Skip to main content
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2021 May 17;37(9):768–775. doi: 10.1002/kjm2.12393

Long non‐coding RNA‐H19 promotes ovarian cancer cell proliferation and migration via the microRNA‐140/Wnt1 axis

Ye Wang 1, Wei‐Jiao Gao 2,✉
PMCID: PMC11896232  PMID: 34002485

Abstract

To explore the effect and underlying molecular mechanism of long non‐coding RNA (lncRNA)‐H19 on ovarian cancer (OC) cells, a total of 41 cases of OC and adjacent normal tissues were collected. H19 and microRNA (miR)‐140 expressions in OC tissues and cells were detected using quantitative real‐time polymerase chain reaction (qRT‐RCR). The correlation between H19 expression and prognosis of OC patient was analyzed. siRNA (si)‐H19 and si‐negative control (NC) were transfected into OC cells. Cell proliferation was checked by cell counting kit‐8 assay and colony formation assay, and cell migration and invasion were analyzed via Transwell assay. The targeted binding relationship between H19 and miR‐140 was predicted and verified, miR‐140 downstream gene was predicted and Wnt1 was screened out. The impact of in‐miR‐140 on the si‐H19‐induced decreased OC cell proliferation and migration was evaluated. H19 expression was upregulated in OC tissues and cells, and its overexpression was associated with a poor prognosis of OC. si‐H19 remarkably reduced OC cell proliferation and migration. H19 upregulated Wnt1 expression through targeting miR‐140 in OC cells. Altogether, miR‐140 was notably downregulated in OC, and in‐miR‐140 partially inhibited the si‐H19‐induced decrease of OC cell proliferation and migration. H19 competitively bound to miR‐140 to upregulate Wnt1, thereby promoting OC cell proliferation and migration.

Keywords: long non‐coding RNA‐H19, microRNA‐140, ovarian cancer, proliferation, Wnt1


Abbreviations

MKP‐4

mitogen activated protein kinase phosphatase‐4

MAP

mitogen activated protein

MKPs

MAP phosphatases

DUSPs

dual‐specificity phosphatases

DUSP9

dual specificity phosphatase‐9

DUSP

dual‐specificity phosphatase

MKKK

MAPK kinase kinase

MKK

MAPK kinase

ERK1/2

extracellular signal regulated kinase

JNK‐1/2/3

c‐jun N‐terminal kinase

TXT

T for threonine, Y for tyrosine and X for any amino acid

MKB

MAP kinase binding motif

KIM

kinase interacting motif

NT

N‐terminal

PKA

protein kinase

NAFL

non‐alcoholic fatty liver

NASH

non‐alcoholic steatohepatitis

NAFLD

non‐alcoholic fatty liver disease

BMP

bone morphogenetic protein

RAR

retinoic acid receptor

TNBC

triple negative breast cancer

HIF‐1

hypoxia inducible factor‐1

1. INTRODUCTION

Globally, ovarian cancer (OC) is the seventh leading cancer in women and the eighth common cause of cancer death, with a five‐year survival rate of less than 45%. 1 In recent years, with the rapid development of surgical and chemotherapeutic approaches, the age standardization rate is stable or declining in several developed countries, while it is increasing in many developing countries; besides, as life expectancy increases, the number of diagnosed cases is elevated annually as well. 2 Therefore, further study is urgently needed to explore the mechanism and potential therapeutic targets of OC.

Long non‐coding RNAs (lncRNAs) are non‐coding RNAs with a length of more than 200 nt. LncRNAs can interact with different types of RNA, such as microRNAs (miRs), and involve in the cell proliferation and migration. The specific mechanism of lncRNA may vary a lot under different conditions of OC. Emerging evidence shows that the interaction between lncRNA and miR plays an important role. 3 , 4 LncRNA taurine upregulated 1 (TUG1), 5 pro‐transition associated RNA (PTAR), 6 maternally expressed gene 3 (MEG3) 7 have been confirmed to be closely participated in the occurrence and development of OC. LncRNA H19 is located on human chromosome 11. As reported previously, H19 is abnormally overexpressed in OC tissues, and closely related to the recurrence of OC. 8 In addition, H19 promotes the transforming growth factor‐β‐induced epithelial‐mesenchymal transition (EMT) by acting as a competitive endogenous RNA for miR‐370‐3p in OC cells. 9 Nevertheless, how lncRNA regulates miR that binds to mRNA 3'UTR to regulate gene expression post‐transcriptionally has not yet been clearly demonstrated.

We predicted the targeted binding relationship between H19 and multiple miRs through the biology website (http://starbase.sysu.edu.cn/?tdsourcetag=s_pcqq_aiomsg). Then miR‐140 with differential expression in tumors was screened out through the website (http://www.oncomir.org/cgi-bin/dbSearch.cgi). We found that miR‐140 shows involvement in the development and procession of diverse cancers, such as liver cancer, cervical cancer, and colorectal cancer. 10 , 11 , 12 Previous work has proposed that miR‐140 took part in OC initiation and progression, and lncRNA plasmacytoma variant translocation 1 promotes OC proliferation through the binding with miR‐140. 13 However, both the interplay between H19 and miR‐140 in OC cell regulation, and the molecular target downstream of miR‐140 remain elusive. In this study, we aimed to investigate the effect of H19 targeting miR‐140 on the proliferation and migration of OC cells.

2. MATERIALS AND METHODS

2.1. Ethical statement

This study got approval from the Ethics Committee of our hospital (IRB number: IRB00001052‐13042). All subjects have signed the written informed consent.

2.2. Specimen collection

Tumor tissues and adjacent normal tissues (more than 2 cm from the tumor edge) from 41 cases (average age 58.2 ± 6.1 years) of OC patients were collected from January 2013 to January 2014. Five cases were at Stage I, 25 cases at Stage II, and 11 cases at Stage III. All patients did not receive chemotherapy before surgery, and fresh specimens (tumor tissues and adjacent normal tissues) were quickly cryopreserved with liquid nitrogen.

2.3. Cell culture

Normal ovarian cells (IOSE80) and OC cell lines (OVCAR3, A2780, HO‐8910 and SKOV3) (American Type Culture Collection, Manassas, Virginia, USA) were cultured in RPMI‐1640 medium contained with 10% fetal bovine serum (Life Technologies, Gaithersburg, MD, USA) in a 37°C incubator with 5% CO2. When reaching the logarithmic growth phase, the cells were co‐transfected with small‐interfering (si)‐H19/si‐negative control (NC) and in‐miR‐140/in‐NC (GenePharma Inc., Shanghai, China) for 6 h using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After further culture for 48 h, subsequent experiments were performed.

2.4. Cell counting kit‐8 assay

Cells (1 × 105 cells/well) in each group were seeded into 96‐well plates, and added with 200 μl cell counting kit‐8 (CCK‐8) solution (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) at 0/24/48/72 h for a 4 h‐culture. Next, 100 μl dimethyl sulfoxide (Solarbio) was added into each well for a 10 min‐shaking. Finally, the optical density (OD) at 570 nm of each well was measured.

2.5. Colony formation assay

After the detachment, HO‐8910 and SKOV3 cells were cultured overnight in a 35 mm culture dish, and then 1000 cells were counted. After 48 h, the cells in each group were treated accordingly, and then cultured in the dish for 2 weeks to form the cell colonies. Afterward, the cells were fixed in 4% paraformaldehyde and stained with 0.1% crystal violet solution (Sigma–Aldrich Co., St Louis, Mo, USA). Colonies larger than 0.5 mm in diameter were counted under a microscope (Olympus Optical Co., Ltd., Tokyo, Japan).

2.6. Transwell assay

HO‐8910 and SKOV3 cells in the logarithmic growth phase were detached into cell suspension, and cell density was adjusted to 2 × 105. Cell suspension (100–200 μl) was added into Transwell apical chamber and 10% medium (600–800 μl) was added into the basolateral chamber for a 24 h further culture. Next, the cells were fixed in 4% paraformaldehyde, stained with 0.1% crystal violet solution (Sigma–Aldrich) and analyzed.

2.7. Quantitative real‐time polymerase chain reaction

Total RNA was extracted from OC tissues and cells using TRIzol (Invitrogen). The concentration and purity of RNA were detected using an ultra‐micro spectrophotometer (Shanghai Puyuan Instrument Co., Ltd., Shanghai, China). RNA (1 μg) was reversely transcribed into cDNA using a reverse transcription kit (Thermo Fisher Scientific, Rockford, IL, USA). LncRNA‐H19, miR‐140, Wnt1, U6, and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) primers were designed and synthesized by Takara (Takara Bio Inc., Kyoto, Japan) (Table 1). Fluorescence quantitative PCR (ABIPRISM®7300 system) was performed using the SYBR® Premix Ex Taq™ II solution kit according to the instructions of the kit. Data were evaluated using the 2ΔΔCt method. 14

TABLE 1.

Primer sequence for qRT‐PCR

Primer Sequence
lncRNA‐H19 Forward primer: 5′‐ATCGGTGCCTCAGCGTTCGG‐3′
Reverse primer: 5′‐CTGTCCTCGCCGTCACACCG‐3′
miR‐140 Forward primer: 5′‐GGGCTACCACAGGGTAGAA‐3′
Reverse primer: 5′‐GTGCAGGGTCCGAGGT‐3′
Wnt1 Forward primer: 5′‐TGGCTGGGTTTCTGCTACG‐3’
Reverse primer: 5′‐CCCGGATTTTGGCGTATC‐3’
U6 Forward primer: 5′‐CTCGCTTCGGCAGCACA‐3’
Reverse primer: 5′‐AACGCTTCACGAATTTGCGT‐3’
GAPDH Forward primer: 5′‐GCACCGTCAAGGCTGAGAAC‐3’
Reverse primer: 5′‐ATGGTGGTGAAGACGCCAGT‐3’

Abbreviations: GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; lncRNA, long non‐coding RNA; miR, microRNA; qRT‐PCR, quantitative real‐time polymerase chain reaction.

2.8. Western blot analysis

Total protein of HO‐8910 and SKOV3 was extracted using a protein extraction kit (p1250, Beijing Pulilai Gene Technology Co., Ltd., Beijing, China). The protein concentration of the samples was determined by the Bradford method with bovine serum albumin as the standard. Protein (30 μg) was subjected to sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE, 10% [wt/vol]) and then imprinted onto polyvinylidene fluoride membranes. Next, the membranes were blocked with blocking fluid for 1 h, and incubated with primary antibodies anti‐Wnt1 (ab96730, Abcam Inc., Cambridge, MA USA) and anti‐GAPDH (ATA296666, ZSGB‐Bio Co., Ltd., Beijing, China), followed by the incubation with horseradish peroxidase‐labeled anti‐rabbit or anti‐mouse secondary antibody (ZSGB‐Bio). After rinsing, the proteins were detected by enhanced chemiluminescence (Merck Millipore). The protein levels were quantified by densitometry and normalized to the corresponding GAPDH level.

2.9. Bioinformatics prediction and dual‐luciferase reporter gene assay

Through Starbase v2.0 (http://starbase.sysu.edu.cn/index.php), the binding sites of H19/miR‐140 and miR‐140/Wnt1 were predicted. The predicted binding sequence of miR‐140 on lncRNA‐H19 and mutation sequence were synthesized and cloned into the downstream of pmirGLO promoter vector (Promega, Madison, WI, USA) luciferase gene. The wild‐type reporter plasmid of Wnt1 3'UTR (Wnt1‐WT) and mutant plasmid (Wnt1‐MT) were constructed using Pmirglo promoter vectors. WT or MT pmirGLO reporter plasmid was co‐transfected, and miR‐140 mimic or NC mimic into HEK293T cells (Shanghai Institute of Cellular Biology of Chinese Academy of Sciences, Shanghai, China). The luciferase activity was detected 48 h after transfection.

2.10. Statistical analysis

All data were analyzed using the SPSS 21.0 statistical software (IBM Corp., Armonk, NY, USA). Data were verified in the normal distribution by Kolmogorov–Smirnov test. Data were expressed as mean ± standard deviation. The comparison between the two groups was analyzed by t‐test. Comparisons among multiple groups were analyzed using one‐way or two‐way analysis of variance (ANOVA), followed by Tukey's multiple comparisons test. The Kaplan–Meier method was used for survival analysis. P‐value was obtained from a two‐tailed test, and p < 0.05 meant a statistically significant difference.

3. RESULTS

3.1. LncRNA‐H19 was upregulated in OC tissues and cells

lncRNA‐H19 overexpression in OC indicates a poor prognosis. 15 However, how H19 regulates the occurrence and development of OC has not been reported. In the present study, a total of 41 pairs of tumor tissues and adjacent normal tissues were obtained from OC patients (mean age 55.3 ± 6.2 years). H19 expression was detected using quantitative real‐time polymerase chain reaction (qRT‐PCR). We found that H19 was significantly upregulated in tumor tissues (p < 0.05) (Figure 1(A)). Next, 41 cases were divided into high expression group (n = 21) and low expression group (n = 20) according to the median value of H19 expression. As shown by Kaplan–Meier analysis results, H19 high expression was associated with poor prognosis of OC patients (Figure 1(B)). Moreover, compared with normal ovarian cells (IOSE80), H19 overexpression was elevated in all OC cell lines (OVCAR3, A2780, HO‐8910 and SKOV3) (p < 0.05). Among them, HO‐8910 and SKOV3 cell lines have higher H19 expression levels comparing to other types of cells (Figure 1(C)).

FIGURE 1.

FIGURE 1

Long non‐coding RNA (LncRNA)‐H19 is upregulated in ovarian cancer (OC) tissues and cells. (A). LncRNA‐H19 expression in tumor tissues and adjacent normal tissues was detected using quantitative real‐time polymerase chain reaction (qRT‐PCR). ** compared with the adjacent group, p < 0.01; (B). The correlation between H19 expression and survival in OC patients with high H19 expression (≥ median; n = 21) or low H19 expression (< median; n = 20) was analyzed using Kaplan–Meier analysis; (C). H19 expression in IOSE80, OVCAR3, A2780, HO‐8910 and SKOV3 cell lines was detected using qRT‐PCR. Data were represented as the mean ± standard deviation of three independent experiments. Compared with IOSE80, *p < 0.05; **p < 0.01

3.2. si‐H19 inhibited OC cell proliferation and migration

The above results confirmed that H19 was highly expressed in OC. To further explore the impact of H19 on OC occurrence and development, we transfected SKOV3 and HO‐8910 cells with si‐H19 and the control si‐NC. H19 expression was firstly detected using qRT‐PCR. We observed that H19 expression was dramatically decreased in the si‐H19 group (p < 0.05) (Figure 2(A)). CCK‐8 and colony formation assay were used to evaluate the si‐H19 effect on cell proliferation. The data showed that si‐H19 effectively inhibited OC cell proliferation and colony formation comparing to si‐NC (p < 0.05) (Figure 2(B, C)). Cell migration and invasion were measured using Transwell assay. We observed that si‐H19 obviously inhibited OC cell migration (p < 0.05) (Figure 2(D, E)).

FIGURE 2.

FIGURE 2

Si‐H19 inhibits ovarian cancer (OC) cell proliferation and migration. SKOV3 and HO‐8910 cells were transfected with si‐H19. (A). The expression of H19 was detected using quantitative real‐time polymerase chain reaction (qRT‐PCR); (B). Optical density (OD) value (at 570 nm) was detected at 0, 24, 48, and 72 h, respectively; (C). Colony number count; (D). Detection of cell migration; (E). Detection of cell invasion

3.3. H19 targeted miR‐140 expression to upregulate Wnt1 expression

We proved that the downregulation of H19 inhibited OC cell malignant biological behaviors. However, the downstream molecular target of H19 downstream remains elusive. Through the biology website (http://starbase.sysu.edu.cn/?tdsourcetag=s_pcqq_aiomsg), we predicted that H19 had a targeted binding relationship with multiple miRs. Next, miR‐140 with differential expression in tumors was screened out through the website (http://www.oncomir.org/cgi-bin/dbSearch.cgi). Therefore, we speculated that H19 may regulate OC cell proliferation and migration via competitively binding to miR‐140. Furthermore, multiple target genes downstream of miR‐140 were predicted, including Wnt1 (Figure 3(A)). The targeted binding relationship between H19 and miR‐140, and between miR‐140 and Wnt1 were firstly verified using a dual‐luciferase reporter gene assay (Figure 3(B, C)). The expression of miR‐140 and Wnt1 in SKOV3 and HO‐8910 cells after H19 knockdown was detected using qRT‐PCR. It was found that the miR‐140 was notably upregulated and Wnt1 mRNA expression was downregulated after silencing H19 (Figure 3(D, E)). Also, as shown by Western blot (WB) results, Wnt1 protein level was dramatically reduced after H19 knockdown (Figure 3(F)).

FIGURE 3.

FIGURE 3

H19 targets microRNA (miR)‐140 expression to upregulate Wnt1 expression. (A). The targeted binding relationship between H19 and miR‐140, and between miR‐140 and Wnt1 were predicted through online websites; (B). SKOV3 cells were co‐transfected with H19‐WT/MT and miR‐140, and the luciferase activity was detected; (C). SKOV3 cells were co‐transfected with miR‐140 and Wnt1‐WT/MT, and the luciferase activity was detected. (D–F) si‐H19 was transfected into SKOV3 and HO‐8910 cells, and the expression of miR‐140 and Wnt1 was detected using quantitative real‐time polymerase chain reaction (qRT‐PCR) and Western blot (WB). Data were represented as the mean ± standard deviation of three independent experiments. Compared with NC, *p < 0.05

3.4. miR‐140 depletion partially inhibited the proliferation and migration in si‐H19‐transfected OC cells

To clarify the role of miR‐140 in OC, we firstly detected miR‐140 expression in OC tissues and adjacent normal tissues. As shown by qRT‐PCR results, miR‐140 expression was significantly decreased in OC tissues (Figure 4(A)). To further explore the important role of miR‐140 in OC occurrence and development, we transfected in‐miR‐140 into SKOV3 cells. The results showed that miR‐140 inhibition could suppress the cell proliferation and migration in si‐H19‐transfected SKOV3 cells. We found that the si‐H19+in‐miR‐140 group showed increased CCK‐8 activity and colony numbers (Figure 4(B, C)), and elevated cell migration (Figure 4(D, E)), comparing to the si‐H19 group. These results suggested that miR‐140 depletion partially inhibited the proliferation and migration in si‐H19‐transfected OC cells.

FIGURE 4.

FIGURE 4

MicroRNA (miR)‐140 depletion partially inhibited the si‐H19‐induced decrease of ovarian cancer (OC) cell proliferation and migration. (A). miR‐140 expression in OC tissues and adjacent normal tissues was detected using quantitative real‐time polymerase chain reaction (qRT‐PCR). SKOV3 cells were transfected with si‐H19 and/or in‐miR‐140; (B, C). Cell counting kit‐8 (CCK‐8) assay and colony formation assay were used to detect SKOV3 cell proliferation; (D, E). Transwell assay was used to detect the migration and invasion of SKOV3 cells. Data were represented as the mean ± standard deviation of three independent experiments. Compared with the si‐NC group, *p < 0.05; compared with the si‐H19 group, #p < 0.05

4. DISCUSSION

At present, the screening methods for OC are limited. A large number of patients are not diagnosed until lymph node metastasis or distant metastasis occurs, which apparently affects the prognosis of OC. Therefore, it is urgent to find novel biomarkers for early diagnosis of OC and reveal the new molecular mechanism of OC. 16 LncRNA can affect tumor cell proliferation and migration via regulating miR and related genes. Besides, tissue specificity makes the diagnostic sensitivity of lncRNA higher than that of mRNA biomarkers. 17 Therefore, lncRNAs may be used as biomarkers of OC early diagnosis. Up to now, lncRNA H19, TUG1, 5 PTAR, 6 and MEG3 7 have been widely recognized to promote OC initiation and progression. Among these, H19 is located on chromosome 11p15.5 and expressed exclusively from the maternal allele, encoding a 2.3 kb IncRNA. It is reported that H19 plays a critical role in all stages of tumorigenesis, highlighting the carcinogenic effects of H19 in a variety of cancers, such as gastric, hepatocellular, and pancreatic carcinoma. 18 , 19 , 20 Most studies have indicated that H19 is associated with growth, migration, invasion, and/or metastasis in many cancers, and serum H19 levels in patients with certain cancers have been suggested to be useful for diagnosis and prognosis. 21 Similarly, we found that H19 expression was upregulated in OC tissues and cells, and H19 overexpression was associated with poor prognosis of OC patients in this study. Gene knockout technology was used for further study. As shown by our results, si‐H19 significantly reduced OC cell proliferation, colony formation, and migration. From all the above, H19 overexpression promoted the occurrence and progression of OC.

Previous studies have proved that lncRNA can regulate the proliferation and migration of OC cells via regulating miR. Haihai Liang et al. indicated that lncRNA PTAR promotes EMT and invasion and metastasis of serous OC via competitively binding to miR‐101‐3p to regulate ZEB1 expression. 6 LncRNA LINC00319 promotes OC progression through the miR‐423‐5p/NACC1 axis. 22 LncRNA DANCR aggravates tumor growth and angiogenesis of OC via targeting miR‐145. 23 Interestingly, the relationship between H19 and miR‐140 has been reported as well. 24 It is demonstrated that the H19/miR‐140‐5p regulatory axis could affect the degradation and calcification of the cartilage matrix in OA cell; H19 might regulate the tumor growth and metastasis via miR‐140‐dependent iASPP regulation. 25 In this study, we predicted and verified the targeted binding relationship between H19 and miR‐140 using a dual‐luciferase reporter gene assay. miR‐140 was downregulated in OC, and in‐miR‐140 partially inhibited the si‐H19‐induced decrease of OC cell proliferation and migration. The above results demonstrated that H19 regulates the proliferation and migration of OC cells via targeting miR‐140. Multiple target genes downstream of miR‐140 were further predicted, and we confirmed that Wnt1 was a target gene downstream of miR‐140. It has been reported that Wnt1 is closely involved in tumor progression and plays an oncogenic role in multiple cancers, such as lung cancer, 26 colon cancer, 27 and cervical cancer. 28 Our finding is that si‐H19 leads to the decrease of Wnt1 expression. However, the role of Wnt1 in OC and its downstream pathway are needed to further study.

5. CONCLUSION

H19 competitively bound to miR‐140 to upregulate Wnt1 expression, thus promoting the proliferation and migration of OC cells.

5.1. Limitation

The number of OC patients in this study is relatively small, which may limit the accuracy of the correlation between H19 and OC clinical prognosis. What is more, Wnt1 is not intervened in the experiment, and the role of Wnt1 in OC and its downstream pathway should be further studied.

CONFLICT OF INTEREST

The authors declare that they have no competing interests.

Wang Y, Gao W‐J. Long non‐coding RNA‐H19 promotes ovarian cancer cell proliferation and migration via the microRNA‐140/Wnt1 axis. Kaohsiung J Med Sci. 2021;37:768–775. 10.1002/kjm2.12393

REFERENCES

  • 1. Lheureux S, Gourley C, Vergote I, Oza AM. Epithelial ovarian cancer. Lancet. 2019;393:1240–53. [DOI] [PubMed] [Google Scholar]
  • 2. Webb PM, Jordan X, Susan J. Epidemiology of epithelial ovarian cancer. Best Pract Res Clin Obstet Gynaecol. 2017;41:3–14. [DOI] [PubMed] [Google Scholar]
  • 3. Wu J, Huang H, Huang W, Lei W, Xia X, Fang X. Analysis of exosomal lncRNA, miRNA and mRNA expression profiles and ceRNA network construction in endometriosis. Epigenomics. 2020;12:1193–213. [DOI] [PubMed] [Google Scholar]
  • 4. Sun D, Fan XH. LncRNA SNHG12 accelerates the progression of ovarian cancer via absorbing miRNA‐129 to upregulate SOX4. Eur Rev Med Pharmacol Sci. 2019;23:2345–52. [DOI] [PubMed] [Google Scholar]
  • 5. Liu S, Liu Y, Lu Q, Zhou X, Chen L, Liang W. The lncRNA TUG1 promotes epithelial ovarian cancer cell proliferation and invasion via the WNT/β‐catenin pathway. Onco Targets Ther. 2018;11:6845–6. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 6. Liang H, Yu T, Han Y, Jiang H, Wang C, You T, et al. LncRNA PTAR promotes EMT and invasion‐metastasis in serous ovarian cancer by competitively binding miR‐101‐3p to regulate ZEB1 expression. Mol Cancer. 2018;17(1):119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Wang J, Xu W, He Y, Qi X, Liu S. LncRNA MEG3 impacts proliferation, invasion, and migration of ovarian cancer cells through regulating PTEN. Inflamm Res. 2018;67:927–36. [DOI] [PubMed] [Google Scholar]
  • 8. Yang K, Hou Y, Li A, Li Z, Wang W, Xie H, et al. Identification of a six‐lncRNA signature associated with recurrence of ovarian cancer. Sci Rep. 2017;7:752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Li J, Huang YY, Deng XJ, Luo ML, Wang XF, Hu HY, et al. Long noncoding RNA H19 promotes transforming growth factor‐β‐induced epithelial‐mesenchymal transition by acting as a competing endogenous RNA of miR‐370‐3p in ovarian cancer cells. Onco Targets Ther. 2018;11:427–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Hou ZH, Hou XW, Fu XY, Zhou LD, Liu SP. Long non‐coding RNA MALAT1 promotes angiogenesis and immunosuppressive properties of HCC cells by sponging miR‐140. Am J Physiol Cell Physiol. 2020;318:C649–63. [DOI] [PubMed] [Google Scholar]
  • 11. Ma J, Zhang F, Sun P. miR‐140‐3p impedes the proliferation of human cervical cancer cells by targeting RRM2 to induce cell‐cycle arrest and early apoptosis. Bioorg Med Chem. 2020;28:115283. [DOI] [PubMed] [Google Scholar]
  • 12. Zhao Q, Li JY, Zhang J, Long YX, Li YJ, Guo XD, et al. Role of visfatin in promoting proliferation and invasion of colorectal cancer cells by downregulating SDF‐1/CXCR4‐mediated miR‐140‐3p expression. Eur Rev Med Pharmacol Sci. 2020;24:5367–77. [DOI] [PubMed] [Google Scholar]
  • 13. Ding Y, Fang Q, Li Y, Wang Y. Amplification of lncRNA PVT1 promotes ovarian cancer proliferation by binding to miR‐140. Mamm Genome. 2019;30:217–25. [DOI] [PubMed] [Google Scholar]
  • 14. Zhou N, Sun Z, Li N, Ge Y, Zhou J, Han Q, et al. miR197 promotes the invasion and migration of colorectal cancer by targeting insulinlike growth factorbinding protein 3. Oncol Rep. 2018;40:2710–21. [DOI] [PubMed] [Google Scholar]
  • 15. Peng L, Yuan X, Liu Z, Li W, Zhang C. High lncRNA H19 expression as prognostic indicator: data mining in female cancers and polling analysis in non‐female cancers. Oncotarget. 2017;8:1655–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Tarhriz V, Bandehpour M, Dastmalchi S, Ouladsahebmadarek E, Zarredar H, Shirin E. Overview of CD24 as a new molecular marker in ovarian cancer. J Cell Physiol. 2019;34:2134–42. [DOI] [PubMed] [Google Scholar]
  • 17. Li N, Zhan X. Identification of clinical trait‐related lncRNA and mRNA biomarkers with weighted gene co‐expression network analysis as useful tool for personalized medicine in ovarian cancer. EPMA J. 2019;10:273–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Pan FF, Zheng YB, Shi CJ, Zhang FW, Zhang JF, Fu WM. H19‐Wnt/beta‐catenin regulatory axis mediates the suppressive effects of apigenin on tumor growth in hepatocellular carcinoma. Eur J Pharmacol. 2021;893:173810. [DOI] [PubMed] [Google Scholar]
  • 19. Yu J, Fang C, Zhang Z, Zhang G, Shi L, Qian J, et al. H19 rises in gastric cancer and exerts a tumor‐promoting function via miR‐138/E2F2 axis. Cancer Manag Res. 2020;12:13033–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Wang F, Rong L, Zhang Z, Li M, Ma L, Ma Y, et al. LncRNA H19‐derived miR‐675‐3p promotes epithelial‐mesenchymal transition and stemness in human pancreatic cancer cells by targeting the STAT3 pathway. J Cancer. 2020;11:4771–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Yoshimura H, Matsuda Y, Yamamoto M, Kamiya S, Ishiwata T. Expression and role of long non‐coding RNA H19 in carcinogenesis. Front Biosci. 2018;23:614–25. [DOI] [PubMed] [Google Scholar]
  • 22. Du W, Feng Z, Sun Q. LncRNA LINC00319 accelerates ovarian cancer progression through miR‐423‐5p/NACC1 pathway. Biochem Biophys Res Commun. 2018;507:198–202. [DOI] [PubMed] [Google Scholar]
  • 23. Lin X, Yang F, Qi X, Li Q, Wang D. LncRNA DANCR promotes tumor growth and angiogenesis in ovarian cancer through direct targeting of miR‐145. Mol Carcinog. 2019;58:2286–96. [DOI] [PubMed] [Google Scholar]
  • 24. Yang B, Xu L, Wang S. Regulation of lncRNA‐H19/miR‐140‐5p in cartilage matrix degradation and calcification in osteoarthritis. Ann Palliat Med. 2020;9:1896–904. [DOI] [PubMed] [Google Scholar]
  • 25. Zhao H, Peng R, Liu Q, Liu D, Du P, Yuan J, et al. The lncRNA H19 interacts with miR‐140 to modulate glioma growth by targeting iASPP. Arch Biochem Biophys. 2016;610:1–7. [DOI] [PubMed] [Google Scholar]
  • 26. Li O, Kang J, Zhang JJ, Wang J, Hu LW. Circle RNA FOXP1 promotes cell proliferation in lung cancer by regulating miR‐185‐5p/Wnt1 signaling pathway. Eur Rev Med Pharmacol Sci. 2020;24:6767–78. [DOI] [PubMed] [Google Scholar]
  • 27. Tian S, Hu J, Tao K, Wang J, Chu Y, Li J, et al. Secreted AGR2 promotes invasion of colorectal cancer cells via Wnt1‐mediated non‐canonical Wnt signaling. Exp Cell Res. 2018;364:198–207. [DOI] [PubMed] [Google Scholar]
  • 28. Li B, Guo X, Li N, Chen Q, Shen J, Wang F. WNT1, a target of miR‐34a, promotes cervical squamous cell carcinoma proliferation and invasion by induction of an E‐P cadherin switch via the WNT/β‐catenin pathway. Cell Oncol. 2020;43:489–503. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES