Abstract
Formononetin exhibits anti‐neoplastic activities in specific types of cancers, such as colon carcinoma and breast cancer. Nevertheless, its role in suppressing gastric carcinoma (GC) growth and metastatic‐associated phenotypes has not been fully understood. Here, we demonstrated that formononetin decreased the viability of GC cell line SGC‐7901 and MGC‐803. Furthermore, formononetin suppressed the migration and invasion abilities of GC cells. Consistent with the results in vitro, the anticancer effect of formononetin was verified using xenograft model. The expression of microRNA‐542‐5p (miR‐542‐5p), acted as an oncogene in many cancers, was identified to be upregulated in GC. Importantly, miR‐542‐5p might involve in formononetin exhibits anticancer activity in GC cells. Taken together, these results indicate that formononetin inhibits the growth and aggressiveness of GC cells in vitro and in vivo.
Keywords: formononetin, gastric carcinoma, invasion, migration, miR‐542‐5p
1. INTRODUCTION
Gastric carcinoma (GC) is the one of the most common digestive system neoplasms and the leading cause of cancer mortality. 1 , 2 , 3 Hence, developing effective strategies to combat GC is still an emergent health problem. Flavonoids are one of the most numerous and widely distributed family of phytochemicals in different types of fruits and vegetables. Plant extracts and their active compounds have long been regarded as promising candidates to treat a variety of human diseases. 4 , 5 Compared with conventional anticancer agents, plant‐derived flavonoids have an extra margin of safety since they show only marginal toxicity even at relatively high concentrations.
Flavonoids are polyphenolic substances, widely distributed in food plant, that possess anti‐inflammatory, antiviral, antithrombotic, antimicrobial, antineoplasic, and antimutagenic. 6 , 7 Luteolin, is a natural flavonoid which widely exist at high concentration in fruits and vegetables. Recent studies confirm that luteolin exerted in antitumor activities in gastric cancer cells through regulating miRNAs. 8 Quercetin modulates multiple cancer‐relevant miRNAs including miR‐155, miR‐21, and miR‐146a, thereby blocking tumorigenesis and cancer development. 9 The dried root of Astragalus membranaceus (Radix Astragali) has a long history of medicinal use in Traditional Chinese Medicine (TCM) as an immunomodulating agent to treat the diarrhea, common cold, fatigue, and anorexia. 10 , 11 In contemporary pharmacotherapy, Radix Astragali has been used to ameliorate the side‐effects of cytotoxic antineoplastic drugs. Formononetin is one of the major isoflavonoid constituents isolated from Astragalus membranaceus and has diverse pharmacological activities, including anticancers. 12 , 13 However, the anticancer mechanisms of formononetin against human GC migration and invasion have not been investigated.
There are several obstacles for the treatment of gastric cancer; for example, chemo‐resistance, immune escape, and metastasis. 14 , 15 During these obstacles, metastases are the leading cause of death in patients with GC. 16 Cancer metastasis is a complicated process by which cancer cell disseminate from their primary site and form secondary metastasis focuses at a distant site. 17 MiRNAs, are a kind of noncoding RNAs which is composed of 21 to 23 bases that regulate protein‐coding gene expression and/or repress mRNA translation through binding to the 3′‐untranslated region (3′‐UTR). Previous investigations have demonstrated that miRNAs play vital roles in a wide range of cellular processes, including growth, differentiation, apoptosis, and metastasis. For this reason, increasing therapeutic options focusing on cancer‐associated miRNAs have been explored as potential therapies for combating cancer metastasis.
In our study, we investigated the anticancer activities of formononetin in vitro and in vivo. Our results suggested that formononetin restrained the growth and metastatic‐associated traits of GC cells. A mechanistic study validated that miR‐542‐5p is involved in formononetin exhibits anticancer activity in GC cells. Our study not only revealed the anticancer role of formononetin in GC but also elucidated the role of miR‐542 as a critical regulator in GC cells progression.
2. MATERIALS AND METHODS
2.1. Cell culture
GC cell lines (BGC‐823, MNK‐45, SGC‐7901, and MGC‐803) and the normal gastric cell line GES‐1 were purchased from National Infrastructure of Cell Line Resource (Shanghai, China). These cell lines were cultured in Dulbecco's modifed Eagle's medium (DMEM) (Thermo Fisher Scientific, Waltham, Massachusetts) supplemented with 10% FBS (Thermo Fisher Scientific) and 100 U/mL penicillin/streptomycin (Sigma‐Aldrich). Formononetin (Figure 1A) was purchased from Beijing Hengye Zhongyuan Chemical Co., Ltd (Beijing, China). miR‐542‐5p inhibitor, anti‐miR‐Ctrl (control negative), miR‐542‐5p mimics, and miR‐Ctrl were purchased from GenePharma (Shanghai, China). Transfection was performed using Lipofectamine RNAiMAX Reagent (Thermo Fisher Scientific) in accordance with the manufacturer's instructions.
FIGURE 1.
Formononetin inhibits the proliferation of GC cell. A, Chemical structure of formononetin. B, SGC‐7901 or MGC‐803 cell was treated with formononetin (ranging from 10 to 100 μM). Cell treated with 0 μM formononetin was used as control. After culturing for 24, 48, or 72 hours, the cell viability was detected using MTT assay. C, Colony formation assay was performed using SGC‐7901 and MGC‐803 cell treated with formononetin (30, 50, or 80 μM). The clones were stained with crystal violet and the number of cell colonies was counted. * P < .05, ** P < .01 compared with control. GC, gastric carcinoma
2.2. MTT assay
SGC‐7901 or MGC‐803 cells were plated into 96 well plates and were treated with formononetin (0, 10, 30, 50, 80, and 100 μM) for 24, 48 or 72 hours. Then, 10 μL of methyl thiazolyl tetrazolium (MTT, 5 mg/mL; Sigma‐Aldrich) was added into 96 well plates and cell plates were incubated for 4 hours at 37°C. Afterwards, 200 μL of DMSO was added into 96 well plates. Finally, OD490 values were detected by a microplate reader.
2.3. Colony formation assay
SGC‐7901 or MGC‐803 cells (1 × 103 cells per well) were cultured into six well plates with formononetin (30, 50, and 80 μM) for 2 weeks. After 2 weeks, cell colonies were stained with 1% crystal violet. The number of cell colonies was recorded.
2.4. Migration assay
MGC‐803 or SGC‐7901 cells were seeded into 24‐well plates. When cell confluence reached over 80%, the monolayer was scratched gently using a sterile 1 mL pipette tip to create a wound. Then cells were washed twice with medium to remove detached cells, fresh medium plus formononetin (30, 50, and 80 μM) was replenished to each well and incubated for another 24 hours. The wound photos were taken with a Canon microscope at both 0 hour and 24 hours after formononetin treatment. The rate of scratch healing was calculated with below formula. Scratch healing rate = (average diameter of scratch at 0 hour‐average diameter of scratch at 24 hours)/average diameter of scratch at 0 hour×100%.
2.5. Invasion assay
The membrane of Transwell chamber (Corning, New York) with 8 μm polycarbonate filter was coated with 30 μg Matrigel (BD Biosciences). 100 μL of SGC‐7901 or MGC‐803 cells were added into the upper chamber and treated with formononetin. 600 μL of medium containing 20% FBS was put into the bottom chamber. After 24 hours, cells were stained with crystal violet and the number of the invading cells was counted under the microscope.
2.6. Quantitative real‐time PCR assay
Total RNA was isolated using MiRNeasy Mini Kit (Qiagen, Hilden, Germany). Reverse transcription (RT) was carried out using All‐in‐One miRNA First‐Strand cDNA Synthesis Kit (GeneCopoeia). Quantitative real‐time PCR (qRT‐PCR) was performed using All‐in‐One miRNA qPCR Detection kit (GeneCopoeia) and the iQ5 real‐time detection system (Bio‐Rad Laboratories, Hercules, California). The comparative cycle threshold (Ct) method was applied to quantify the expression levels through calculating the 2(−ΔΔCt) method. The primers used were as follows: miR‐542 (Forward: 5′‐GCGGTCGGGGATCATCATGTC‐3′, Reverse: 5′‐ATCCAGTGCAGGGTCCGAGG‐3′), U6 (Forward: 5′‐AATGGACAACTGGTCGTGGAC‐3′, Reverse: 5′‐CCCTCCAGGGGATCTGTTTG‐3′).
2.7. Xenograft model
BALB/c nude mice were randomly divided into three groups (n = 3 in each group). 100 μL of untreated or miR‐542‐5p mimics transfected SGC‐7901 cells (1 × 106/ml) were inoculated subcutaneously into BALB/c nude mice. After tumor reached 100 mm3, the mice were treated with either 100 μL formononetin (30 mg/kg) or saline (vehicle) using the method of intragastric administration three times a week. The tumor volume was calculated as following: length × width2/2. The mice were sacrificed via CO2 asphyxiation 5 weeks after the transplant. Tumors were then removed and weighed. Animal experiment was approved by the Committee for Animal Research of Zhuji People's Hospital of Zhejiang Province.
3. STATISTICAL ANALYSIS
All data were presented as mean ± SD and were analyzed using SPSS 18.0. P < .05 was statistically significant. Statistical analysis of difference was conducted using two‐tailed Student's t‐test or one‐way ANOVA followed by post hoc Dunnett's test.
4. RESULTS
4.1. Effect of formononetin on the proliferation of GC cells
To explore the inhibitory effect of on the growth of GC cells in vitro, GC cell line SGC‐7901 or MGC‐803 was treated with various concentrations of formononetin (10, 30, 50, 80, and 100 μM) of 24, 48 or 72 hours, respectively. As showed in Figure 1B, we found that formononetin suppressed the proliferation of GC cells in a dose‐dependent manner. Consistently, formononetin significantly inhibited the colony formation of MGC‐803 and SGC‐7901 cell in vitro (Figure 1C). All these findings indicate that formononetin inhibits GC cells growth in vitro.
4.2. Formononetin inhibits GC cells migration and invasion
To explore the role of formononetin on the aggressive traits of GC cells, we investigated the migration and invasiveness of MGC‐803 and SGC‐7901 cells using wound healing and Transwell invasion assay. As shown in Figure 2A,B, formononetin (30, 50, and 80 μM) markedly inhibited the migrate abilities of MGC‐803 and SGC‐7901 cells. In Transwell assay, we also observed that formononetin dose‐dependently restrained the invasion of GC cells in vitro (Figure 2C,D). These data indicate that formononetin represses the migration and invasion capacities of GC cells.
FIGURE 2.
Formononetin inhibits SGC‐7901 and MGC‐803 cell migration and invasion. A‐B, Formononetin inhibited SGC‐7901 and MGC‐803 cell migration in a wound healing assay. Cells were wounded with a pipette and treated with different concentrations (0, 30, 50, and 80 μM) of formononetin. Microscopic observations were recorded 0 and 24 hours after scratching the cell surface. C‐D, Formononetin inhibited SGC‐7901 or MGC‐803 cell invasion in a Transwell assay. Images represented the cells that traveled through the micropore membrane and histograms show the number of invaded cells. * P < .05, ** P < .01 compared with control
4.3. miR‐542‐5p is overexpressed in GC
To seek the role of miRNAs in GC, we analyzed the dysregulated miRNAs by retrieving the microarray data in The Cancer Genome Atlas Program (TCGA). Cluster analysis based on miRNAs expression pattern indicated a significant difference between GC tissue and the adjacent normal tissue ((log[2] fold change > 1 and P‐value < .01, Figure 3A). 102 miRNAs showed higher expression in GC tissues when compared with in normal(Table 1). To further examine the value of the 102 selected miRNAs as prognosis biomarker, we tested their associations with prognosis results of patients with GC. Only three miRNAs (miR‐542‐5p, miR‐1976, and miR‐450b) were correlated with overall survival of GC patients (Table 2, log‐rank, P < .05). We then determined the effect of formononetin on the levels of miR‐542‐5p, miR‐1976, and miR‐450b. The results of qRT‐PCR displayed that miR‐542‐5p rather than miR‐1976 and miR‐450b was significantly reduced by formononetin in SGC‐7901 and MGC‐803 cells compared to the untreated control (Figure 3B). Thus, in the current study, we speculated that the miR‐542‐5p was partially associated with the anticancer effects formononetin in GC. The relative level of miR‐542‐5p in GC tissues and normal tissues was shown in Figure 3C. Importantly, the higher level of miR‐542‐5p associated with worse outcome in patients with GC (Figure 3D). To test the levels of miR‐542‐5p in GC cell lines, we examined miR‐542‐5p expressions in four GC cell lines (SGC‐7901, BGC‐823, MGC‐803, and MKN‐45) and the normal gastric cell line GES‐1. We found that miR‐542‐5p was also upregulated in GC cell lines, as compared to GES‐1 (Figure 3E). The levels of miR‐542‐5p were higher in SGC‐7901 and MGC‐803 than that in BGC‐823 and MNK‐45 cell lines. The suppressive effects of formononetin on low miR‐542‐5p expressing BGC‐823 and MNK‐45 cells were also detected. As shown in Figure 3F,G, formononetin (30, 50, and 80 μM) markedly inhibited the colony formation and invasion abilities of BGC‐823 and MNK‐45 cell. These results indicate that miR‐542‐5p may be involved in the development of GC.
FIGURE 3.
miR‐542‐5p is upregulated in GC tissues and cell lines. A, differentially expressed miRNAs were analyzed between GC cancer tissue and normal tissue. Data were retrieved from TCGA. B, SGC‐7901 and MGC‐803 cells were exposed to formononetin (50 μM) and the levels of miR‐542‐5p, miR‐1976, and miR‐450b were determined by qRT‐PCR assay. C, The relative expression of miR‐542‐5p in GC and normal tissues in TCGA. D, Kaplan‐Meier survival analysis of overall survival of patients with GC had high or low expression of miR‐542‐5p. E, Relative expression of miR‐542‐5p in four GC cell lines (SGC‐7901, BGC‐823, MGC‐803, MKN‐45) and the normal gastric cell line GES‐1. ** P < .01 vs GES‐1. F, Colony formation assay was performed using BGC‐823 and MKN‐45 cell treated with formononetin (30, 50, or 80 μM). G, Formononetin inhibited BGC‐823 and MKN‐45 cell invasion in a Transwell assay. * P < .05, ** P < .01 compared with control. GC, gastric carcinoma; qRT‐PCR, Quantitative real‐time PCR; TCGA, The Cancer Genome Atlas Program
TABLE 1.
The differentially expressed of miRNAs in GC and normal tissues
| miRNA | logFC | AveExpr | t | P‐value | Adj P‐value |
|---|---|---|---|---|---|
| hsa‐mir‐196b | 4.46807033 | 7.20660235 | 11.0042824 | 4.31E‐25 | 8.45E‐23 |
| hsa‐mir‐196a‐2 | 4.35171651 | 5.41266789 | 12.2984234 | 3.76E‐30 | 1.48E‐27 |
| hsa‐mir‐196a‐1 | 4.31208993 | 5.30270283 | 12.5259481 | 4.54E‐31 | 2.37E‐28 |
| hsa‐mir‐135b | 3.20213711 | 5.03690151 | 11.2053952 | 7.38E‐26 | 1.93E‐23 |
| hsa‐mir‐194‐2 | 3.04773787 | 12.1296526 | 10.6032376 | 1.38E‐23 | 2.18E‐21 |
| hsa‐mir‐194‐1 | 2.98896585 | 11.9603449 | 10.3729984 | 9.75E‐23 | 1.27E‐20 |
| hsa‐mir‐192 | 2.9311231 | 14.2110496 | 9.3289403 | 4.96E‐19 | 2.36E‐17 |
| hsa‐mir‐200a | 2.82460986 | 10.4511255 | 10.2771679 | 2.18E‐22 | 2.64E‐20 |
| hsa‐mir‐183 | 2.75423928 | 11.5014604 | 10.0369575 | 1.62E‐21 | 1.41E‐19 |
| hsa‐mir‐552 | 2.72197963 | 2.99225769 | 5.87715588 | 8.16E‐09 | 1.07E‐07 |
| hsa‐mir‐200b | 2.7133333 | 10.3599236 | 10.2475132 | 2.80E‐22 | 3.14E‐20 |
| hsa‐mir‐141 | 2.60238678 | 10.1048149 | 9.51616864 | 1.12E‐19 | 6.51E‐18 |
| hsa‐mir‐21 | 2.46750398 | 17.8092012 | 25.0956473 | 2.00E‐87 | 3.13E‐84 |
| hsa‐mir‐146b | 2.45287399 | 9.17764507 | 14.2094732 | 4.34E‐38 | 3.40E‐35 |
| hsa‐mir‐200c | 2.44500886 | 12.7004238 | 9.33347214 | 4.79E‐19 | 2.35E‐17 |
| hsa‐mir‐429 | 2.39898673 | 7.76747718 | 7.97565499 | 1.28E‐14 | 3.52E‐13 |
| hsa‐mir‐182 | 2.36543705 | 12.9230479 | 9.3790656 | 3.34E‐19 | 1.75E‐17 |
| hsa‐mir‐18a | 2.13473897 | 4.66230784 | 9.36374501 | 3.77E‐19 | 1.91E‐17 |
| hsa‐mir‐767 | 2.03065551 | 2.12619329 | 4.19333499 | 3.31E‐05 | 0.00022415 |
| hsa‐mir‐335 | 2.01543685 | 6.22198084 | 9.38117745 | 3.28E‐19 | 1.75E‐17 |
| hsa‐mir‐142 | 1.98988427 | 10.8664836 | 7.43192154 | 5.48E‐13 | 1.25E‐11 |
| hsa‐mir‐501 | 1.94850366 | 5.51015413 | 9.83224373 | 8.70E‐21 | 6.21E‐19 |
| hsa‐mir‐105‐2 | 1.90914975 | 1.99883348 | 4.12569343 | 4.41E‐05 | 0.00028815 |
| hsa‐mir‐96 | 1.87042686 | 3.73069642 | 8.4084308 | 5.60E‐16 | 1.79E‐14 |
| hsa‐mir‐105‐1 | 1.85594009 | 1.99218471 | 3.98920577 | 7.74E‐05 | 0.00048206 |
| hsa‐mir‐19a | 1.85249096 | 5.00403517 | 9.24797834 | 9.39E‐19 | 4.21E‐17 |
| hsa‐mir‐215 | 1.84397295 | 8.81172446 | 4.37922169 | 1.48E‐05 | 0.00010935 |
| hsa‐mir‐93 | 1.78635427 | 12.1328048 | 9.99592456 | 2.27E‐21 | 1.78E‐19 |
| hsa‐mir‐584 | 1.70245601 | 6.28115833 | 7.06584575 | 6.15E‐12 | 1.27E‐10 |
| hsa‐mir‐210 | 1.69707847 | 7.77349195 | 4.48391691 | 9.32E‐06 | 7.07E‐05 |
| hsa‐mir‐20a | 1.69459925 | 8.35059549 | 8.5502333 | 1.96E‐16 | 6.40E‐15 |
| hsa‐mir‐222 | 1.69433369 | 6.44789582 | 8.66196745 | 8.49E‐17 | 2.90E‐15 |
| hsa‐mir‐500a | 1.66086665 | 7.90643241 | 9.11964472 | 2.56E‐18 | 1.09E‐16 |
| hsa‐mir‐130b | 1.65559731 | 4.66820401 | 7.8624068 | 2.84E‐14 | 7.55E‐13 |
| hsa‐mir‐708 | 1.64592053 | 5.83847164 | 7.98592223 | 1.19E‐14 | 3.33E‐13 |
| hsa‐mir‐203b | 1.62559966 | 5.68091117 | 4.60660027 | 5.34E‐06 | 4.34E‐05 |
| hsa‐mir‐17 | 1.61443242 | 9.67401297 | 9.17210862 | 1.70E‐18 | 7.42E‐17 |
| hsa‐mir‐181b‐2 | 1.57341178 | 6.63639386 | 10.1187744 | 8.20E‐22 | 7.57E‐20 |
| hsa‐mir‐1307 | 1.56816721 | 10.2336523 | 8.34179725 | 9.13E‐16 | 2.75E‐14 |
| hsa‐mir‐181b‐1 | 1.55159148 | 6.74046508 | 10.1811129 | 4.88E‐22 | 5.10E‐20 |
| hsa‐mir‐181a‐1 | 1.54789564 | 9.07372859 | 11.7107639 | 8.11E‐28 | 2.54E‐25 |
| hsa‐mir‐503 | 1.53903245 | 2.88119075 | 8.13490468 | 4.10E‐15 | 1.18E‐13 |
| hsa‐mir‐203a | 1.53612737 | 12.5290249 | 4.52024752 | 7.92E‐06 | 6.12E‐05 |
| hsa‐mir‐1269a | 1.52122029 | 1.77713027 | 3.4271043 | 0.00066638 | 0.00325714 |
| hsa‐mir‐217 | 1.49909249 | 5.02481648 | 6.72842863 | 5.26E‐11 | 8.50E‐10 |
| hsa‐mir‐935 | 1.4609049 | 2.04503207 | 5.76764519 | 1.50E‐08 | 1.86E‐07 |
| hsa‐mir‐106b | 1.46035891 | 8.96431343 | 9.77014211 | 1.44E‐20 | 9.44E‐19 |
| hsa‐mir‐592 | 1.45118232 | 2.21889235 | 6.75818339 | 4.36E‐11 | 7.21E‐10 |
| hsa‐mir‐532 | 1.44324294 | 9.98472183 | 9.25105971 | 9.17E‐19 | 4.21E‐17 |
| hsa‐mir‐223 | 1.38472618 | 8.20868129 | 5.64279301 | 2.97E‐08 | 3.56E‐07 |
| hsa‐mir‐185 | 1.37211221 | 5.89269217 | 10.5291636 | 2.59E‐23 | 3.70E‐21 |
| hsa‐mir‐577 | 1.35259261 | 3.7679098 | 4.0296339 | 6.56E‐05 | 0.00041268 |
| hsa‐mir‐424 | 1.34946415 | 6.05920061 | 6.4231764 | 3.41E‐10 | 5.05E‐09 |
| hsa‐mir‐425 | 1.34297407 | 7.6848319 | 6.19877978 | 1.29E‐09 | 1.81E‐08 |
| hsa‐mir‐1301 | 1.33973769 | 3.07675724 | 7.81433961 | 3.97E‐14 | 1.04E‐12 |
| hsa‐mir‐146a | 1.32743332 | 7.36555503 | 5.59716086 | 3.80E‐08 | 4.39E‐07 |
| hsa‐mir‐4326 | 1.32372957 | 2.84765816 | 5.43908962 | 8.83E‐08 | 9.62E‐07 |
| hsa‐mir‐362 | 1.32108717 | 4.04705428 | 7.74021977 | 6.66E‐14 | 1.71E‐12 |
| hsa‐mir‐542‐5p | 1.31957482 | 7.17596729 | 10.0017638 | 2.16E‐21 | 1.78E‐19 |
| hsa‐mir‐221 | 1.31816396 | 8.14024037 | 7.51807227 | 3.06E‐13 | 7.16E‐12 |
| hsa‐mir‐652 | 1.31192602 | 4.87144117 | 8.13330197 | 4.14E‐15 | 1.18E‐13 |
| hsa‐mir‐188 | 1.30798774 | 2.46865109 | 7.63723869 | 1.36E‐13 | 3.38E‐12 |
| hsa‐mir‐660 | 1.29675029 | 5.99446008 | 7.94721788 | 1.56E‐14 | 4.23E‐13 |
| hsa‐mir‐191 | 1.29592073 | 8.81295472 | 7.00499148 | 9.11E‐12 | 1.83E‐10 |
| hsa‐mir‐500b | 1.2936541 | 3.29434041 | 7.5334399 | 2.76E‐13 | 6.65E‐12 |
| hsa‐mir‐615 | 1.28133387 | 1.72596399 | 6.00191279 | 4.03E‐09 | 5.50E‐08 |
| hsa‐mir‐7‐1 | 1.27855552 | 5.25205431 | 6.96254794 | 1.20E‐11 | 2.26E‐10 |
| hsa‐mir‐15a | 1.27548222 | 7.10713096 | 8.83655099 | 2.27E‐17 | 8.89E‐16 |
| hsa‐mir‐19b‐1 | 1.26083608 | 6.26193593 | 7.28861473 | 1.43E‐12 | 3.15E‐11 |
| hsa‐mir‐4677 | 1.25645011 | 2.87198971 | 9.10417714 | 2.89E‐18 | 1.19E‐16 |
| hsa‐mir‐937 | 1.2371866 | 1.6062045 | 6.55488034 | 1.54E‐10 | 2.39E‐09 |
| hsa‐mir‐19b‐2 | 1.23485306 | 6.05772932 | 7.00236286 | 9.26E‐12 | 1.84E‐10 |
| hsa‐mir‐455 | 1.22388554 | 7.39032615 | 4.89506668 | 1.37E‐06 | 1.24E‐05 |
| hsa‐mir‐493 | 1.21438629 | 3.64562497 | 8.4019819 | 5.87E‐16 | 1.84E‐14 |
| hsa‐mir‐877 | 1.20791447 | 1.79602083 | 7.31243352 | 1.22E‐12 | 2.73E‐11 |
| hsa‐mir‐92a‐1 | 1.18969188 | 12.2488517 | 6.89279232 | 1.87E‐11 | 3.33E‐10 |
| hsa‐mir‐301a | 1.18832499 | 3.36575573 | 6.96239358 | 1.20E‐11 | 2.26E‐10 |
| hsa‐mir‐589 | 1.18235143 | 5.84544988 | 8.74356308 | 4.59E‐17 | 1.76E‐15 |
| hsa‐mir‐92a‐2 | 1.18062001 | 12.1323656 | 6.86514068 | 2.23E‐11 | 3.90E‐10 |
| hsa‐mir‐450b | 1.16020853 | 3.21655189 | 8.17979367 | 2.96E‐15 | 8.78E‐14 |
| hsa‐mir‐25 | 1.15865111 | 12.89145 | 8.66247244 | 8.46E‐17 | 2.90E‐15 |
| hsa‐mir‐4661 | 1.15708217 | 1.98970218 | 6.28111614 | 7.97E‐10 | 1.14E‐08 |
| hsa‐mir‐181a‐2 | 1.15312374 | 9.75227581 | 9.71183378 | 2.32E‐20 | 1.45E‐18 |
| hsa‐mir‐1266 | 1.14313084 | 3.45671836 | 5.14823905 | 3.94E‐07 | 3.75E‐06 |
| hsa‐mir‐3613 | 1.13137303 | 3.48932105 | 6.60504768 | 1.13E‐10 | 1.77E‐09 |
| hsa‐mir‐3127 | 1.13020064 | 2.40335922 | 6.97916666 | 1.08E‐11 | 2.11E‐10 |
| hsa‐mir‐675 | 1.12367169 | 3.60850461 | 3.12561298 | 0.00188975 | 0.00832869 |
| hsa‐mir‐155 | 1.11061449 | 8.61852634 | 5.2558329 | 2.29E‐07 | 2.25E‐06 |
| hsa‐mir‐103a‐2 | 1.09480307 | 12.9595823 | 8.67452753 | 7.72E‐17 | 2.82E‐15 |
| hsa‐mir‐103a‐1 | 1.09373912 | 12.9558005 | 8.64243264 | 9.83E‐17 | 3.28E‐15 |
| hsa‐mir‐3677 | 1.08502786 | 2.74647529 | 5.64012078 | 3.01E‐08 | 3.58E‐07 |
| hsa‐mir‐508 | 1.08279726 | 1.8991184 | 4.59848938 | 5.55E‐06 | 4.48E‐05 |
| hsa‐mir‐92b | 1.08172814 | 6.47011641 | 7.13032822 | 4.04E‐12 | 8.57E‐11 |
| hsa‐mir‐769 | 1.07553387 | 4.46597034 | 8.37772779 | 7.01E‐16 | 2.16E‐14 |
| hsa‐mir‐502 | 1.06072183 | 3.82547751 | 7.26339035 | 1.69E‐12 | 3.67E‐11 |
| hsa‐mir‐1976 | 1.05463755 | 2.96402332 | 7.538767 | 2.66E‐13 | 6.51E‐12 |
| hsa‐mir‐550a‐1 | 1.04674686 | 1.92424792 | 6.90430833 | 1.73E‐11 | 3.13E‐10 |
| hsa‐mir‐483 | 1.04260328 | 1.79157091 | 3.32557412 | 0.00095495 | 0.00449947 |
| hsa‐mir‐421 | 1.02702813 | 1.98120344 | 7.52512772 | 2.92E‐13 | 6.93E‐12 |
| hsa‐mir‐590 | 1.02589693 | 4.21553744 | 5.98541419 | 4.43E‐09 | 5.94E‐08 |
| hsa‐mir‐345 | 1.00724129 | 3.59653674 | 4.65811513 | 4.21E‐06 | 3.50E‐05 |
| hsa‐mir‐942 | 1.0069842 | 3.33082121 | 5.63674962 | 3.07E‐08 | 3.62E‐07 |
Abbreviations: Adj P‐value, adjust P‐value; AveExpr, average log‐expression value; FC, fold change; GC, gastric carcinoma.
TABLE 2.
The association of miRNAs with the prognosis of patients with GC
| miRNA | P‐value |
|---|---|
| hsa‐mir‐450b | .012686177 |
| hsa‐mir‐542‐5p | .033115882 |
| hsa‐mir‐1976 | .04668818 |
Abbreviation: GC, gastric carcinoma.
4.4. miR‐542‐5p inhibitor suppresses GC cells growth and invasion
Given the higher level of miR‐542‐5p in GC cell lines, we speculated that miR‐542‐5p may serve as an oncogene. To verify it, 6‐fluorescein (6‐FAM)‐labeled miR‐542‐5p inhibitor (anti‐miR‐542‐5p) was transfected into MGC‐803 and SGC‐7901 cells (Figure 4A). Consistently, the qRT‐PCR assay displayed that anti‐miR‐542‐5p treatment significantly decreased the level of miR‐542‐5p in SGC‐7901 and MGC‐803 (Figure 4B). The results of colony formation disclosed that miR‐542‐5p silencing inhibited SGC‐7901 and MGC‐803 cell growth (Figure 4C). Meanwhile, miR‐542‐5p knockdown resulted in an obvious decreased in the migration and invasion of GC cells (Figure 4D,E). We also detected the level of miR‐542‐5p in GC cells that were treated with formononetin. The result of qRT‐PCR assay indicated that formononetin reduced the level of miR‐542‐5p in four GC cell lines (Figure 4F).
FIGURE 4.
miR‐542‐5p inhibitor inhibits GC cells growth, migration, and invasion in vitro. A, miR‐542‐5p labeled with 6‐FAM was transfected into GC cells and the fluorescence staining was detected using a fluorescence microscope. B, The levels of miR‐542‐5p in SGC‐7901 and MGC‐803 cells were detected using qRT‐PCR assay. C, Cell growth was measured by colony formation assay after anti‐miR‐542‐5p transfection in SGC‐7901 and MGC‐803 cells. D, the migration was detected by wound healing after anti‐miR‐542‐5p transfection in SGC‐7901 and MGC‐803 cells. E, The invasion was detected using transwell after anti‐miR‐542‐5p transfection in SGC‐7901 and MGC‐803 cells. ** P < .01 compared with anti‐miR‐ctrl. F, GC cells were exposed to formononetin (30, 50, and 80 μM) and the levels of miR‐542‐5p were determined by qRT‐PCR assay. ** P < .01 compared with control. GC, gastric carcinoma; qRT‐PCR, Quantitative real‐time PCR
4.5. miR‐542‐5p is involved in formononetin exhibits anticancer activity in GC cells
The results above have demonstrated that downregulation of miR‐542‐5p using miR‐542‐5p inhibitor (anti‐miR‐542‐5p) suppressed the growth, migration, and invasion of GC cells. To verify whether miR‐542‐5p is involved in formononetin exhibits anticancer activity in GC cells, miR‐542‐5p mimics were transfected into GC cells and exposed to formononetin. After transfection, the level of miR‐542‐5p was significantly raised in SGC‐7901 and MGC‐803 cells (Figure 5A). Compared to formononetin + miR‐Ctrl group, the colony formation and invasion of SGC‐7901 and MGC‐803 cells were remarkably increased in formononetin + miR‐542‐5p mimics group (Figure 5B,C), which indicated that formononetin inhibited GC cells might be via down‐regulating miR‐542‐5p expression.
FIGURE 5.
MiR‐542‐5p is involved in formononetin exhibits anticancer activity in GC cells. A, After miR‐542‐5p mimics or its negative control (miR‐ctrl) transfection, the expression of miR‐542‐5p in SGC‐7901 and MGC‐803 cells was measured using qRT‐PCR. B, The inhibitory effect of formononetin in the colony formation of GC cells were impaired by the addition of miR‐542‐5p mimics. C, The inhibitory effect of formononetin in GC cells invasion was impaired by the addition of miR‐542‐5p mimics. ** P < .01 compared with control, ## P < .01 compared with formononetin (50 μM). GC, gastric carcinoma; qRT‐PCR, Quantitative real‐time PCR
4.6. Formononetin exerts antitumor activities in vivo
Next, SGC‐7901 xenograft model was constructed to elaborate the antitumor potential of formononetin in vivo (Figure 6A). As shown in Figure 6B,D, the tumors derived from the xenografts treated with formononetin exhibited smaller tumor volume and lower tumor weight as compared with the control. Finally, the expressions of miR‐542‐5p in tumor tissues derived from SGC‐7901 cells were detected using qRT‐PCR. Consistent with the in vitro experiments, the expression of miR‐542‐5p was decreased by formononetin whereas its level was rescued in tissues formed by miR‐542‐5p mimics transfected SGC‐7901 cells (Figure 6E). These data indicate that formononetin significantly suppresses SGC‐7910 cells growth in vivo.
FIGURE 6.
Antitumor activity of formononetin in an SGC‐7901 gastric cancer model. A, After cells inoculation, nude mice was treated with formononetin (30 mg/kg). B, Representative photograph of cancer tissues formed in nude mice. C‐D, Tumor volume and weight were measured in the different groups. E, The expressions of miR‐542‐5p in tumor tissues were evaluated by qRT‐PCR. ** P < .01 compared with vehicle, ## P < .01 compared with formononetin (30 mg/kg). qRT‐PCR, Quantitative real‐time PCR
5. DISCUSSION
The standard treatment for GC includes surgery, radiotherapy, and chemotherapy. Nevertheless, there are several “bottle‐necks” for the treatment of GC, and cancer cells metastasis is one of the primary causes leading to treatment failure. 17 Since patients with metastatic GC have poor clinical outcomes, inhibiting metastases is important for combating this disease and improving survival. 18 Since effective therapeutic drugs are limited and drug resistance occurs frequently, it is urgent to investigate natural treatments, which could improve the treatment of metastatic GC and mitigate the undesirable side‐effects of chemotherapeutics.
Although studies reveal the antitumor activity of formononetin in several cancer types, few investigations illuminate the anticancer effect of formononetin in human GC. 19 , 20 , 21 In this study, we proved that formononetin treatment inhibited the proliferation of GC cell SGC‐7901 and MGC‐803 in dose‐dependent manner. In colony formation analysis, the colony formation potential of GC cells was significantly decreased by formononetin, which further confirmed that formononetin suppressed the growth of GC cells in vitro. Consistently, formononetin reduced the tumor growth of SGC‐7901 cell in vivo. Cancer metastasis requires several crucial interrelated events, such as cancer cell migration and invasion. 22 , 23 In our study, we also investigated the migration and invasion of GC cells that were treated with formononetin. As expected, the migration ability and invasiveness of GC cells were remarkably declined by formononetin. In all, our data suggest that formononetin has a potential anticancer effect in GC.
Previous studies have reported that miR‐542 was a multifunctional miRNA, which is involved in cancer cell apoptosis, proliferation, invasion, and metastasis. Two mature sequences of miR‐542‐5p and miR‐542‐3p were formed from pre‐miR‐542. miR‐542‐3p is a suppressive miRNA, and upregulation of miR‐542‐3p inhibits the growth, migration, angiogenesis, and metastatic abilities of cancer cells. 24 , 25 While studies on miR‐542‐3p abound, there are only a few studies on miR542‐5p, and its role is still controversial. MiRNA‐542‐5p is remarkedly higher in osteosarcoma than in normal bone and overexpression of miR‐542‐5p promote cell growth. 26 Nevertheless, miR‐542‐5p is downregulated in lung cancer tissues and the lower level of miR‐542‐5p is associated with advanced vascular invasion and lymphatic metastasis in patients with lung cancer. 27 In GC, we observed that the level of miR‐542‐5p was higher in cancer compared with that in normal tissue using TCGA. Importantly, downregulation of miR‐542‐5p using miR‐542‐5 inhibitor (anti‐miR‐542‐5p) remarkedly reduced the colony formation, migration, and invasion of GC cells.
Importantly, the levels of miR‐542‐5p were significantly reduced by formononetin in GC cells. To further validate the central role of miR‐542‐5p in formononetin anticancer impacts, GC cells were transfected with miR‐542‐5p and then treated with formononetin. The results from colony formation and invasion assays confirmed that formononetin exerted its suppressive impacts in GC was partly dependent on regulating miR‐542‐5p. Formononetin as a natural product displayed anticancer activity in cancers. To discovery more potent antitumor compounds based on the natural formononetin, the structural modification of formononetin is very necessary. Formononetin derivative is designed and synthesized via a molecular hybridization strategy based on formononetin. Formononetin derivative displays potently greater antiproliferative activity in GC cells. 28 Altogether, we demonstrated the antitumor activity of formononetin on GC in vitro and in vivo. We confirmed that miR‐542‐5p might involve in formononetin exhibits anticancer activity in GC cells. It is possible that formononetin may has clinical benefit in treatment for GC patients. However, miRNAs target specific mRNAs involved in mediating multiple biological processes, such as cancer cell proliferation, invasion, and metastasis. In the further, we will investigate the critical miRNA‐mRNA axis in GC cell progression and clarify the clear anticancer mechanism of formononetin in vivo and in vitro.
CONFLICT OF INTEREST
The authors declare no potential conflict of interest.
Wang W‐S, Zhao C‐S. Formononetin exhibits anticancer activity in gastric carcinoma cell and regulating miR‐542‐5p. Kaohsiung J Med Sci. 2021;37:215–225. 10.1002/kjm2.12322
REFERENCES
- 1. Zhang R, Zhu Z, Shen W, Li X, Dhoomun DK, Tian Y. Golgi membrane protein 1 (GOLM1) promotes growth and metastasis of breast cancer cells via regulating matrix metalloproteinase‐13 (MMP13). Med Sci Monit. 2019;25:847–855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Zhang J, Zhu L, Fang J, Ge Z, Li X. LRG1 modulates epithelial‐mesenchymal transition and angiogenesis in colorectal cancer via HIF‐1alpha activation. J Exp Clin Cancer Res. 2016;35:29. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Wang GJ, Jiao BP, Liu YJ, Li YR, Deng BB. Reactivation of microRNA‐506 inhibits gastric carcinoma cell metastasis through ZEB2. Aging. 2019;11(6):1821–1831. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Li Y, Zhang T, Chen GY. Flavonoids and colorectal cancer prevention. Antioxidants (Basel). 2018;7(12):187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Amawi H, Ashby CR Jr, Tiwari AK. Cancer chemoprevention through dietary flavonoids: What's limiting? Chin J Cancer. 2017;36(1):50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Hu W, Wu X, Tang J, Zhao G, Xiao N, Zhang L, et al. Anti‐cancer targets of formononetin and molecular mechanisms in osteosarcoma: Findings of bioinformatic and experimental assays. J Cell Mol Med. 2019;23(5):3505–3511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Zhang L, Gong Y, Wang S, Gao F. Anti‐colorectal cancer mechanisms of formononetin identified by network pharmacological approach. Med Sci Monit. 2019;25:7709–7714. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Pu Y, Zhang T, Wang J, Mao Z, Duan B, Long Y, et al. Luteolin exerts an anticancer effect on gastric cancer cells through multiple signaling pathways and regulating miRNAs. J Cancer. 2018;9(20):3669–3675. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Kim DH, Khan H, Ullah H, Hassan STS, Smejkal K, Efferth T, et al. MicroRNA targeting by quercetin in cancer treatment and chemoprotection. Pharmacol Res. 2019;147:104346. [DOI] [PubMed] [Google Scholar]
- 10. Zhou Q, Zhang W, Li T, Tang R, Li C, Yuan S, et al. Formononetin enhances the tumoricidal effect of everolimus in breast cancer MDA‐MB‐468 cells by suppressing the mTOR pathway. Evid Based Complement Alternat Med. 2019;2019:9610629. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Chen J, Zeng J, Xin M, Huang W, Chen X. Formononetin induces cell cycle arrest of human breast cancer cells via IGF1/PI3K/Akt pathways in vitro and in vivo. Horm Metab Res. 2011;43(10):681–686. [DOI] [PubMed] [Google Scholar]
- 12. Ye Y, Hou R, Chen J, Mo L, Zhang J, Huang Y, et al. Formononetin‐induced apoptosis of human prostate cancer cells through ERK1/2 mitogen‐activated protein kinase inactivation. Horm Metab Res. 2012;44(4):263–267. [DOI] [PubMed] [Google Scholar]
- 13. Auyeung KK, Law PC, Ko JK. Novel anti‐angiogenic effects of formononetin in human colon cancer cells and tumor xenograft. Oncol Rep. 2012;28(6):2188–2194. [DOI] [PubMed] [Google Scholar]
- 14. Ben Kridis W, Marrekchi G, Mzali R, Daoud J, Khanfir A. Prognostic factors in metastatic gastric carcinoma. Exp Oncol. 2019;41(2):173–175. [DOI] [PubMed] [Google Scholar]
- 15. Jin M, Zhang GW, Shan CL, Zhang H, Wang ZG, Liu SQ, et al. Up‐regulation of miRNA‐105 inhibits the progression of gastric carcinoma by directly targeting SOX9. Eur Rev Med Pharmacol Sci. 2019;23(9):3779–3789. [DOI] [PubMed] [Google Scholar]
- 16. Liu J, Zhao X, Wang K, Zhang X, Yu Y, Lv Y, et al. A novel YAP1/SLC35B4 regulatory axis contributes to proliferation and progression of gastric carcinoma. Cell Death Dis. 2019;10(6):452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Chen QF, Hu CF, Sun K, Lang YP. LncRNA NR027113 promotes malignant progression of gastric carcinoma via EMT signaling pathway. Eur Rev Med Pharmacol Sci. 2019;23(11):4746–4755. [DOI] [PubMed] [Google Scholar]
- 18. Qu Y, Dou P, Hu M, Xu J, Xia W, Sun H. circRNACER mediates malignant progression of breast cancer through targeting the miR136/MMP13 axis. Mol Med Rep. 2019;19(4):3314–3320. [DOI] [PubMed] [Google Scholar]
- 19. Zhang X, Bi L, Ye Y, Chen J. Formononetin induces apoptosis in PC‐3 prostate cancer cells through enhancing the Bax/Bcl‐2 ratios and regulating the p38/Akt pathway. Nutr Cancer. 2014;66(4):656–661. [DOI] [PubMed] [Google Scholar]
- 20. Zhang Y, Chen C, Zhang J. Effects and significance of formononetin on expression levels of HIF‐1alpha and VEGF in mouse cervical cancer tissue. Oncol Lett. 2019;18(3):2248–2253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Xin M, Wang Y, Ren Q, Guo Y. Formononetin and metformin act synergistically to inhibit growth of MCF‐7 breast cancer cells in vitro. Biomed Pharmacother. 2019;109:2084–2089. [DOI] [PubMed] [Google Scholar]
- 22. Zeeshan R, Mutahir Z. Cancer metastasis ‐ tricks of the trade. Bosn J Basic Med Sci. 2017;17(3):172–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Fidler IJ, Kripke ML. The challenge of targeting metastasis. Cancer Metastasis Rev. 2015;34(4):635–641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Rang Z, Yang G, Wang YW, Cui F. miR‐542‐3p suppresses invasion and metastasis by targeting the proto‐oncogene serine/threonine protein kinase, PIM1, in melanoma. Biochem Biophys Res Commun. 2016;474(2):315–320. [DOI] [PubMed] [Google Scholar]
- 25. Long HC, Gao X, Lei CJ, Zhu B, Li L, Zeng C, et al. miR‐542‐3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin. Int J Mol Med. 2016;37(4):1112–1118. [DOI] [PubMed] [Google Scholar]
- 26. Cheng DD, Yu T, Hu T, Yao M, Fan CY, Yang QC. MiR‐542‐5p is a negative prognostic factor and promotes osteosarcoma tumorigenesis by targeting HUWE1. Oncotarget. 2015;6(40):42761–42772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. He RQ, Li XJ, Liang L, Xie Y, Luo DZ, Ma J, et al. The suppressive role of miR‐542‐5p in NSCLC: The evidence from clinical data and in vivo validation using a chick chorioallantoic membrane model. BMC Cancer. 2017;17(1):655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Yao JN, Zhang XX, Zhang YZ, Li JH, Zhao DY, Gao B, et al. Discovery and anticancer evaluation of a formononetin derivative against gastric cancer SGC7901 cells. Invest. New Drugs. 2019;37(6):1300–1308. [DOI] [PubMed] [Google Scholar]