRNAs in CNS injuries. Nat Rev Neurol. 2013;9(6):328–339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Singh A, Sen D. MicroRNAs in Parkinson's disease. Exp Brain Res. 2017;235(8):2359–2374. [DOI] [PubMed] [Google Scholar]
  • 8. Volny O, Kasickova L, Coufalova D, Cimflova P, Novak J. microRNAs in cerebrovascular disease. Adv Exp Med Biol. 2015;888:155–195. [DOI] [PubMed] [Google Scholar]
  • 9. Ma Q, Zhao H, Tao Z, Wang R, Liu P, Han Z, et al. MicroRNA‐181c exacerbates brain injury in acute ischemic stroke. Aging Dis. 2016;7(6):705–714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Zhu J, Zhu F, Song W, Zhang B, Zhang X, Jin X, et al. Altered miR‐370 expression in hepatic ischemia‐reperfusion injury correlates with the level of nuclear kappa B (NF‐kappaB) related factors. Gene. 2017;607:23–30. [DOI] [PubMed] [Google Scholar]
  • 11. Li L, Li G, Yu C, Shen Z, Xu C, Feng Z, et al. A role of microRNA‐370 in hepatic ischaemia‐reperfusion injury by targeting transforming growth factor‐beta receptor II. Liver Int. 2015;35(4):1124–1132. [DOI] [PubMed] [Google Scholar]
  • 12. Zare MA, Zare A, Azarpira N, Pakbaz S. The protective effect of bone marrow‐derived mesenchymal stem cells in liver ischemia/reperfusion injury via down‐regulation of miR‐370. Iran J Basic Med Sci. 2019;22(6):683–689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Zhao YB, Zhao J, Zhang LJ, Shan RG, Sun ZZ, Wang K, et al. MicroRNA‐370 protects against myocardial ischemia/reperfusion injury in mice following sevoflurane anesthetic preconditioning through PLIN5‐dependent PPAR signaling pathway. Biomed Pharmacother. 2019;113:108697. [DOI] [PubMed] [Google Scholar]
  • 14. Yang Y, Zhi F, He X, Moore ML, Kang X, Chao D, et al. Delta‐opioid receptor activation and microRNA expression of the rat cortex in hypoxia. PLoS one. 2012;7(12):e51524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Evert BO, Nalavade R, Jungverdorben J, Matthes F, Weber S, Rajput A, et al. Upregulation of miR‐370 and miR‐543 is associated with reduced expression of heat shock protein 40 in spinocerebellar ataxia type 3. PLoS one. 2018;13(8):e0201794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Zhang W, Wei R, Zhang L, Tan Y, Qian C. Sirtuin 6 protects the brain from cerebral ischemia/reperfusion injury through NRF2 activation. Neuroscience. 2017;366:95–104. [DOI] [PubMed] [Google Scholar]
  • 17. Qiu Z, Wang L, Mao H, Xu F, Sun B, Lian X, et al. miR‐370 inhibits the oxidative stress and apoptosis of cardiac myocytes induced by hydrogen peroxide by targeting FOXO1. Exp Ther Med. 2019;18(4):3025–3031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Xian Y, Dong L, Jia Y, Lin Y, Jiao W, Wang Y. miR‐370 promotes high glucose‐induced podocyte injuries by inhibiting angiotensin II type 1 receptor‐associated protein. Cell Biol Int. 2018;42(11):1545–1555. [DOI] [PubMed] [Google Scholar]
  • 19. Tian D, Sha Y, Lu JM, Du XJ. MiR‐370 inhibits vascular inflammation and oxidative stress triggered by oxidized low‐density lipoprotein through targeting TLR4. J Cell Biochem. 2018;119(7):6231–6237. [DOI] [PubMed] [Google Scholar]
  • 20. Zhou M, Wang M, Wang X, Liu K, Wan Y, Li M, et al. Abnormal expression of MicroRNAs induced by chronic unpredictable mild stress in rat hippocampal tissues. Mol Neurobiol. 2018;55(2):917–935. [DOI] [PubMed] [Google Scholar]
  • 21. Ning T, Zhang H, Wang X, Li S, Zhang L, Deng T, et al. miR‐370 regulates cell proliferation and migration by targeting EGFR in gastric cancer. Oncol Rep. 2017;38(1):384–392. [DOI] [PubMed] [Google Scholar]
  • 22. Wang X, Zhu W, Xu C, Wang F, Zhu X, Sun Y, et al. MicroRNA‐370 functions as a tumor suppressor in hepatocellular carcinoma via inhibition of the MAPK/JNK signaling pathway by targeting BEX2. J Hum Genet. 2019;64:1203–1217. [DOI] [PubMed] [Google Scholar]
  • 23. Huang L, Liu X. microRNA‐370 promotes cell growth by targeting WNK2 in breast cancer. DNA Cell Biol. 2019;38(6):501–509. [DOI] [PubMed] [Google Scholar]
  • 24. Yang Y, Tian T, Wang Y, Li Z, Xing K, Tian G. SIRT6 protects vascular endothelial cells from angiotensin II‐induced apoptosis and oxidative stress by promoting the activation of Nrf2/ARE signaling. Eur J Pharmacol. 2019;859:172516. [DOI] [PubMed] [Google Scholar]
  • 25. Yu J, Sun W, Song Y, Liu J, Xue F, Gong K, et al. SIRT6 protects retinal ganglion cells against hydrogen peroxide‐induced apoptosis and oxidative stress by promoting Nrf2/ARE signaling via inhibition of Bach1. Chem Biol Interact. 2019;300:151–158. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES